Apoptozės amplifikacija nuosekliai skaidant metas tirozinkinazės receptorius kaspazėje | ląstelių mirtis ir diferenciacija

Apoptozės amplifikacija nuosekliai skaidant metas tirozinkinazės receptorius kaspazėje | ląstelių mirtis ir diferenciacija

Anonim

Anotacija

MET tirozinkinazės receptoriaus aktyvinimas hepatocitų augimo / sklaidos faktoriu yra klasikiškai susijęs su ląstelių išgyvenimu. Nepaisant to, streso dirgikliai gali sukelti nuo kaspazės priklausomą MET suskaidymą jo juxtamembrane srityje, sukuriantį proapoptotinį 40 kDa fragmentą (p40 MET). Čia mes pranešame, kad p40 MET iš tikrųjų susidaro dėl papildomo kaspazės skilimo MET jo kraštiniame C-galo regione, kuris pašalina tik keletą aminorūgščių. Mes įrodėme hierarchinę šių skilimų organizavimą, kai C-galo skilimas teikia pirmenybę juxtamembrane. Kaip funkcinė pasekmė, pašalinus paskutines p40 MET aminorūgštis, padidėja jo apoptozinis pajėgumas. Galiausiai ląstelės, ekspresuojančios C receptoriaus kaspazės vietoje mutavusį MET receptorių, nesugeba generuoti p40 MET ir yra atsparios apoptozei, tai rodo, kad p40 MET generacija sustiprina apoptozę. Šie rezultatai atskleidė dviejų pakopų MET skaidymą kaspazės būdu, dėl kurio šis išgyvenimo receptorius buvo pakeistas į proapoptotinį faktorių.

Pagrindinis

Hepatocitų augimo faktorius / sklaidos faktorius (HGF / SF) yra pleiotropinis augimo faktorius, veikiantis per MET tirozinkinazės receptorius įvairiose ląstelių rūšyse. 1, 2, 3 Prijungus HGF / SF, MET receptoriai sumažėja ir jo tirozinkinazės aktyvumas stimuliuojamas receptoriaus autofosforilinimu. Du fosforo tirozino likučiai, esantys receptoriaus C galinėje uodegoje, buvo nustatyti kaip daugiafunkcinė doko vieta, galinti sąveikauti su keliais citoplazminiais signalo keitikliais. 5, 6 Įdarbinimas per šiuos tirozino likučius vaidina lemiamą vaidmenį tarpininkaujant biologinėms reakcijoms į HGF / SF. 7 Priešingai nei teigiama signalizacija, kurią sukelia C-galo uodega, juxtamembrane regione yra kelios neigiamos reguliavimo vietos, kurios yra susijusios su receptorių perdirbimu ir (arba) skaidymu. 8, 9, 10, 11, 12

Ligandu suaktyvinta MET stimuliuoja epitelio ląstelių proliferaciją, išsisklaidymą, invaziją ir morfogenezę, veikia kaip angiogeninis faktorius, pasižymi chemoteatraktantu ir neurotrofiniu aktyvumu. HGF / SF taip pat yra išgyvenimo faktorius, saugantis daugelį ląstelių tipų nuo ląstelių toksiškumo ir apoptozės. 13, 14, 15 fenotipinė hgf ar met null pelių analizė parodė, kad HGF / SF-MET signalizacija yra būtina norint išsaugoti hepatocitus, nes šioms pelėms labai sumažėja kepenų dydis ir pasireiškia didžiulė apoptozė. 16, 17, 18

Neseniai pranešėme, kad MET yra funkcinis kaspazių taikinys. 19 Iš tiesų, mes parodėme, kad streso dirgikliai sukelia kaspazės MET skaidymą prie asparto liekanos 1000, esant ESVD pelės MET juxtamembraninės srities motyvui. Šis skilimas sukuria tarpląstelinį 40 kDa fragmentą, kuriame yra kinazės domenas. Pats p40 MET fragmentas sukelia apoptozę, tuo tarpu negyvas jo kinazės variantas pažeidžia proapoptozinį aktyvumą.

Kaspazių suaktyvinimas apoptozės metu lemia proteolitinį įvairių substratų skaidymą, o tai gali tiesiogiai prisidėti prie apoptozinio proceso. Daugeliu atvejų skilimas inaktyvuoja tikslinį substratą. 20 Pavyzdžiui, kaspazės suaktyvintos DNazės (ICAD) inhibitorius yra inaktyvuotas kaspazės-3 skaidymu, kuris leidžia suaktyvinti kaspazės suaktyvintą DNazę (CAD) ir apoptozės būdingą DNR suskaidymą. Nepaisant to, kai kuriais atvejais buvo nustatyta, kad kaspazės skaidymas suaktyvina tikslinį substratą. Pavyzdžiui, su sero / treonino kinazės, susietos su Rho, susijusios kinazės 1 skilimas padidina jos kinazės aktyvumą, sukeldamas miozino lengvosios grandinės fosforilinimą ir apoptozei būdingą membranos pūtimą. 23, 24 Kaspazės skilimas MET jukstamembraniniame domene lemia proapoptotinio faktoriaus susidarymą, o ligandu suaktyvintas receptorius skatina išgyvenimą. Taigi MET atveju kaspazės skaidymas sukelia pirminį išgyvenimo receptoriaus virsmą proapoptotiniu faktoriu. Šio virsmo kaspazės skilimo mechanizmai nebuvo žinomi. Čia parodyta, kad be juxtamembrane skilimo, MET tirozino kinazė yra skaidoma kaspazėmis per jos C galą. Apibūdindami šią skilimo vietą, mes nustatėme, kad šis papildomas skilimas yra būtinas norint sukelti p40 MET fragmento proapoptotinį aktyvumą.

Rezultatai

Stresas sukelia tiek juxtamembrane, tiek C-galo MET skaidymąsi

Yra žinoma, kad TRK-MET receptoriai tarpininkauja MET specifiniams signalams epitelio ląstelėse, reaguodami į nervų augimo faktorių (NGF). 25, 26 Šios chimeros susideda iš tarpląstelinės TRK-A dalies, sujungtos su transmembraniniu ir viduląsteliniu MET domenais. Norėdami palengvinti jo aptikimą, mes pažymėjome TRK-MET C-terminalo V5 epitopu.

TRK-MET V5 ekspresijos plazmidė buvo stabiliai transfekuota Madin – Darby Canine inksto (MDCK) epitelio ląstelėse. Chimerinis receptorius buvo aptiktas numatyto dydžio, naudojant anti-pelių MET antikūną (1a ir b paveikslai, kairysis skydelis). TRK-MET aptikimas buvo panašiai gautas naudojant anti-V5 antikūną (1a ir b paveikslai, dešinysis skydelis). Šių ląstelių gydymas apoptoziniu induktoriaus anizomicinu per kelias valandas suaktyvina kaspazę-3 ir sukuria p40 MET (1a pav.).

