Anaplastinė stambiųjų ląstelių limfoma atsiranda timocituose ir jai reikalinga laikina tcr išraiška, norint užkrėsti timpą | gamtos komunikacijos

Anaplastinė stambiųjų ląstelių limfoma atsiranda timocituose ir jai reikalinga laikina tcr išraiška, norint užkrėsti timpą | gamtos komunikacijos

Anonim

Dalykai

  • Limfoma
  • T-ląstelių receptoriai

Anotacija

Anaplastinė stambiųjų ląstelių limfoma (ALCL) yra periferinė T ląstelių limfoma, dažniausiai pasireiškianti vaikams ir jauniems suaugusiesiems. Natūrali šios ligos eiga, kaip ir tikrosios jos kilmės ląstelės, yra nežinoma. Pateikiame periferinės ALCL patogenezės modelį, kai piktybiniai navikai prasideda ankstyvuose timocituose, prieš T-ląstelių receptorių (TCR) β persiorientavimą, kuris apeinamas CD4 / NPM – ALK transgeninėse pelėse po Notch1 ekspresijos. Tačiau mes pastebime, kad TCR reikalingas užkrūčio liaukos išsiskyrimui ir periferinių pelių auglių vystymuisi, tačiau šis TCR turi būti sureguliuotas T ląstelių limfomagenezei. Atsižvelgiant į tai, žmogaus ALCL kloniniai TCR persitvarkymai dažniausiai būna rėmelyje, tačiau dažnai būna netolerantiški, esant kloniniam TCRα, tačiau nėra panašaus kloninio TCRβ persitvarkymo, sukeldami įvykius, kurie paprastai nėra leistini išgyvenimui užkrūčio vystymosi metu. ALCL paveikti vaikai gali aptikti užkrūčio limfomą inicijuojančias ląsteles, galinčias sėti recidyvus po chemoterapijos.

Įvadas

Nukleofosmino-anaplastinės limfomos kinazės (NPM – ALK) teigiama anaplastinė stambiųjų ląstelių limfoma (ALCL) yra laikoma periferine T ląstelių limfoma ir yra susijusi su t (2; 5) (p23; q35) translokacija, nustatyta kaip susiliejimas. kinazės geno, ALK , nukleolinio baltymo geno NPM1 (nuoroda 1). ALCL yra apibrėžiamas aktyvuotų B ir T ląstelių CD30 žymens ir kai kuriais atvejais T ląstelių žymenų, tokių kaip CD4 ar CD8, ekspresija, taip pat citotoksinių molekulių, tokių kaip perforinas, kurios kartu su kloniniu T- ląstelių receptorių (TCR) pertvarkymai rodo aktyvuotų T-ląstelių kilmę 2, 3, 4, 5, 6 . Kiti tyrimai pasiūlė Treg ląstelių kilmę (dėl FoxP3 nuorašų generavimo ir ILC ir TGFβ susidarymo ALCL ląstelių linijomis) arba visai neseniai Th17 fenotipą (dėl naviko ląstelių gaminamą IL17) 5, 6, 7, 8 . Lieka visiškai išsiaiškinti, ar šie ląstelės požymiai yra kilmės ląstelės likučiai, ar yra sukelti NPM – ALK. Nepaisant numanomo T-ląstelių priklausomybės, ALK + ALCL retai ekspresuoja TCRβ arba CD3ɛ imunohistochemijos 9 dėka, o CD3 signalizacijos kaskada yra nuosekliai sureguliuojama priklausomai nuo NPM-ALK transkripcijos ir epigenetinės modifikacijos būdu 10 . Visai neseniai mes parodėme, kad subkategorinės ALCL vėžio kamieninės ląstelės (CSC) ekspresuoja genus, praturtintus ankstyvųjų užkrūčio liaukų genčių rinkinyje (ETP), darant nuorodą į primityvios kilmės ląsteles 11 . Mūsų duomenys rodo, kad ALCL sėklos yra sėjamos į užkrūčio ląstą arba dar anksčiau, kai vystosi hemopoetika, galbūt tai rodo, kad įvykiai užkrūčio liaukoje arba pradėjus ląstelėms išeiti iš užkrūčio ląstos gali formuoti galutinį ląstelės fenotipą. Norėdami ištirti šią hipotezę, mes atlikome išsamią TCR persitvarkymo žmogaus ALCL analizę, norėdami rasti įrodymų, kad NPM – ALK sumenkino užkrūčio T-ląstelių vystymąsi. Esant normaliam T-ląstelių vystymuisi, prieš TCRβ VDJ pertvarkymą prieš TCRβ VDJ pertvarkymą ir didžiulį timocitų išsiplėtimą ląstelėse, pasirenkant ik TCR β atranką. Β-atrankos procesą skatina išankstinis TCR, sudarytas iš išankstinio TCRα, išreikšto ląstelės paviršiuje kartu su TCRβ grandine. Todėl TCR imunogenetiniai profiliai, naudojant daugialypę PGR, gali būti naudojami nustatyti giminystės ryšį ir brendimo sulaikymo stadiją.