Image

Pažymėta TRK-MET versija atskleidžia C-galo kaspazės skilimą. a ) MDCK epitelio ląstelės, stabiliai transfekuotos TRK-MET V5 WT chimera, buvo iš anksto apdorotos arba ne 1 valandą HGF / SF (10 ng / ml) arba NGF (100 ng / ml), po to apdorotos arba neeksploatuotos 12 h su anizomicinu (Ani., 50 μM ). b ) MDCK epitelio ląstelės, stabiliai transfekuotos TRK-MET V5 WT chimera, 8 valandas buvo gydomos anizomicinu (Ani., 50 μM ), esant arba neturint zVAD-FMK (zVAD, 20 μM ). . ( a, b ) Kiekvienai būklei tas pats baltymų kiekis buvo išskaidytas 10% SDS-PAGE ir analizuotas atliekant Western blot analizę, naudojant antikūną, nukreiptą prieš pelės MET (viršutinė panelė). Membranos nuėmimas ir pakartotinis atkūrimas buvo atliekamas naudojant anti-V5 antikūną (dešinįjį skydelį) ir anti-ERK2 antikūną, kad būtų galima įvertinti palyginamą apkrovą (apatinė panelė). Apatinė filtro dalis buvo analizuojama atliekant Western blot analizę, naudojant anti-aktyvų kaspazės-3 antikūną (vidurinis skydelis). Rodyklės rodo p150 TRK-MET (visiškai glikozilinto), p125 TRK-MET (iš dalies glikozilinto) ir p40 MET fragmento padėtis. ( c ) TRK-MET V5-His receptoriaus schema su pelių sekomis, esančiomis juxtamembrane kaspazės vietoje ir spėjamoje C-galo kaspazės vietoje. ( d ) MDCK ląstelių ekstraktai, stabiliai transfekuoti TRK-MET V5 WT, D1000N, D1374N, D1000 / 1374N, inkubuojami su išgryninta kaspaze-3. Tada mėginiai buvo išskaidyti 10% SDS-PAGE ir analizuojami atliekant Western blot analizę, naudojant anti-pelės MET antikūną (kairysis skydelis). Filtras buvo nuimtas ir pakartotinai suaktyvintas naudojant anti-V5 antikūną (dešinysis skydelis). Rodyklės rodo p150 TRK-MET, p125 TRK-MET, p40 MET fragmento ir p40 MET-V5 fragmento padėtis

Visas dydis

Remiantis antioapopotinėmis endogeniniu būdu aktyvuotų MET receptorių savybėmis, HGF / SF stimuliacija paskatino MDCK ląstelių išgyvenimą, lydimą kaspazės-3 aktyvacijos sumažėjimo ir p40 MET kartos (1a pav.). Panašus poveikis buvo gautas naudojant NGF MDCK ląstelėse, stabiliai transfekuotose TRK-MET, patvirtinantis funkcinį chimeros aktyvavimą (1a pav.). Be to, gydymas visos kaspazės inhibitoriumi zVAD slopino kaspazės-3 aktyvaciją ir p40 MET susidarymą (1b paveikslas).

Nors šie duomenys buvo tikėtini, V5 antikūnas negalėjo aptikti sugeneruoto p40 MET (1a ir b pav.), Kas rodo, kad C-galo žymė buvo prarasta skilimo metu apoptozės metu. Tai paskatino mus toliau nagrinėti galimą nuo C-galo kaspazės priklausomą MET skaidymą.

C-galo skilimas vyksta asparto rūgštyje 1374

Kadangi pelės MET yra numanoma kaspazės vieta (DNID 1374 ), esanti penkiose aminorūgštyse prieš sustabdymo kodoną, mes ištyrėme, ar šioje vietoje gali atsirasti kaspazės skilimas (1c paveikslas). Eksperimentai buvo atlikti naudojant MDCK ląsteles, stabiliai ekspresuojančias TRK-MET receptorius, kuriuose asparto rūgštis buvo pakeista asparaginu juxtamembrano (D1000N) ir C-galo (D1374N) srityse (1c paveikslas). Ląstelių ekstraktai buvo inkubuojami su aktyvia kaspaze-3, o TRK-MET receptoriai buvo aptikti naudojant anti-MET arba anti-V5 antikūnus. TRK-MET WT inkubavimas su kaspaze-3 leido generuoti p40 MET su anti-MET antikūnu (1d paveikslas, kairysis skydelis). Priešingai, p40 MET ir viso ilgio MET receptoriai nebuvo aptikti naudojant anti-V5 antikūną, parodantį C-galo skilimą (1d pav., Dešinė panelė). Kaip ir tikėtasi, iš TRK-MET D1000N ekspresuojančių ląstelių p40 MET nebuvo generuojamas, tuo tarpu C-galo skilimas vis tiek buvo efektyvus. Iš TRK-MET D1374N vis dar buvo sugeneruotas p40 MET ir aptiktas anti-V5 antikūnu (1d pav.). Sukurto p40 MET fragmento dydis buvo šiek tiek padidintas, atsižvelgiant į V5 žymę. Iš abiejose vietose mutavusių TRK-MET, p40 MET kartos buvo panaikintos ir išsaugotas TRK-MET V5 nustatymas. Šie rezultatai rodo, kad in vitro C-galo skaidymui kaspazės-3 reikia asparto rūgšties D1374. Panašiai dėl D1371N mutacijos buvo panaikintas C-galo skilimas, nurodant, kad DNID seka yra kaspazės taikinio motyvas (duomenys nepateikti).

C-galo kaspazės vietos mutacija užkerta kelią juxtamembrane skilimui

Toliau įvertinome C-galo kaspazės vietos mutavimo pasekmę MET receptoriaus, kuriam veikiamas ląstelių stresas, likimui. MDCK ląstelės buvo laikinai transfekuotos TRK-MET chimeromis, o ląstelių ekstraktai buvo analizuojami Western blot būdu, naudojant anti-MET arba anti-V5 antikūnus. Ląstelėse, perkeltose su TRK-MET WT, buvo aptiktas p40 MET ir viso ilgio receptoriai (2a pav.). Tokiu atveju p40 MET buvo aptiktas kaip dubletas su viršutine juosta, atitinkančia fosforilintą p40 MET. Ląstelėse, perkeltose TRK-MET D1000N, p40 MET nepastebėta. Verta pastebėti, kad trumpalaikio transfekcijos sukelto streso pakako skilimui skatinti. Nors tai slopino kaspazės inhibitorius (papildomi duomenys, S1 pav.), Mes nepastebėjome kaspazės-3 aktyvacijos laikinai perkeltose ląstelėse. Tačiau šis stresas gali paskatinti silpną kaspazės-3 aktyvavimą, kuris gali būti aptikimo lygyje, arba suaktyvinti kitas kaspazes. Svarbu tai, kad ląstelėse, perkeltose su TRK-MET D1374N, p40 MET aptikimas naudojant anti-MET antikūną buvo labai sumažėjęs, palyginti su TRK-MET WT (2b paveikslas, kairysis skydelis, 2 ir 4 juostos). Pakartotinis su V5 antikūnu rodo, kad likęs p40 MET, generuotas TRK-MET D1374N, vis dar pažymėtas V5 (2a paveikslas, dešinysis skydelis, 4 juosta). Todėl šis rezultatas rodo, kad C-galo kaspazės vietos mutacija apsaugo nuo skilimo juxtamembrano srityje.

Image

C-galo kaspazės vietos mutacija slopina juxtamembrane skilimą. ( a ) MDCK ląstelės buvo laikinai perneštos tuščiais vektoriais arba ekspresuojančiais TRK-MET V5 WT, D1000N, D1374N ir D1000 / 1374N. Kitą dieną ląstelės buvo lizuotos. Kiekvienai būklei tas pats baltymų kiekis buvo išskaidytas 10% SDS-PAGE ir analizuotas atliekant Western blot analizę, naudojant antikūną, nukreiptą prieš pelės MET (kairysis skydelis). Filtras buvo nuimtas ir pakartotinai suaktyvintas naudojant anti-V5 antikūną (dešinysis skydelis). Rodyklės rodo TRK-MET V5 pozicijas, o linijos rodo p40 MET ir p40 MET V5 fragmentų padėtis. ( b ) MDCK epitelio ląstelės, stabiliai transfekuotos TRK-MET V5 WT, D1000N, D1374N, D1000 / 1374N, 8 valandas buvo gydomos anizomicinu (Ani., 50 μM ). Kiekvienai būklei tas pats baltymų kiekis buvo išskaidytas 10% SDS-PAGE ir analizuotas atliekant Western blot analizę, naudojant anti-pelės MET antikūną (viršutinė panelė). Filtras buvo nufilmuotas ir pakartotinai pakartotinai panaudotas naudojant anti-V5 antikūną (dešinysis skydelis) ir anti-ERK2 antikūnas, kad būtų galima įvertinti palyginamą apkrovą (apatinė panelė). Apatinė filtro dalis buvo analizuojama atliekant Western blot analizę, naudojant anti-aktyvų kaspazės-3 antikūną (vidurinis skydelis). Rodyklės rodo TRK-MET V5, p40 MET ir p40 MET-V5 fragmentų padėtis. ( c ) Stabilios MDCK ląstelės 8 valandas buvo gydomos anizomicinu (Ani., 50 μM ) arba TNF α (30 ng / ml) / cikloheksimidu (CHX, 10 μg / ml). Tada ląstelės buvo nudažytos Trypan Blue. Nustatytas mirusių ląstelių, nudažytų mėlyna spalva, procentas ( n = 3; ± SD)

Visas dydis

Norint toliau tirti šį rezultatą, stabiliai transfekuotose MDCK ląstelėse, kurios ekspresuoja palyginamus TRK-MET lygius, buvo sukelta apoptozė. Kaip parodyta 2b paveiksle, atlikus proapoptotinius dirgiklius, p40 MET buvo sugeneruotas iš TRK-MET WT, bet ne iš TRK-MET D1000N. Ląstelės, išreiškiančios TRK-MET su D1000N mutacija, taip pat parodė mažesnį kaspazės-3 aktyvavimą (2b paveikslas) ir mažesnę ląstelių mirtį, matuojant trypano mėlynojo išskyrimo būdu (2c paveikslas). Tai rodo, kad ląstelės, ekspresuojančios TRK-MET su D1000N mutacija, buvo atsparesnės apoptozei. Šie rezultatai atitinka ankstesnius tyrimus, rodančius, kad asparto rūgštis D1000 ir greta esantis fosforilintas tirozinas Y1001 yra CBL sąveikos motyvas, kuris susijęs su aktyvuoto MET ubikvitinimu ir skaidymu. Atitinkamai, buvo įrodyta, kad D1000 arba Y1001 mutacija sutrikdė MET – CBL sąveiką ir sukėlė MDCK ląstelių konstitucinį išsibarstymą. 10, 25, 27 MDCK ląstelės, ekspresuojančios TRK-MET D1000N, turi panašią konstitucinę sklaidą (papildomi duomenys, S2 pav.). Svarbu tai, kad ląstelėse, ekspresuojančiose TRK-MET D1374N, p40 MET susidarymas buvo stipriai sumažėjęs (2b paveikslas, kairysis skydelis, 2 ir 6 juostos). Panašūs rezultatai buvo gauti atliekant laiko eigos eksperimentus po gydymo įvairiais apoptozės induktoriais, įskaitant anizomiciną, naviko nekrozės faktorių (TNF) α / cikloheksimidą ir staurosporiną (3 paveikslas).

Image

Apoptozinio proceso metu sukelta p40 MET karta. MDCK epitelio ląstelės, ekspresuojančios TRK-MET V5 WT ir D1374N, nurodytą laiką buvo gydomos anizomicinu (Ani., 50 μM ), TNF α (30 ng / ml) / cikloheksimidu (CHX, 10 μ g / ml) arba staurosporinu. (1 μM ). Kiekvienai būklei tas pats baltymų kiekis buvo išskaidytas 10% SDS-PAGE ir analizuotas atliekant Western blot analizę, naudojant anti-pelės MET antikūną (viršutinę skydą ir vidurinę skydą). Apatinė filtro dalis buvo analizuojama atliekant Western blot analizę, naudojant anti-aktyvų kaspazės-3 antikūną (apatinė panelė). Rodyklės rodo TRK-MET V5 ir p40 MET fragmento padėtis

Visas dydis

Kartu mūsų rezultatai rodo, kad C-galo kaspazės svetainės mutacija nepalanki juxtamembrane skilimui ir vėliau p40 MET kartai, atskleidžiant nuoseklų skilimų organizavimą. Verta paminėti, kad nuoseklus MET skaidymas vizualizuojamas tik ląstelėse po streso indukcijos. Tiesą sakant, skilimo in vitro metu C-galo vietos mutacija neslopino juxtamembranos skilimo, tai yra tikėtina efektyvaus skilimo, kurį sukelia perteklius išgrynintos kaspazės, pasekmė.

MET receptoriaus pašalinimas kaspazės-3 dėka

Norėdami palyginti įvairių kaspazių sugebėjimą skaidyti MET, ląstelių ekstraktai iš MDCK ląstelių, ekspresuojančių TRK-MET V5, buvo inkubuojami su išgrynintomis kaspazėmis. Kaip parodyta 4a paveiksle, tik kaspazė-3 galėjo generuoti p40 MET. Be to, ekstraktuose, apdorotuose kaspaze-3, nei p40 MET, nei TRK-MET nebuvo aptikti naudojant anti-V5 antikūną (4a paveikslas, dešinė panelė), rodantį, kad MET yra in vitro kaspazės-3 substratas abiejose vietose.

Image

Kaspazė-3 skaido MET receptorių. ( a ) MDCK ląstelių ekstraktai, stabiliai transfekuoti TRK-MET V5 WT chimera, inkubuojami su išgryninta kaspaze-3, -6, -7, -8 arba -9. Mėginiai buvo išskaidyti 10% SDS-PAGE ir analizuojami atliekant Western blot analizę, naudojant antikūną, nukreiptą prieš pelės MET (kairysis skydelis). Filtras buvo nuimtas ir pakartotinai suaktyvintas naudojant anti-V5 antikūną (dešinysis skydelis). ( b ) MCF-7 ir MCF-7 / kaspazės-3 ląstelės buvo laikinai perneštos vektoriais, tuščiais arba ekspresuojančiais TRK-MET V5 WT. Kitą dieną ląstelės buvo lizuotos. Kiekvienai būklei tas pats baltymų kiekis buvo išskaidytas 10% SDS-PAGE ir analizuotas atliekant Western blot analizę, naudojant anti-pelės MET antikūną (kairysis skydelis). Filtras buvo nuimtas ir pakartotinai suaktyvintas naudojant anti-V5 antikūną (dešinysis skydelis). Kad būtų galima įvertinti kaspazės-3 ekspresiją MCF-7 ir MCF-7 / kaspazės-3, buvo atliktas Western blot tyrimas naudojant anti-kaspazės-3 antikūnus. Rodyklės rodo padėtį TRK-MET ir p40 MET fragmentą

Visas dydis

Norėdami įvertinti ląstelėse kaspazės-3 vaidmenį skiliant MET, mes transfekavome TRK-MET receptorius normaliose MCF-7 ląstelėse, kurios neišreiškia kaspazės-3, ir MCF-7 ląstelėse, kuriose vėl buvo įvesta funkcinė kaspazė-3. (MCF-7 / kaspazė-3) 28 (4b pav.). MCF-7 / kaspazės-3 ląstelėse p40 MET aptikimas buvo stipriai padidintas, palyginti su normaliu MCF7 (4b paveikslas, kairysis skydelis). Reikėtų pažymėti, kad TRK-MET transfekcija be papildomo streso buvo pakankama norint sukelti p40 MET susidarymą, kurį panaikino kaspazės inhibitorius (papildomi duomenys, S1 pav.). C-galo skilimas taip pat buvo efektyvus, nes p40 MET nebuvo aptiktas naudojant anti-V5 antikūną (4b paveikslas, dešinė panelė). Tai rodo, kad kaspazė-3 skatina MET skaidymą ląstelėse.