Mūsų duomenys rodo, kad dauguma ALK + ALCL rodo imunogenetinius TCR pertvarkymo rėmuose įrodymus, 25% rodo netipinius TCR profilius, kurie paprastai nepasirenkami TCR-β beta linijų užkrūčio vystymosi metu (arba leistinoms). Įprasto T-ląstelių ontogenezės metu šie įvykiai lemtų β-atrankos žlugimą ir užkrūčio užkrūčio ląstelių mirtį, o tai rodo, kad šių pacientų thymi įvykis (-iai) pakeitė β-selekciją. Todėl mes panaudojome CD4 / NPM – ALK (CD4NA) timinės T ląstelių limfomos modelį 12, norėdami ištirti galimą rekombinazę suaktyvinančio geno (Rag) medijuoto TCR persitvarkymo ir TCR signalo indėlį į natūralią NPM – ALK sąlygotos T-ląstelės raidą. limfoma. Nesant Rag tarpininkaujamų TCR pertvarkymų, NPM – ALK gali sukelti „T ląstelių brendimą“ į T4 ląstelių vystymosi CD4 + CD8 + dvigubai teigiamus (DP) ir CD4 vienkartinius teigiamus (SP) etapus, leidžiančius susidaryti užkrūčio limfomos. Mes iškėlėme hipotezę, kad norint užkrėsti užkrūčio liauka gali prireikti tam tikros TCR formos išraiškos, todėl CD4NR transgeninę liniją perrėžėme į I klasės ribojamą Ova specifinę TCR transgeninę liniją OT1 tiek Rag, tiek Rag nepakankamumo fone 13, 14 OTI TCR buvimas perkelia limfomos pateikimo vietą į periferiją, nors naviko ląstelės neišreiškia TCR, o TCR stimuliacija užkerta kelią limfoidų onkogenezei; toks modelis labiau primena žmogaus ALCL, kuris taip pat retai išreiškia TCR 9, 10 . Šie duomenys rodo, kad periferinis ALK + ALCL priklauso nuo trumpalaikio funkcinio TCR ekspresijos, kad būtų galima atlikti primityvių T limfocitų timinę emigraciją ir vėlesnį jo žemyn reguliavimą, kai ląstelės yra periferijoje, kad būtų galima transformuotis.

Rezultatai

Nenormalūs TCR pokyčiai žmogaus ALCL navikuose

Kadangi NPM raiška yra visur paplitusi, NPM – ALK susiliejimas gali sukelti ALK raišką visuose užkrūčio augimo etapuose 15 . Norėdami ištirti, ar ALCL ląstelės praėjo pro užkrūčio liauką, ekspresuodamos NPM – ALK, išanalizavome TCR persitvarkymo žmogaus navikuose būklę. TCRδ, TCRγ ir TCRβ genai buvo amplifikuoti iš ALCL navikų DNR ir klonų populiacijų, identifikuotų atliekant PGR produktų geno analizę, apytiksliai 1–5% jautrumu (1 pav., 1 lentelė, 1 papildoma lentelė ir apibendrinta papildoma fig. 1). Norėdami patikslinti TCR būseną, tam tikrais atvejais buvo atlikta 180K Agilent CGH matricos analizė ir PCR nustatymas kloninių TCRα transkriptų iš papildomos DNR (cDNR) naudojant Vα ir Cα pradmenis (1 lentelė).

Image

a ) Įprasto T ląstelių vystymosi metu TCR genų pertvarkymas vyksta laikinai, kai δ ​​pertvarkymas vyksta prieš γ, po kurio eina β, o po to α, kuris paskutinis sutampa su δ lokuso ištrynimu. DP, dvigubai teigiamas; ISP, tarpinis teigiamas; SP, vienas teigiamas. ( b ) Parodyta tipiška PGR iš DNR (γ, β, δ) arba RNR (α), vaizduojanti kiekvienos iš keturių nurodytų TCR kategorijų buvimą / nebuvimą ir kloninių pertvarkymų tipą, kaip ir Agilent 180K CGH TCRα / δ profiliai. c ) Trys pavyzdžiai, atspindintys CGH TCRβ VJ pertvarkymų diapazoną, stebėtą tarp TCRαβ atvejų: nėra (12 iš 17), oligokloninių (2 iš 17) arba kloninių (3 iš 17). d ) Žmogaus ALCL procentas, priskiriamas TCR gemalo linijos (GL), TCRαβ (TCR AB), TCRγδ (TCR GD) arba tik TCRγ (TCR G) pertvarkymams. ND, nenustatyta.

Visas dydis

Pilno dydžio lentelė

Iš viso buvo ištirta 57 ALK + ALCL, turinčių ne mažiau kaip 40% naviko ląstelių. T limfoidinio imunohistologija ir citotoksinė būklė yra apibendrinta 1 lentelėje ir išsamiai aprašyta 1 papildomoje lentelėje. Apskritai, kloniniai TCRγ VJ persitvarkymai buvo nustatyti atliekant PGR 49 (75%), TCRβ VDJ 33 (58%) ir TCRδ VDJ 11 (19). %) atvejų (1 lentelė). Remdamiesi šiais duomenimis, ALCL suskirstėme į keturias atskiras kategorijas, atsižvelgiant į stebimą TCR pertvarkymo profilį: TCR gemalinė linija (GL), TCRαβ, TCRγδ ir tik TCRγ.

Aštuoni (14%) navikai neparodė reikšmingų kloninio TCR persitvarkymo PGR arba TCRα / δ CGH požymių, nepaisant mažiausiai 50% naviko ląstelių kiekio (1b, d, 1 lentelė ir 1 papildoma lentelė) ir buvo priskiriami TCR GL kategorijai. . Iš esmės jie žymi niekinio ALCL molekulinį ekvivalentą (nors šeši iš aštuonių atvejų išreiškė ląstelių paviršiaus žymenis, susijusius su T ląstelės fenotipu (1 papildoma lentelė)).