Žmogaus MET receptoriaus juxtamembraninis ir C-terminalas

MET receptoriaus C galinė uodega yra silpnai konservuota (5a pav.). Zebros žuvyse ir ksenopuose galimo kaspazės motyvo nerasta, tuo tarpu viščiukų, šunų ir pelių atveju sutinkamas kaspazės motyvas (DXXD). Ape ir žmogaus organizme vieta atrodo dubliuojama (DXXDDXXD).

Image

Žmogaus MET suskaidomas kaspazėmis jo C galinėje dalyje. a ) Danio renio , Xenopus laevis , Gallus gallus , Mus musculus , Canis familiaris , Pan troglodytes ir Homo sapiens MET tirozinkinazės receptorių aminorūgščių sekų suderinimas . C-galo daugia substrato surišimo vietos tirozino liekanos yra paryškintos, o numanomos kaspazės vietos paryškintos ir pabrauktos. ( b ) Kaspazės-3 rekonstruotos MCF-7 ląstelės buvo laikinai transfekuotos 1 μg / ml vektoriaus, tuščio arba išreiškiančio žmogaus MET WT, negyvos kinazės (KD) arba neišvalomo mutanto (Juxta. mutantas), kuriame valino liekana V1001 Juxtamembrano skilimo vietos buvo pakeistos alaninu (V1001 žmogaus seka atitinka V999 pelių seka). Kitą dieną ląstelės buvo lizuotos. Kiekvienai būklei tas pats baltymų kiekis buvo išskaidytas 10% SDS-PAGE ir analizuotas atliekant Western blot analizę, naudojant antikūną, nukreiptą prieš MET kinazės domeną (kairysis skydelis). Filtras buvo pašalintas ir pakartotinai panaudotas antikūnu, atpažįstančiu žmogaus MET C galą (C-28 antikūnas) (dešinysis skydelis). Rodyklės rodo nesubrendusio ir subrendusio MET ir p40 MET fragmento vietas. ( c ) HeLa ląstelės nurodytą laiką buvo apdorotos anisomicinu (Ani., 50 μM ). Kiekvienai būklei tas pats baltymų kiekis buvo išskaidytas 10% SDS-PAGE ir analizuotas atliekant Western blot analizę, naudojant antikūną, nukreiptą prieš MET kinazės domeną (kairysis skydelis). Filtras buvo pašalintas ir pakartotinai panaudotas antikūnu, atpažįstančiu žmogaus MET C galą (C-12 antikūnas) (dešinysis skydelis). Apatinė filtro dalis buvo analizuojama atliekant Western blot analizę, naudojant anti-aktyvų kaspazės-3 antikūną (apatinė panelė). Rodyklės rodo nesubrendusio ir subrendusio MET ir p40 MET fragmento vietas

Visas dydis

Mes nustatėme, kad anti-MET antikūnai, nukreipti prieš žmogaus receptoriaus C galinę uodegą, negalėjo atpažinti sutrumpinto MET iš C-galo kaspazės vietos D1376 (papildomi duomenys, S3A pav.). Naudodami šiuos antikūnus mes patikrinome, ar žmogaus p40 MET yra suskaidytas C-terminale. Mes laikinai transfekavome MCF-7 / kaspazės-3 ląsteles su viso ilgio žmogaus MET WT, negyva kinaze ar mutavusią juxtamembrane kaspazės vietoje. Naudojant anti-MET antikūną, atpažįstantį kinazės domeną, buvo aptikti negyvi WT ir kinazės MET receptoriai ir jų p40 MET fragmentai. Kaip ir tikėtasi, fragmentas nebuvo sukurtas iš juxtamembrane kaspazės vietos mutanto (5b paveikslas, kairysis skydas). Priešingai, naudojant anti-žmogaus MET antikūną, atpažįstantį C-galūnę, buvo aptiktas viso ilgio MET, tuo tarpu p40 MET fragmentų nebuvo (5b pav., Dešinė panelė). Šie rezultatai rodo, kad panašiai kaip pelės MET, žmogaus p40 MET yra suskaidytas jo C galinėje dalyje.

Apoptozės metu, siekiant sekti žmogaus endogeninius C-galinius ir juxtamembraninius skilimus, žmogaus gimdos kaklelio karcinomos epitelio ląstelės (HeLa ląstelės) buvo gydomos anizomicinu ir kas valandą lizuojamos. Western blot, naudojant anti-MET kinazę, atskleidė ir viso ilgio MET, kurio aptikimas mažėja tik šiek tiek apoptozės metu, ir p40 MET, gautą praėjus 1 val. Po apdorojimo (5c paveikslas, kairysis skydelis). Priešingai, reprobuotas anti-MET C-galo antikūnas parodė, kad apoltozės metu aptiktas pilno ilgio MET aptikimas ir nėra p40 MET aptikimo. Antikūnų zondavimo tvarkos keitimas davė panašius rezultatus (Papildomi duomenys, S3B). Šie rezultatai patvirtina žmogaus p40 MET skaidymą C-gale ir dar labiau įrodo, kad yra membranoje tvirtinamas C receptoriaus C galas, sutrumpintas galu, kuris tampa pagrindine forma kartu su apoptozė.

P40 MET skaidymas C-gale sustiprina jo proapoptotinį aktyvumą

Norėdami įvertinti p40 MET C-galo sutrumpinimo biologinį tinkamumą, sukūrėme p40 MET ilgio (nuo juxtamembrane skilimo vietos iki C-terminalo galo) ir p40 MET mažą (nuo juxtamembrane iki C-termino skilimo). svetainė). Imunofluorescencinė analizė atskleidė p40 MET konstruktų ekspresiją tiek laikinai transfekuoto NIH3T3 citoplazmoje, tiek branduolyje. p40 MET ekspresuojančios ląstelės buvo suapvalintos, o Hoechst dažymas parodė būdingus apoptozės požymius, stipriai sumažėjus DNR kiekiui arba susikondensavus DNR (6a paveikslas, viršutinės plokštės). Įdomu tai, kad apie 17% p40 MET mažai perkeltų ląstelių buvo teigiamos dėl aktyvaus kaspazės-3 dažymo, tuo tarpu 12% aktyvių kaspazės-3 teigiamų ląstelių buvo pastebėta ilgą laiką ekspresuojančiose p40 MET ląstelėse, tai rodo, kad C-galo skilimas pagerina fragmento proapoptotinis aktyvumas (6a pav., apatinės plokštės). p40 MET mažų kinazę negyvai ekspresuojančių ląstelių morfologija normali, aktyvių kaspazės-3 teigiamų ląstelių procentas atitinka bazinę apoptozę transfekuotose ląstelėse. Panašūs rezultatai buvo gauti suskaičiavus apoptozinius branduolius dažant Hoechst. Ląstelių, išreiškiančių TPR-MET, onkogeninę MET formą, morfologija buvo normali, o ląstelių žūties lygis buvo panašus į negyvos p40 MET kinazės (6b pav.), Rodantį, kad konstitucinio aktyvaus MET kinazės negimdinė ekspresija nesukelia apoptozės.

Image

C-galo skilimas padidina ląstelių žūtį, sukeltą p40 MET. ( a ir b ) NIH3T3 ląstelės buvo laikinai perkeltos vektoriais, ekspresuojančiais arba mažą p40 MET laukinio tipo (p40 MET mažą), p40 MET mažą negyvą kinazę (p40 MET KD), p40 MET ilgį, arba TPR-MET. Praėjus keturiasdešimt aštuonioms valandoms po transfekcijos, branduoliai buvo aptikti naudojant Hoechst dažymą (Hoechst, mėlynas dažymas), o imunofluorescencija buvo atlikta naudojant anti-MET antikūną (Anti-MET, žalias dažymas) ir anti-suskaidytą kaspazę-3 (anti-skiltą kaspazę) -3, raudonas dažymas). Baltos rodyklės rodo reprezentacines ląsteles, ekspresuojančias perkeltą p40 MET. Nustatytas kaspazės-3 teigiamų ląstelių ir apoptozinių branduolių (kondensuotos DNR) procentas nuo MET transfekuotų ląstelių. Kiekviename šulinyje buvo suskaičiuota mažiausiai 200 ląstelių trijuose skirtinguose šulinėliuose ( n = 3; ± SD). c ) HEK293 ląstelės, kultivuojamos šešių šulinėlių plokštelėse, buvo perneštos tuščiu vektoriu arba vektoriais, išreiškiančiais mažą p40 MET, p40 MET mažą KD, p40 MET ilgį arba p40 MET ilgį D1371N. Po dviejų dienų ląstelės buvo suskaidytos į keturis 100 mm indus, o likusios ląstelės buvo lizuotos Western blot analizei. Tada ląstelės buvo parinktos 10 dienų naudojant G418 ir suskaičiuotos. Rezultatai pavaizduoti kaip išgyvenusių ląstelių procentas, remiantis tuščia vektoriaus transfekcija ( n = 3; ± SD). Vienas indas iš kiekvienos būklės taip pat buvo nudažytas ir parodytas (apatinė plokštė). ( d ) Ląstelių ekstraktai, paruošti antrą dieną po transfekcijos, buvo išskaidomi 10% SDS-PAGE ir analizuojami atliekant Western blot analizę, naudojant anti-pelės MET antikūną, norint įvertinti ekspresiją iš transfekuoto vektoriaus (viršutinė panelė). Filtras buvo nuimtas ir pakartotinai pertvarkytas naudojant anti-fosfo MET antikūną (apatinė panelė)

Visas dydis

Norint įvertinti šiuos rezultatus, HEK293 ląstelės buvo perkrautos p40 MET konstruktais ir atrinktos G418, nes ekspresijos vektoriuje yra šis atsparumo antibiotikams genas. Po 10 dienų atrankos neperkeltos ir p40 MET transfekuotos ląstelės mirė, tuo tarpu daugiau kaip 60% ląstelių, perkeltų p40 MET kinaze negyvų, išgyveno, naudodamos tuščią vektorių kaip atskaitą (6c paveikslas). Be to, mes nustatėme, kad p40 MET mažas yra stipresnis nei p40 MET ilgio, kad sukeltų ląstelių mirtį. Šis poveikis buvo dar stipresnis naudojant p40 MET D1371N, kas rodo, kad p40 MET ilgio sukelta ląstelių žūtis iš dalies yra tolesnio C-galo skilimo pasekmė. Praėjus dviem dienoms po transfekcijos ir prieš atrenkant G418, buvo patikrinta p40 MET ekspresija (6d paveikslas). Šiame etape visi p40 MET buvo išreikšti ir, priešingai nei mirusi p40 MET kinazė, p40 MET ilgos ir mažos buvo aptiktos kaip tepinėlis, atitinkantis jų fosforilintas ir nefosforilintas formas (6d paveikslas). Daugelio eksperimentų metu mirusi p40 MET kinazė yra mažiau išreikšta nei p40 MET kinazė, tikėtina jos nestabilumo pasekmė. Tai gali paveikti HEK293 ląstelių sukeltą ląstelių mirtį. Tačiau papildomame S4 ​​paveiksle mes parodome, kad kai p40 MET WT ir kinazės mirtis išreiškiami panašiu lygiu, mes vis tiek stebėjome veiksmingą išgyvenimą mirus p40 MET kinazei. Apskritai šie rezultatai rodo, kad p40 MET fragmento skaidymas C-gale sustiprina jo proapoptotinį aktyvumą.

C-galo kaspazės vietos mutacija apsaugo nuo nedidelio streso sukeltos ląstelių mirties

P40 MET susidarymą galima užkirsti kelią mutacijomis juxtamembrane srityje (D1000N) ir C galinėje uodegoje (D1374N). Tačiau TRK-MET D1000N ląstelės turi konstitucinį išsklaidytą fenotipą (papildomi duomenys, S2 pav.) Ir buvo atsparios apoptozei (2b paveikslas). Priešingai, ląstelės, ekspresuojančios TRK-MET WT ir TRK-MET D1374N, turėjo normalią salelių struktūrą ir išsisklaidė panašiai, reaguodamos į NGF ir HGF / SF (7a pav.). Be to, reaguodami į NGF, TRK-MET WT ir D1374N panašiai sugebėjo įdarbinti signalinį baltymą GRB2 ir suaktyvinti mitogeno aktyvuotos baltymo kinazės (MAPK) tarpląsteliniu būdu reguliuojamą kinazę (ERK) (7b paveikslas). Šie rezultatai rodo, kad D1374N mutacija nekeičia bazinio ir ligandų sukelto TRK-MET chimerų aktyvumo. Todėl, norėdami įvertinti p40 MET kartos dalyvavimą apoptozėje, mes panaudojome TRK-MET D1374N ląsteles.

Image

C-galo kaspazės vietos mutacijos įtaka ląstelių mirčiai, kurią sukelia silpnas stresas. ( a ) MDCK epitelio ląstelės, ekspresuojančios TRK-MET V5 WT ir D1374N, buvo pasėtos mažo tankio. Po dviejų dienų ląstelės buvo kultivuojamos 24 valandas, kai nebuvo (-) arba nebuvo 10 ng / ml HGF / SF arba 100 ng / ml NGF, ir buvo nufotografuota (padidinimas × 80). ( b ) MDCK epitelio ląstelės (1, 10 6 ląstelės / 100 mm lėkštele), ekspresuojančios ar neleidžiančios TRK-MET V5 WT ir D1374N, per naktį buvo auginamos DMEM-0% FCS ir stimuliuojamos arba ne 10 min., naudojant 200 ng / ml NGF. . Kiekvienai būklei tas pats kiekis ląstelių lizato buvo išspręstas 10% SDS-PAGE ir analizuotas Western blot analize, naudojant anti-pelės MET antikūną (pirmoji panelė) arba anti-fosforilintą ERK1 ir 2 (antroji panelė) antikūną. Filtras buvo nuimtas ir pakartotinai perduotas naudojant anti-ERK2 antikūną (trečioji panelė). Iš tų pačių ekstraktų imunoprecipitacija buvo atlikta naudojant polikloninį antikūną prieš pelės MET ir apdorota Western blot analizei naudojant anti-GRB2 antikūną (paskutinė panelė). c ) MDCK epitelio ląstelės (2, 10 5 ląstelės / 35 mm lėkštelėje), stabiliai transfekuotos TRK-MET V5 WT arba D1374N, 1 dieną buvo auginamos DMEM-10% FCS ir apdorotos anizomicinu (Ani., 0, 3 μM ). . Kiekvieną dieną ląstelės buvo lizuojamos ir baltymai išskaidomi 10% SDS-PAGE ir analizuojami atliekant Western blot analizę, naudojant antikūną, nukreiptą prieš pelės MET (viršutines plokštes). Panašūs ekstraktai buvo atskirti 12% SDS-PAGE, ir Western blot buvo atliktas naudojant anti-aktyvųjį kaspazės-3 antikūną (apatinė panelė). Rodyklės rodo TRK-MET V5 ir p40 MET padėtis. d ) prieš lizę nuotraukos buvo padarytos šviesos mikroskopu (padidinimas × 40)