Navikai buvo klasifikuojami kaip TCRαβ, jei kloninis TCRβ VDJ persiskirstymas buvo aptiktas PGR bent viename alelyje, nesant TCRδ VDJ persitvarkymo, atitinkančio dvišalį TCRδ deleciją TCRα perstatymo metu. Tai buvo vyraujanti kategorija (32 iš 57; 56%; 1d pav.). Didžioji dauguma (16 iš 17 tirtų) TCR-ββ ALK + ALCL parodė aiškius TCRα VJ įrodymus bent viename alelio CGH ir kloniniame TCRα nuoraše buvo nustatyti naudojant atvirkštinės transkriptazės PGR (RT – PGR) 10 iš 10 15 CGH teigiamų atvejų (1b pav.). Netikėtai TCRβ pertvarkymai, nepaisant to, kad buvo aiškiai aptikti PGR, CGH aptiko tik nedaugeliu atvejų (3 iš 17, 18%), o dviem papildomais atvejais (ALCL19 ir 07) buvo demonstruojamos nevienalytės delecijos (1c pav.). Tai nebuvo daroma dėl nepakankamo „Agilent 180K“ matricų skyros, nes net TCRβ pertvarkymai, apimantys 5 ′ Vβ, nebuvo matyti ir pakartokite CGH, naudojant „Affymetrics“ didelio tankio citoscanų matricas (2, 7 M zondai) trimis TCRβ PCR VDJ + / CGH-TCRαβ atvejais. TCRα VJ persitvarkymo įrodymai, tačiau nenustatomas TCRβ VDJ, tik vienu atveju įrodytas tikėtinas kloninis nepilnas TCRβ DJ (ALCL24) (papildomas 2 pav.).

Kloninių PGR produktų sekos analizė parodė bent vieną rėmo TCRα pertvarkymą aštuoniuose iš devynių TCRαβ atvejų, trimis atvejais - du rėmo pertvarkymai rėmelyje. Tiriant TCRβ VDJ pertvarkymus iš 16 TCR-ββ ALCL (1 papildoma lentelė), buvo nustatytas mono-aleliškas, kadre esantis pertvarkymas visais atvejais, išskyrus vieną, ALCL 26, ypač vienu iš retų atvejų, kai TCRβ CGH turi teigiamą poveikį. Nepaisant šių funkcinio TCRαβ įrodymų, nė viename iš 16 ALCL, išanalizuotų imunohistochemijos metodais, nebuvo nustatyta aptinkamo TCRβ ekspresijos naviko ląstelėse (papildomas 3A pav.). Trylika TCRγ alelių buvo išskirta iš aštuonių TCRαβ atvejų, tačiau, kaip tikėtasi, tik du (15%) alelių buvo rėmelyje (1 papildoma lentelė).

Apibendrinant, TCRαβ navikai rodo akivaizdžius klimato TCRα pertvarkymus rėmelyje, tačiau tik nedidelius, rėmelyje esančius TCRβ pertvarkymus, kurie nustatomi atliekant PGR, bet retai naudojant CGH masyvą, laikantis heterogeninių, vykstančių TCRβ pertvarkymų TCRα klone, arba su reaktyviais, navikinius infiltruojančiais limfocitais. Norėdami nustatyti, ar dėl šių vykstančių pertvarkymų neatsirado jokių kloninių protėvių, mes klonavome ir nustatėme sekos TCRβ pertvarkymus iš ALCL19, tačiau nė vienas iš nedidelių pertvarkymų neturėjo jokios akivaizdžios protėvių TCRβ CDR3 DJ sekos.

Šešiais atvejais buvo pastebėtas kloninis TCRγ pertvarkymas, tačiau nebuvo TCRδ pertvarkymo, o daugiausia - neišsamus TCRβ pertvarkymas (trys monoallelic DJ), ir jie buvo pažymėti kaip tik TCRγ (1b, d pav.). Keista, bet dviem iš keturių atvejų TCGα lokalizacija buvo pertvarkyta CGH, o kloniniai TCRα VJC nuorašai buvo aptikti penkiuose iš šešių RT-PCR metodu (1b pav., Papildomas 2 pav., ALCL30 ir 1 lentelė). Nepaprastai akivaizdu, kad visi šeši TCRα pertvarkymai, atkurti iš šių penkių ALCL, nepaisant akivaizdaus kloninio TCRβ VDJ pertvarkymo. Tai nebuvo padaryta dėl klaidingų neigiamų TCRβ PGR rezultatų, nes 180K CGH analizė nenustatė TCRβ pertvarkymo keturiais tirtais atvejais (1 papildoma lentelė) ir didelės skiriamosios gebos 2, 7M ALCL30 citoscan analizė nustatė tikėtiną TCRβ DJ (papildomas 2B pav.). . Tik viename (ALCL23) nebuvo įrodymų apie TCRα persitvarkymą atliekant RT – PCR ir CGH. Iš esmės jis panašus į TCR GL ALCL su izoliuotu „nesubrendusiu“ rėmo VγfI-JP1 / 2 TCRγ pertvarkymu. Nesant TCRβ, TCRα, bent jau hipotetiškai, galėjo susieti su TCRγ, nes visais atvejais buvo atliktas bent vienas mono-aleliškasis persitvarkymas, tačiau tik vienas iš šešių sekos nustatytų TCRγ alelių buvo rėmelyje. Iš viso penki iš šešių tik TCRγ atvejų demonstruoja potencialiai funkcinį TCRα persitvarkymą, jei nėra TCRβ pertvarkymo, ir skiriasi nuo TCRαβ atvejų tik tuo, kad PGR nėra TCRβ kloninio VDJ smailės.

Vienuolika atvejų (19%) buvo klasifikuojami kaip TCR-δδ, nes buvo nustatyti kloniniai TCRγ VJ ir TCRδ VDJ pokyčiai (1b, d pav.). Ši kategorija demonstravo vienodą genotipą: 10 iš 11 rodė Vδ1-Jδ1 / Dδ2-Jδ1 genotipą ir TCRγ bei TCRδ pertvarkymą į rėmą bent viename alelyje (1 papildoma lentelė). 180K CGH profiliai patvirtino tik TCRδ, bet ne TCRα ar TCRβ pertvarkymus šešiais ištirtais atvejais (1 ir 1 lentelė). Jie visi parodė nepilną TCRβ DJ bent vienoje alelėje (žemiau CGH nustatymo skyros). ALCL36 taip pat parodė visišką TCRβ VDJ pertvarkymą į rėmus, tačiau buvo klasifikuojamas kaip TCR-δδ, nes TCRδ pertvarkymai buvo dvišaliai, kloninis TCRγ buvo rėmelyje ir jokių TCRα transkriptų nebuvo aptikta naudojant RT – PCR. Taigi, kaip ir TCR-ββ ALCL, TCR-δδ ALCL turi imunogenetinius įrodymus apie galimai funkcinį TCR.