Visas dydis

Norėdami įvertinti p40 MET susidarymo pasekmę apoptozinio atsako metu, TRK-MET WT arba TRK-MET D1374N ląsteles apdorojome maža anizomicino doze. Esant tokiai silpnai stresinei situacijai, TRK-MET WT ląstelės pradėjo atsiriboti iki 3 dienos, o visos ląstelės mirė iki 7 dienos (7d paveikslas). Ši ląstelių mirtis koreliavo su p40 MET fragmento susidarymu ir kaspazės-3 aktyvacija (7c paveikslas). TRK-MET D1374N ląstelėse, priešingai, gydymas anisomicinu nesukėlė ląstelių atsiskyrimo, o kaspazės-3 ar p40 MET nebuvo rasta net po 7 dienų. Taigi, užkertant kelią C-galinio MET skaidymo ir vėlesnio p40 MET kartos sumažėjimo, atsirado atsparumas ląstelių mirčiai.

Diskusija

Šioje ataskaitoje mes parodome, kad MET tirozinkinazės receptorius yra suskaidomas apoptozės metu priklausomai nuo kaspazės tiek jo juxtamembrane, tiek C-gale. Mutacijos analizė pelių MET rodo, kad šie skilimai vyksta esant asparto rūgščiai 1000 ir 1374. C-galo skilimas sukuria nenustatomą fragmentą, kurį sudaro paskutinės penkios pelės MET aminorūgštys. Nepaisant to, šis paslėptas skaidymas buvo įrodytas naudojant TRK-MET receptoriaus pažymėtą C-galo versiją, kurioje C-galo V5 epitopo praradimas paryškina skilimą.

C-galo galūnės aminorūgščių seka evoliucijos metu yra silpnai išsaugota (5a pav.). Tačiau mes parodėme, kad pelių ir žmogaus MET receptoriai yra skaidomi kaspazėmis šia seka, funkcinėje kaspazės vietoje. Sekų analizė rodo, kad atsižvelgiant į gyvūnų rūšis galima sustiprinti C-galo kaspazės vietą. Žuvų C-galinėje uodegoje ir ksenopuso MET nerasta jokios sutikimo kaspazės vietos, šios vietos (DXXD) yra vištienoje, šunyje ir pelėje, o dubenyje - apuokų ir žmonių (DXXDDXXD). Taigi, nors kraštutinė C galinė MET uodega yra silpnai konservuota, mes nustatėme funkcinę kaspazės vietą, kuri leidžia skilti MET apoptozės metu.

Nors C-galo skilimas pašalina tik paskutines penkias pelių MET aminorūgštis, jis turi stiprių padarinių mechanizmams, kuriais sukuriamas p40 MET. Pirmiausia įrodoma, kad skilimai yra hierarchiniai, o C-galo skilimas yra palankus juxtamembrane. Todėl šie du skilimai gali atitikti dvigubą užraktą, galintį užkirsti kelią p40 MET susidarymui. Kaip antroji dvigubo skilimo pasekmė, susidaro p40 MET fragmentas, sutrumpintas iš paskutinių penkių aminorūgščių, ir jis yra efektyvesnis sukeldamas apoptozę. Šie rezultatai kartu parodo, kad C-galo skilimas yra susijęs su MET receptoriaus formavimu į proapoptotinį faktorių.

C-galo skilimo ir jo funkcinių padarinių p40 MET identifikavimas rodo, kad C-galo galūnė yra reguliavimo sritis. Kai kuriems tirozinkinazės receptoriams C-galo uodegos buvo akivaizdžios kaip neigiami reguliavimo domenai. Pavyzdžiui, Tie2 arba iš trombocitų gauto augimo faktoriaus beta receptoriaus (PDGF β -R) C-galinių sekų delecija sustiprina jų tirozinkinazės aktyvumą. Remiantis tuo, kad peptidas, esantis C-galo daugia substrato surišimo vietoje, slopina kinazės aktyvumą, siūlomas MET slopinantis C-galo uodegos vaidmuo. 31 Tada įdomu pasiūlyti, kad MET skaidymas C-gale gali palengvinti slopinančią konformaciją, kuri gali būti susijusi su apoptozinio atsako indukcija.

Mūsų įrodymas, kad p40 MET yra apoptozinis, kelia klausimą, ar jis prisideda prie ląstelių mirties amplifikacijos. TRK-MET D1000N ląstelės nebuvo naudojamos šiam tikslui. Iš tikrųjų, asparto rūgštis D1000 priklauso CBL surišimo motyvui (DYR), kuris prisideda prie MET visuotinio kvotinimo ir žeminančio reguliavimo, reaguojant į HGF / SF. Tirozino 1001 arba asparto rūgšties 1000 mutacija sumažina CBL prisijungimą, sąlygojantį MDCK 25, 27 ląstelių konstitucinį išsisklaidymą ir atsparumą apoptozei. Tačiau šiame tyrime, identifikuodami papildomą kaspazės skilimo vietą, mes sukūrėme antrą mutantą, kuriame užkertamas kelias p40 MET kartai. Priešingai nei D1000N mutacija, D1374N mutacija nekeitė MET savybių, įskaitant jos gebėjimą tarpininkauti RAS-ERK signalizacijos aktyvacijai ir ląstelių išsibarstymui. Esant lengvoms streso sąlygoms, TRK-MET D1374N ląstelės išgyveno ilgiau, palyginti su TRK-MET WT ląstelėmis, tai rodo, kad p40 MET kartos padidina ląstelių mirtį. Šis apoptozės amplifikacija nebuvo pastebėtas MDCK, išreiškiančiame TRK-MET WT ir D1374N, kai buvo naudojama didelė anizomicino dozė, kuri per kelias valandas sukėlė didžiulę ląstelių mirtį. Šie rezultatai rodo, kad p40 MET karta nėra būtina norint sukelti apoptozę, kurią sukelia stiprūs streso dirgikliai, tuo tarpu ji gali perjungti ląsteles į apoptozę esant silpnoms streso sąlygoms. Šioje eilutėje verta pastebėti, kad p40 MET nėra stiprus apoptozės induktorius, o apoptozės lygis p40 MET transfekuotose ląstelėse neviršija 20%. Todėl darome išvadą, kad p40 MET gali veikti kaip stiprintuvas, o ne kaip apoptozės induktorius.

Nors daugelis kaspazės substratų yra suskaidomi keliose vietose 32, šių skilimų hierarchinė organizacija yra menkai apibrėžta. Ras GTPazę aktyvinantis baltymas (RasGAP) baltymas yra skaidomas keliose vietose kaspazės-3 dėka. Pirmasis skilimas įvyksta greitai apoptozės metu ir yra palankus antrajam. 33, 34 Pirmasis skilimas leidžia generuoti antiapoptozinį fragmentą, o antrasis skilimas paverčia jį mažesniais proapoptotiniais fragmentais. Tokiu atveju nuoseklus skaidymas palaiko modelį, kuriame RasGAP veikia kaip kaspazės aktyvumo jutiklis, kad nustatytų, ar ląstelė išgyvens, ar ne. 35 MET atveju dėl jo nuoseklaus skilimo atsiranda sutrumpėjęs MET, suskaidomas tik jo C galinėje srityje. Nors po šio pirmojo skilimo juxtamembraninis skilimas leidžia generuoti p40 MET, sutrumpėjęs MET išilgai apoptozės tampa pagrindine membranos MET receptorių forma. Ši nauja MET forma, kurią gali sukelti HGF / SF, gali įgyti specifinių funkcijų, kurios taip pat gali būti svarbios reguliuojant balanso išgyvenamumą / apoptozę, kurią sukelia tirozinkinazės receptoriaus MET.

Medžiagos ir metodai

Citokinai, vaistai ir ląstelių kultūros

Žmogaus rekombinantinis HGF / SF buvo įsigytas iš „Peprotech“, o β- NGF ir TNF- α - iš „R&D Systems“. Anizomicinas buvo įsigytas iš „Calbiochem“, cikloheksimidas iš „ICN Biomedicals“ ir staurosporinas iš „Sigma“. Bendrasis kaspazės inhibitorius, Z-Val-Ala-Asp (OMe) -fluormetilketonas (zVAD-FMK), buvo įsigytas iš „Kamiya Biomedical Company“. MDCK epitelio ląstelės, 293 žmogaus embrioninių inkstų epitelinių ląstelių linija (HEK293) ir HeLa ląstelės buvo kultivuojamos Dulbecco modifikuotoje Eagle terpėje (DMEM, Invitrogen), papildytoje 10% šiluma inaktyvuoto vaisiaus veršelio serumo (FCS, Invitrogen) ir antibiotikų. MCF-7 ląstelės ir MCF-7 / kaspazės-3 ląstelės (maloniai parūpino Reiner Jänicke, Diuseldorfo universitetas, Vokietija) buvo auginamos RPMI 1640 (Gibco), papildytame 10% FCS ir antibiotikais. Pelės fibroblastai NIH3T3 buvo kultivuojami DMEM terpėje, papildytoje 10% šiluma inaktyvuoto veršelio serumo (Hyclone). Ląstelės buvo kultivuojamos 37 ° C temperatūroje vandenyje prisotintame 5% CO 2 atmosferoje.

Plazmidžių konstrukcijos

TRK-MET V5-His chimeros buvo aprašytos anksčiau. 19 Trumpai tariant, originalios TRK-MET chimeros, klonuotos pBAT vektoriuje, leidžiančios ekspresuoti tarpląstelinį TRKA receptorių, sulietą su pelės MET transmembraniniu ir citoplazminiu regionais, 25 buvo klonuojamos pcDNA 3.1 V5-His C plazmidėje (Invitrogen). TRK seka iki BamHI restrikcijos vietos buvo išpjaustoma suskaidžius, naudojant Hind III ir BamHI restrikcijos fermentus, ir klonuota į pcDNA 3.1 V5-His plazmidę. Likusi TRK-MET seka nuo Bam HI restrikcijos vietos iki 3 ′ galo buvo amplifikuota PGR, naudojant gruntą, kuriame yra Bam HI restrikcijos vieta, ir pradmenį, kuriame yra Xho I restrikcijos vieta, kaip šabloną naudojant pBAT TRK-MET. PGR produktas buvo subklonuotas į pGEM plazmidę (pGEM Easy kit; Stratagene). MET, kuriame asparto rūgštis 1374 buvo pakeista asparaginu, buvo sukurtas naudojant „Stratagene“ vietoje nukreiptą mutagenezės sistemą „QuickChange“, kaip šabloną naudojant pGEM MET WT arba D1000N ir šiuos pradmenis: 5′-CCCAAGACAACATTAATGGCGAGGGG-3 ′ ir 5′-CCCCTCGCCTA -3 ′. Mutacijos įterpimas buvo patikrintas sekvenavus. Galiausiai, MET seka iš pGEM buvo įterpta į pcDNA3 TRK, naudojant Bam H1 ir Xho1 restrikcijos vietą. Kitos mutacijos buvo aprašytos anksčiau. 19

Pilno ilgio žmogaus MET, kuriame juxtamembrano skilimo vietos valino liekana V1001 (žmogaus seka atitinka V999 pelių seka) buvo pakeista alaninu, buvo sukurta naudojant „QuickChange“ vietai pritaikytą mutagenezės sistemą, naudojant pMT2 žmogaus MET WT ( dosni dovana, kurią pateikė Flavio Maina, IBDM, Marselis, Prancūzija) kaip šabloną ir šiuos pradmenis: 5′-CAAATGAATCTGCAGACTACCGAGCTAC-3 ′ ir 5′-GTAGCTCGGTAGTCTGCAGATTCATTTG-3 ′. Mutacijos įterpimas buvo patikrintas sekvenavus.

N-galo vėliava p40 MET ilgio buvo sukonstruota taip: pelės MET nuo juxtamembrane kaspazės vietos iki C-galo buvo amplifikuota PGR, naudojant šabloną TRK-MET WT ir šiuos pradmenis: 5′-CAAATGAGTCTGGATCCTACAGAGCTAC-3 ′ turinčios BamHI restrikcijos vietą ir pradmenį 5′-CCTCGAACTCGAGACCTCAAGTGTTCCC-3 ′, turinčius Xho I restrikcijos vietą. N-terminalo Flag p40 MET maža ir p40 MET mažos negyvos kinazės versija (p40 MET Small K1108A) buvo sukonstruotos taip: pelės MET iš juxtamembrane kaspazės vietos į C galą kaspazės vieta buvo amplifikuota PGR, naudojant TRK-MET WT ir TRK-MET K1108A kaip šablonus ir šiuos pradmenis: 5′-CAAATGAGTCTGGATCCTACAGAGCTAC-3 ′, turinčius Bam HI restrikcijos vietą, ir pradmenis 5′-TCTCGAGTTCCCCTCTCAATCAATGTTGTC-3 ′, turinčius Xho I restrikcijos vietą. Gautos sekos buvo klonuojamos naudojant Bam HI / XhoI rėmelyje su vėliavos seka pcDNA3 vektoriuje.

Onkogenas TPR-MET buvo sukonstruotas taip: TPR-MET seka buvo amplifikuota PGR naudojant pXM139 SMS TPR-MET kaip šabloną (dosniai dovanojo Morag Park, McGill universitetas, Monrealis, Kvebekas, Kanada) ir pradmenis 5′-GCGCCGGCCTCGAGTCATGGCGGCGGTG- 3 ′, turinčios Xho I restrikcijos vietą, ir 5′-TCAGTCTAGATCTGATGCTCTGTCAG-3 ′, turinčios Xba I restrikcijos vietą. TPR-MET seka buvo klonuota pcDNA3 vektoriuje, naudojant Xho I / Xba I vietas. Negyva TPR-MET kinazė (TPR-MET KD), kurioje lizinas 1110 buvo pakeistas argininu, buvo sukurta naudojant „QuickChange“ vietai pritaikytą mutagenezės sistemą iš Stratagene, naudojant šabloną pcDNA3 TPR-MET ir šiuos pradmenis: 5′-CACTGTGCTGTGGCATCCTTGAACAGAATC-3. ′ Ir 5′-GATTCTGTTCAAGGATGCCACAGCACAGTG-3 ′. Iš 1376 asparto rūgšties sutrumpintas TPR-MET (TPR-MET δ Ct) buvo sukurtas naudojant „QuickChange“ vietoje nukreiptos mutagenezės sistemą, naudojant šabloną pcDNA3 TPR-MET ir šiuos pradmenis: 5 ′ GATAACGCTGATTAGTGCTAGTACTATGTC 3 ′ ir 5 ′ GACATAGTACTAGCCTA.