Apibendrinant galima pasakyti, kad PGR ir CGH TCR pertvarkymų analizė ALK + ALCL parodė, kad du trečdaliai (tik TCR-β ir tik TCRγ) demonstruoja pagrindinį rėmo TCRα klonų pertvarkymą, kuris nėra lydimas panašios pagrindinės TCRβ kloninės populiacijos, bet dėl nedidelių TCRβ klonų populiacijų, kurios daugiausia yra rėmelyje ir gali kilti iš TCRα klonų populiacijos arba nepriklausomai nuo jos ir nėra susijusios su aptinkamu TCRβ baltymu imunohistocheminiu būdu. Likęs trečdalis yra padalijamas tarp imunogenetinio „Null-ALCL“ (TCR gemalinė linija, 14%) ir imunogenetinio TCR-δδ ALCL (19%).

Todėl mes iškėlėme hipotezę, kad, laikydamiesi mūsų ankstesnio pasiūlymo, kad NPM – ALK gali pakeisti TCRβ signalizacijos kaskadą 16, NPM – ALK gali leisti nesubrendusiai kraujodaros ląstelei apeiti timinę β atranką iki stadijos, kai tampa įmanoma TCRα VJ persitvarkymas, taigi nenormalus T limfoidų diferenciacija ir reiškia, kad mažiausiai daliai ALCL yra užkrūčio kilmė. Norėdami įvertinti, ar vykstantis rekombinazės aktyvumas gali atsirasti esant nustatytiems ALK + ALCL navikams, 52 atvejais ieškojome RAG1 nuorašų, tačiau visi buvo neigiami, kaip ir visos trys ALCL ląstelių linijos, patikrintos priešingai nei nesubrendusios T-ALL ląstelių linijos, sulaikytos timinė vystymosi stadija (papildomas 3B pav.).

NPM – ALK gali sukelti timinę „T ląstelių brendimą“

Norėdami išsiaiškinti, ar NPM – ALK, išreiškiantys timocitus, gali išsivystyti ir galų gale įvykti transformacija nesant funkcinio TCR pertvarkymo, mes sukūrėme transgenines peles, išreiškiančias NPM – ALK, visuose užkrūčio vystymosi etapuose, kuriems trūko rag2 geno (2a pav.). RAG2 reikalingas TCR pertvarkymui, todėl 2 - / - rag. Pelėms yra mažas thymi, neturinčių subrendusių T ląstelių, bet jose yra normalus skaičius T-ląstelių pirmtakų, blokuotų vystytis DN3 stadijoje. Prieš pateikdami akivaizdžius navikus, išanalizavome CD4NA / RAG + / + ir CD4NA / RAG2 - / - pelių thymi. 5 savaičių amžiaus CD4NA / RAG + / + pelėse kaupiasi fenotipinės DN3 ląstelės. (2b, c pav., Absoliutus ląstelių skaičius parodytas 2 papildomoje lentelėje). Taip pat padidėjo visos užkrūčio liaukų populiacijos procentas, išreiškiantis ląstelių paviršiaus žymeklį CD117 - baltymą, kurio ekspresija yra išjungta DN3 / 4 užkrūčio vystymosi stadijoje (2b, c pav.). Šie duomenys rodo TM ląstelių vystymosi sulėtėjimą šiame etape, kurį sukelia NPM – ALK aktyvumas ir atitinka laiką, kada vyksta β atranka.

Image

( a ) CD4NR transgeninės pelės timidė buvo suskirstyta į nurodytus T ląstelių pogrupius ir įvertinta, ar ekstrahuota RNR turi NPM-ALK nuorašus. SP, vienas teigiamas; DP, dvigubai teigiamas; DN, dvigubai neigiamas; RT, atvirkštinė transkripcija. ( b ) 5 savaičių amžiaus CD4NR transgeninių pelių thymi (bendras užkrūčio ląstelių skaičius, palyginus laukinio tipo ir transgenines peles, yra lygus), buvo ištirta ląstelių procentinė dalis kiekviename dvigubai neigiamų stadijų etape (vartojant ant CD3 / 4/8 - ląstelių) užkrūčio T-ląstelių vystymąsi. Parodytas reprezentatyvus penkių analizuotų pelių pavyzdys. Skaičiai grafikuose parodo viso DN fondo procentinę dalį. c ) Ląstelių procentinė dalis kiekviename užkrūčio T-ląstelių vystymosi etape penkių pelių grupėse iš kiekvieno nurodyto genotipo 5 savaičių amžiaus. Duomenys parodo atskirų pelių skaičių ir vidutinę vertę, atitinkamai P = 0, 0368, P = 0, 015 ir P = 0, 0007 atitinkamai DN3, DN4 ir CD117 pogrupiams (Studento t- testas, darant prielaidą, kad dispersija lygi). d ) užkrūčio raida dvigubai neigiamose stadijose buvo įvertinta nurodytais pelių genotipais srauto citometrijos metodu. Parodytas reprezentatyvus trijų analizuotų pelių pavyzdys, o skaičiai grafikuose parodo DN fondo procentinę dalį. e ) Ląstelių procentinė dalis kiekviename užkrūčio liaukos vystymosi etape nurodytuose genotipuose 9 savaičių amžiaus. Duomenys parodo atskirų pelių skaičių, o klaidų juostų vidurkis rodo standartinį nuokrypį, P = 0, 0267, P = 0, 0005 ir P = 0, 0001 atitinkamai CD4SP, DP ir DN pogrupiams, n = 10 kiekvieno genotipo, Studento t- testas. ( f ) NPM – ALK atkuria užkrūčio vystymąsi RAG2 - / - pelėse. Parodytas trijų analizuotų pelių tipinis pavyzdys, o skaičiai rodo bendro gyvų timocitų skaičiaus procentą. ( g ) NPM – ALK ekspresija užkrūčio liaukoje atkuria Notch1 raišką DN3 timocitų paviršiuje RAG2 - / - pelėse. Pateiktas reprezentatyvus trijų pelių, analizuotų kiekvieno nurodyto genotipo, pavyzdys, teigiami vartai nubrėžti pagal izotipo kontrolę.