Antikūnai

Pelės monokloninis antikūnas, nukreiptas prieš pelės MET (B-2) ir triušio polikloninius antikūnus prieš žmogaus MET C-galinę sritį (C-28 ir C-12), prieš pelės MET (SP-260) ir prieš ERK2 (C-14). buvo įsigyti iš „Santa-Cruz“ biotechnologijų. Pelės monokloniniai antikūnai, nukreipti prieš MET kinazės domeną (25H2) ir nukreipti prieš fosforilintą ERK, ir triušio polikloniniai antikūnai prieš suskaidytą kaspazę-3 buvo įsigyti iš „Cell Signaling Technology“. Triušio polikloninis antikūnas prieš MET kinazės domeno fosforilintus tirozinus 1234 ir 1235 buvo įsigytas iš „Upstate Biotechnology“. Triušio polikloniniai antikūnai prieš kaspazę-3 buvo įsigyti iš „Stressgen Biotechnologies“. Pelės monokloninis antikūnas, nukreiptas prieš V5 etiketę, buvo įsigytas iš „Invitrogen“. Pelės monokloninis antikūnas prieš GRB2 buvo įsigytas iš „Transduction Laboratories“. Peroksidazės, fluoresceino ir rodamino konjuguoti antikūnai, nukreipti prieš triušio ir pelės IgG, buvo įsigyti iš „Jackson Immunoresearch Labs“.

Vakarų pūtimas

MDCK ir MCF-7 ląstelės (3, 10 5 ląstelės / 35 mm lėkštelėje), perkeltos arba ne, buvo kultivuojamos 1 dieną atitinkamai DMEM-10% FCS ir RPMI-10% FCS, ir buvo apdorotos ar nepašalintos anisomicinu, TNF α / cikloheksimidu arba staurosporinas terpėje, kurioje nėra serumo. Adherent cells and cells in suspension, collected after centrifugation of the medium, were lyzed and protein concentration determined by Bio-Rad protein assay. Western blotting buvo atliktas, kaip aprašyta anksčiau. 36 Results are representative of at least two experiments.

Trypano mėlynas dažymas

MDCK cells were cultured in the same condition that described previously. Adherent cells, detached with trypsin, and cells in suspension, collected after centrifugation of the medium, were collected and stained with trypan Blue (Sigma) (PBS/trypan Blue, vol/vol) for 15 min at room temperature. Unstained cells (cells alive) and blue cells (dead cells) were counted in Malassez hematimeter.

Caspase cleavage reaction

Caspase cleavages using cell extract were performed as follows: MDCK cells stably transfected with the TRK-MET chimeras (3.10 5 cells/35 mm-dish) were cultured 1 day in DMEM-10% FCS and then lyzed in 100 μ l of caspase buffer (20 mM PIPES pH 7.2; 100 mM NaCl; 1% Chaps; 10% sucrose; 5 mM DTT; 0.05 mM EDTA). Cell extracts were incubated 4 h at 37°C with 1 μ l of purified caspase. Proteins were then resolved on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and submitted to Western blotting. 36 Purified active caspases were generously provided by Dr GS Salvesen (The Burnham Institute, La Jolla, CA, USA). Titration of the active recombinant caspases have been obtained using in vitro cleavages against synthetic substrates as described previously 37 (Caspase-3, 13.9 μ M; Caspase-6, 7.5 μ M; Caspase-7, 19.7 μ M; Caspase-8, 15 mM; Caspase-9, 41.5 μ M).

Perkėlimai

Transient and stable transfections of MDCK cells were performed as described previously using the lipofection method. 26 For transient transfection of NIH3T3 fibroblasts, 8.10 4 cells were cultured in 12-well plates and were incubated with a mixture of DNA (1 μ g/ml) and Lipofectamine (Invitrogen; 20 μ g/ml). MCF7 cells (3.10 5 ) were cultured in six-well plates and were incubated with a mixture of DNA (1.25 μ g/ml) and PEI/ExGen 500 (Euromedex).

Imunofluorescencija

NIH3T3 cells (80 × 10 3 cells/24 mm-dish) were cultured for 1 day in DMEM-10% CS on glass coverslips and transiently transfected as described above. Forty-eight hours after transfection, cells were washed, fixed with 4% paraformaldehyde, permeabilized with 0.1% triton X-100, and blocked with 0.2% casein for 30 min. Cells were incubated 60 min with a combination of mouse anti-Met antibody (1 : 200) and rabbit anti-active caspase-3 antibody (1 : 200). Cells were then washed and incubated with a combination of fluorescein-conjugated anti-mouse IgG (7 μ g/ml) and rhodamine-conjugated anti-rabbit IgG (7 μ g/ml). Cell nuclei were counterstained using Hoechst 33258. Coverslips were mounted with Glycergel mounting medium (Dako) and fluorescence examined using a Zeiss Axioplan2. Results presented are representative of three experiments.

Kolonijų susidarymo tyrimas

For the colony formation assay, 6 × 10 5 HEK293 cells/well were plated in six-well plates, and the next day transient transfections were performed using the polyethyleneamine Exgen 500 procedure (Euromedex) using 1 μ g of DNA/well. Two days after transfection, cells were split into three 100-mm dishes containing DMEM-10% FCS, and the next day the medium was supplemented with 1.1 mg/ml G418 (Gibco). After 2 weeks, cells were counted.

Papildoma informacija

„Powerpoint“ failai

  1. 1.

    Supplementary data, Figure S1

  2. 2.

    Supplementary data, Figure S2

  3. 3.

    Supplementary data, Figure S3

  4. 4.

    Supplementary data, Figure S4

Žodynas

HGF/SF

hepatocyte growth factor/scatter factor

NGF

nervų augimo faktorius

TNF

naviko nekrozės faktorius

CAD

kaspazės suaktyvinta DNazė

ICAD

inhibitor of caspase-activated DNase

ROCK1

Rho-associated kinase 1

ŽEMĖLAPIS

mitogeno suaktyvinta baltymų kinazė

ERK

tarpląsteliniu būdu reguliuojama kinazė

RasGAP

Ras GTPase-activating protein

CBL

Casitas b-lineage lymphoma

PDGF β -R

platelet-derived growth factor beta receptor

zVAD-FMK

Z-Val-Ala-Asp (OMe) -fluormetilo ketonas

MDCK

Madin–Darby Canine Kidney

HEK293

human embryonic renal epithelial cell 293

HeLa cells

human epithelial cells from cervical carcinoma

FCS

vaisiaus blauzdos serumas

SDS-PAGE

natrio dodecilsulfato-poliakrilamido gelio elektroforezė

Papildoma informacija pridedama prie dokumento apie ląstelių mirtį ir diferenciaciją svetainėje (//www.nature.com/cdd)