Visas dydis

Pelėse CD4NA / RAG2 - / - užkrūčio ląstelė buvo žymiai padidinta, palyginti su RAG2 - / - pelių skaičiumi, bet ne iki laukinio tipo pelių stebimo lygio (2e pav. Absoliutus ląstelių skaičius parodytas papildomoje lentelėje). 3). Ląstelių skaičius, stebimas RAG2 - / - linijoje, atitinka ankstesnes ataskaitas 13 . CD4NA / RAG2 - / - pelėse DN3 ląstelių skaičius buvo per didelis, palyginti su laukinio tipo pelėmis. Pažymėtina, kad dauguma timocitų, esančių CD4NA / RAG2 - / -, buvo DP (2e, f pav.). Šie duomenys rodo, kad NPM – ALK gali paskatinti apeiti β atrankos kontrolinį tašką. Remiant šiais duomenimis, 32% mažiau DN4 ląstelių, išskirtų iš CD4NR pelių, ląstelių paviršiuje ekspresuoja TCRβ, palyginti su laukinio tipo vadinamosiomis vadinamosiomis pakratų pelėmis (papildomas 4A pav.).

Be to, DN3 ląstelės, išskirtos iš CD4NA / RAG2 - / - transgeninių pelių, išreiškė ląstelės paviršių Notch1, kas atitinka akivaizdų timocitų brendimą už DN3 stadijos (2g pav.), Taip pat maistinių medžiagų pernešėjų CD98 ir CD71, kurių reikia norint patenkinti besivystančių timocitų metaboliniai poreikiai (papildomas 4B pav.). Iš tiesų, CD98 ir CD71 padidėjęs reguliavimas paprastai pastebimas tik esant Notch1 ir išankstinio TCR signalizacijai, kas rodo, kad NPM – ALK ne tik skatina Notch1 išraišką, bet ir kompensuoja ikik TCR 17 nebuvimą.

CD44 hi populiacija yra naviko augimo pirmtakas

CD4NR transgeninių pelių organizme aptinkama nenormali timocitų populiacija vėlesniame amžiuje, kai užkrūčio ląstelių ląstelės tebėra normos ribose. CD4 / CD8 subrendusios T ląstelės ekspresuoja nesubrendusių ląstelių paviršiaus žymeklį CD117, taip pat CD44, pastarieji paprastai yra ribojami DN1 / 2 timocitais (papildomas 5A pav.). Neaišku, ar CD44 hi ląstelių padidėjimas yra DN1 / 2 ląstelių ekspresijos liekana, ar NPM – ALK sukeltas CD44 reguliavimas, nors pastarąjį paaiškinimą patvirtina eksperimentai, kurių metu NPM – ALK gali sukelti luciferazės ekspresiją iš CD44 promotorius (papildomas 5B pav.).

Šie duomenys rodo, kad NPM – ALK skatina asinchroninį TCRβ DNR tipo ląstelių proliferaciją ir brendimą į DP ląsteles, neprarandant DN1 / 2 charakteristikų, tokių kaip CD44 ir CD117 ekspresija. Tai gali suteikti onkogeninį pranašumą šiai populiacijai, kuriai netaikoma timidinė TCR tarpininkaujama atranka. Iš tiesų, ši CD44 + populiacija sukėlė užkrūčio auglius, kai jie buvo į veną persodinami pelėms-recipientams, vėlgi atsižvelgiant į šio modelio sistemos ETP kilmę (papildomas 5C pav.).

NPM – ALK skatina nuo TCR nepriklausomą šlaunies naviką

Nepaisant TCR pertvarkymo, pelės CD4NA / RAG2 - / - sukelia užkrūčio auglius, sudarytus iš ląstelių, primenančių dvigubai teigiamą T ląstelių vystymosi stadiją (3a pav., 2 lentelė). Tačiau navikai, atsirandantys CD4NR ar CD4NR / RAG2 - / - linijose, yra ta pati histopatologija, susidedantys iš NPM – ALK ekspresuojančių difuzinių, homogeninių vidutinio dydžio ląstelių lakštų, visiškai pašalinančių normalią užkrūčio liaukos struktūrą (3b pav.). Kaip ir tikėtasi, CD4NA / RAG2 - / - navikai, nepaisant išreikšto CD4 ± CD8, nerodo TCR pertvarkymų (3c pav.). Šie duomenys rodo, kad TCR pertvarkymas nėra būtinas atliekant ląstelių transformaciją užkrūčio liaukoje, nors CDNA / RAG2 - / - pelių auglių vystymasis, palyginti su CD4NR, yra atidėtas, ir tai rodo, kad šis procesas gali sustiprinti navikogenezę (3d pav.). Taigi, nesant TCR pertvarkymo, NA leidžia asinchroniškai užkrėsti šlaunikaulį iki CD4 / 8 DP stadijos ir vystytis žievės užkrūčio limfomai.

Image

( a ) CD4NR ir CD4NR / RAG - / - pelėse esantis užkrūčio naviko fenotipas primena žievės timocitus. Skaičiai grafikuose rodo viso gyvo naviko ląstelių skaičiaus procentą. Šie duomenys atspindi mažiausiai 10 analizuotų navikų. b ) Tipiškas navikų histopatologinis pateikimas, teigiamas ALK ekspresijai, padidinimas 400. Mastelio juosta, 50 μm. c ) nurodyto pelių naviko genotipo TCRβ pertvarkymai, palyginti su normalia užkrūčio liauka ir be limfoidinės DNR; parodyti keturi reprezentaciniai pavyzdžiai iš kiekvieno. d ) CD4NR ir CD4NR / RAG2 - / - pelių Kaplano ir Meiero išgyvenamumo kreivė, P <0, 005, log rank testas. NPM – ALK / RAG2 - / -, n = 20; NPM – ALK, n = 15.

Visas dydis

Pilno dydžio lentelė

Pelių navikai visada būna tik užkrūčio liauka, tuo tarpu ALCL žmonėms dažniausiai būna periferijoje ir dažnai būna ekstranodališki (nors tarpuplaučio įsitraukimas pastebėtas net 50% žmonių atvejų 18 ). Todėl akivaizdu, kad jei navikai prasideda užkrūčio liaukoje, kažkas turi prisidėti prie užkrūčio liauka. Įprasto užkrūčio ląstos brendimo metu tai paprastai užtikrinama TCR / CD3 komplekso paviršiaus ekspresija. ALCL, priešingai, būdingas tiek žmonėms 9, tiek mūsų pelių CD4NR / RAG2 - / - modeliui, visiškai nesant TCR / CD3 komplekso, tokiu būdu galimai paaiškinant, kad neišvyksta užkrūčio liauka, bent jau pelėms. Tai ne visada būna, nes retais atvejais CD4NR pelės gali susirgti periferiniais navikais (mūsų rankose vienai iš 50 CD4NR pelių vystosi navikai periferiniuose limfmazgiuose). Be to, mūsų duomenys rodo, kad dauguma žmogaus ALCL demonstruoja imunogenetinius TCRαβ arba TCRγδ rėmus, rodančius išankstinę funkcinio TCR išraišką. Todėl atkūrėme TCR raišką pelių modelyje, įvesdami TCR transgeną.

Esant OT1 TCR, atsiranda periferinė T ląstelių limfoma

OT1 TCR (Vα2) atpažįsta ovalbumino (kiaušialąsčių) likučius 257–264 (SIINFEKL) H2κb kontekste (nuoroda 14). Jei nėra kiaušialąsčių, CD4NA / RAG2 - / - / OTI pelių linijoje neišsivysto limfoidiniai navikai, o po ilgesnio (OT1 TCR neigiami) virškinimo trakto stromos navikų, kepenų ląstelių karcinomų ir sarkomų, nors OTI TCR- teigiamos T ląstelės egzistuoja periferijoje (papildomas 6 pav., 4 papildoma lentelė). Priešingai, RAG kompetentinga CD4NA / OT1 linija iš tiesų sukelia ALK + limfomas, turinčias periferinę, o ne timinę, o vidutinis išgyvenimas yra 181 diena (palyginti su 88 dienomis CD4NA pelėms ( P = 0, 0001, studento t- testas); 4a pav.). Ar šis naviko vystymosi uždelsimas yra tikras skirtumas, ar tai yra tik pavėluoto naviko aptikimo rezultatas (užkrūčio liaukos CD4NR navikai sukelia sunkų kvėpavimą, tuo tarpu CD4NR / OTI pelių periferinius navikus dėl besimptomio augimo gali būti sunkiau nustatyti). Tačiau DN3 populiacijos CD4NR / OTI pelėse analizė, palyginti su CD4NR pelėmis, parodė padidėjusią ląstelių proliferaciją, o tai gali sutrumpinti laiką, reikalingą naviką sukeliančių antrinių genetinių įvykių (galbūt RAG tarpininkavimui), leidžiančių užkrėsti užkrūčio ląsteles, įgijimui. ir transformacija periferijoje (papildomas 7 pav.). Tačiau CD4NA / OTI pelių T-ląstelių vystymosi profiliai, atrodo, yra normalūs, nors bendras timidinis ląstelių kiekis yra padidėjęs (papildomas 8A – C pav.). Pažymėtina, kad CD4NR / OTI linijos periferiniai navikai labiau atkartoja histopatologinį žmogaus ligos apibūdinimą (2 lentelė, 4b pav.). Visi navikai teigiamai vertina ALK dažymą imunohistochemiškai, o histologinė analizė parodė ląsteles su eozinofiline citoplazma ir reniforminiais branduoliais, primenančiais klasikines žmogaus ALCL „bruožines“ ląsteles (4b pav.) 19 . Nepaisant RAG buvimo šiose pelėse, navikuose nebuvo endogeninių TCRβ pertvarkymų, kas rodo, kad jie atsirado dėl užkrūčio liaukų populiacijų, išreiškiančių OTI transgeninį TCR, kuris, kaip žinoma, slopina RAG tarpininkaujamus endogeninius pertvarkymus (4c pav.). OTI TCR išraiška (vis dar nėra kiaušialąsčių) reikštų timos emigraciją, nesant kitų TCR pertvarkymų. Tačiau navikai retai išreiškė transgeninį Vα2 TCR ląstelių paviršiuje (tik viena iš 10 tirtų pelių; 4d pav., 2 lentelė), nors Vα2, ekspresuojančios T ląsteles, egzistuoja paveiktuose navikų turinčių pelių organuose (1 pav. 4e) ir yra ikivėžinių pelių periferijoje (papildomas 6B pav.), Kas rodo, kad jos raiška buvo prarasta. Galima aptikti tarpląstelinį CD3, tačiau paviršiniame CD3 ant navikų nebuvo rasta, o viduląstelinio Vα2 TCR nebuvo, nors buvo galima aptikti OTI nuorašus (papildomas 8D pav., E). Šis „nulinio“ ląstelės paviršiaus fenotipas (4d pav.) Ryškiai primena žmogaus ALK + ALCL. Buvo pranešta, kad IL2R ir molekulės, esančios paskui TCR-ligacijos sukeltą signalizaciją, yra nutildytos epigenetiniais mechanizmais, pateiktais ALCL 10, 20, ir tai rodo, kad TCR sukelta signalizacija veikia kaip naviką slopinantis mechanizmas.

Image

a ) Kaplano ir Meiero išgyvenimo kreivė, CD4NN = 20, CD4NR / OT1 n = 16, CD4NR / OT1 / RAG2 - / - n = 10, P = 0, 0052 (CD4NR / OTI palyginti su CD4NR / OTI / RAG2 - / - ), žurnalo rango testas. b ) Tipiškas navikų, esančių CD4NR / OTI pelių linijoje, histopatologinis vaizdas. Ląstelė, turinti morfologinių panašumų su „žymėjimo“ ląstele, žymima rodykle, x 400 padidinimu; mastelio juosta, 50 μm. c ) Endogeniniai TCRβ persitvarkymai navikuose, esančiuose CD4NR / OTI pelių linijoje, parodyti trys reprezentatyvūs pavyzdžiai. d ) Dauguma navikų, išsivysčiusių pelėms, yra „nulinio“ ląstelės fenotipo, neturinčio visų T ląstelių, apibūdinančių ląstelių paviršiaus žymenis, įskaitant transgeninį OT1 TCR (Vα2), išraiškos. Skaičiai grafikuose parodo bendro gyvų naviko ląstelių skaičiaus procentą. e ) Reprezentatyvus nulinės ląstelės naviko, atsirandančio blužnyje, pavyzdys, neekspresuojantis Vα2 TCR (dešinysis skydelis), tuo tarpu sveiki limfmazgiai, paimti iš tos pačios pelės, išreiškia Vα2 TCR (kairiajame skydelyje). ( f ) CD4NR / OTI pelėms, kurioms buvo paskirta MHV-kiaušialąstė, išsivysto kepenų ląstelių karcinoma, padidinta × 400; mastelio juosta, 50 μm. g ) HCC navikai neišreiškia OTI TCR (Vα2) savo ląstelių paviršiuje, tuo tarpu nepažeistas blužnies audinys toje pačioje pelėje. Mėlyna reiškia izotipo kontrolę, o raudona - OTI Vα2 TCR. Tipinis trijų pelių pavyzdys parodytas f ir g pav.

Visas dydis

Kadangi CD4NR / RAG2 - / - / OTI transgeninėse pelėse nesivysto limfoidiniai navikai, gali būti, kad RAG veikė kaip esminis naviko skatintojas NPM – ALK / OTI pelėse. Žmogaus ALCL navikai negamina RAG1 nuorašų (papildomas 3B pav.) (Net jei RAG2 nuorašus galima aptikti mūsų pelių NA / OTI navikuose, papildomas 8E pav.). RAG paprastai prarandamas dėl ekspresijos ir giminingo signalo apie funkcinį TCR, todėl jo nebuvimas žmogaus ALCL yra suderinamas su subrendusiomis po timio ląstelėmis, tačiau neatmeta RAG ekspresijos ankstesniame ALCL vystymosi etape. Kaip alternatyva, B ląstelės (kurios nėra gaminamos RAG - / - pelės fone) gali būti esminis auglio vystymosi veiksnys, nors CD4NR / OTI pelėse atsiradusiems navikams nebuvo reikšmingos B ląstelių infiltracijos navikuose (papildomas 8F pav. ).

Norėdami įvertinti TCR-Ag sąveikos vaidmenį periferiniame ALCL vystymesi, mes paveikėme NA / OT1 RAG kompetentingas peles MHV-OVA (MHV68; nuoroda 21). Stebėtina, kad tai panaikino ALCL vystymąsi kepenų ląstelių karcinomų ir sarkomų naudai, kaip matyti iš NA / RAG2 - / - / OT1 pelių (4f pav., 4 papildoma lentelė). Tai rodo, kad giminingų periferinių TCR signalų perdavimas NPM – ALK ekspresuojančiose ląstelėse nesuderinamas su ALCL raida ir (arba) išgyvenimu. Kaip ir tikėtasi, OTI Vα2 TCR nebuvo išreikštas šių pelių auglių paviršiuje, tuo tarpu jo buvo nepaveiktame hematologiniame audinyje (4g pav.).

Visi šie duomenys rodo, kad NPM – ALK leidžia išvengti šlaunies β atrankos, tačiau, norint užkrėsti timolą ir sukurti periferinį ALCL, TCR signalo perdavimas yra būtinas, o pastarasis priklauso nuo vėlesnio TCR panaikinimo (papildomas 9 pav. ). Iš tiesų, analizuojant 16 žmogaus ALK + ALCL dvigubai dažant CD30 ir TCRβ grandinę, paaiškėjo, kad nėra navikinių ląstelių, kurios kartu išreikštų abu baltymus, ir tai vėlgi rodo, kad TCR buvimas nesuderinamas su naviko ląstelių išgyvenimu esant NPM – ALK (papildomas 3A pav.).

Diskusija

Žinomai sunku buvo atkurti klinikinius ir imunofenotipinius žmogaus ALCL požymius transgeniniuose pelių modeliuose 12, 22, 23, 24, 25 . Dabar mes pademonstravome, kad CD4 sukelta NPM – ALK gali sukelti tiek RAG2 - / - tarpininkaujamo pelių DN3 užkrūčio užkrėtimo blokadą, tiek ir žievės užkrūčio limfomos vystymąsi. Tačiau TCR išraiška reikalinga užkrūčio liaukos išsiskyrimui ir periferinių navikų, kurie pirmą kartą histologiškai primena žmogaus ALK + ALCL, išsivystymui. Faktas, kad šie periferiniai pelių navikai negali vystytis esant kiaušialąsčių sukeltam transgeninio TCR stimuliavimui ir praradę endogeninę TCR ekspresiją, yra nepaprastai panašus į plačiai pripažintą TCR ekspresijos ir signalizacijos 9, 10 nebuvimą, nepaisant ankstesnio kloninio TCR persitvarkymo, Žmogaus ALCL ir rodo, kad nuolatinis TCR ir NPM-ALK sukelto signalo perdavimas periferijoje nesuderinamas su ALCL raida ir (arba) išgyvenimu. Imunogenetinė žmogaus ALCL analizė parodė, kad daugumoje yra svarbiausių TCRα receptorių pertvarų pagal rėmus, nesant palyginamų TCRβ pertvarkymų, nesant aptinkamo TCRβ baltymo, suderinamo su TCRβ pakeitimu NPM – ALK. klasikinės ALCL plėtra.

NPM – ALK leido ląstelėms atlikti asinchroninę diferenciaciją, atrenkant čiobinę β, nesant TCRβ pertvarkymo RAG2 - / - modelyje, išreiškiant Notch1 (skirtingai nuo rag2 - / - pelių) ir jo pasroviui turinčių CD98 ir CD71 maistinių medžiagų pernešėjų 26, tačiau palaikant. CD44 ir CD117 išraiškos, atsižvelgiant į ankstesnį ETP transkripcijos parašo identifikavimą ALCL 11 . Tai rodo, kad pradiniai ALCL vystymosi etapai vyksta užkrūčio liaukoje ir yra suderinami su tarpuplaučio masės nustatymu 50% vaikų ALCL ir aukšto lygio Notch1 ekspresija ALCL 18, 27 . Taigi, NPM – ALK signalizacija turi būti pajėgi bent iš dalies imituoti signalą prieš TCR ir leisti subrendti TCRα pertvarkymui, įskaitant akivaizdų svarbiausio kloninio TCRβ pertvarkymo nebuvimą, kaip nustatyta 67% (tik TCRαβ ir tik TCRγ) žmogaus ALCL. Neatrodo, kad NPM – ALK užkirstų kelią vykstančiam TCRβ persitvarkymui žmogaus ALCL, nes daugeliu atvejų kloninės populiacijos demonstruojamos PGR (bet ne didelės raiškos CGH) būdu ir tokiu būdu tikriausiai yra 1–20% DNR. Neįmanoma nustatyti, ar šie nedideli persitvarkymai kyla iš ALCL populiacijos, ar atspindi navikinius infiltruojančius reaktyvius T limfocitus, tačiau mes palaikome pirmuosius, nes naviko infiltruoti reaktyvieji T limfocitai turėtų būti aptinkami naudojant TCRαβ specifinius antikūnus imunohistochemijos būdu, o taip nebuvo. .

Dėl uždelsto limfomos vystymosi pradžios NA / RAG2 - / - modelyje ir jos nebuvimo NA / RAG2 - / - / OT1 modelyje būtų galima manyti, kad TCR signalizacija (arba kita RAG sukelta rekombinacija) prisideda prie limfomagenezės, nors ir dėl to Kitą, tikslinį RAG poveikį, dar reikia ištirti. RAG aktyvumas T ir B limfoidinių pirmtakų srityje sukelia rekombinazių sukeltų anomalijų, galinčių prisidėti prie limfomagenezės, riziką, pripažintą ūminės limfoblastinės leukemijos atvejais 28 . Alternatyvus paaiškinimas gali būti susijęs su RAG baltymų gebėjimu sukelti DNR grandinės nutrūkimą prie (kripto) rekombinacijos signalo sekų, o tai gali sukelti onkogeninių chromosomų translokacijas. Vargu, ar B limfocitų nebuvimas yra limfomos neišsivystymo, nesant RAG, paaiškinimas, nes nebuvo reikšmingų B ląstelių infiltracijos navikuose, atsirandančiuose CD4NR / OTI pelėms.

Pagal šį modelį RAG yra nepatartinas užkrūčio liaukos augliams, kurie buvo sustabdyti prieš teigiamą ir neigiamą atranką DP žievės timocituose, tačiau būtini periferiniams navikams, tai patvirtina limfomos nebuvimas NA / RAG - / - / OT1 pelėms, laikantis rekombinazės tarpininkaujamų įvykių vaidmuo kuriant ALCL. Faktas, kad periferinio ALCL vystymasis kompetentingose ​​NA / OT1 pelėse buvo rekombinacinėse pelėse, buvo susijęs su TCR transgeno ekspresijos praradimu, ir kad konstitucinio TCR signalo sukėlimas, NA / OT1 pelėms veikiant kiaušialąstes, panaikintas periferinis ALCL, rodo, kad TCR sukeltas signalizavimas veikia kaip naviką slopinantis mechanizmas, esant periferinėse T ląstelėse esant NPM – ALK. „Imuninės priežiūros“ arba naviko slopintuvo funkcija ALCL buvo priskirta IL2Rγ signalų perdavimui, o NPM – ALK sumažina su TCR susijusias signalines molekules kinazės priklausomomis, tarpininkaujant STAT3, genų transkripcijai ir (arba) epigenetiniam nutildymui 10, 20 .

Vienas iš galimų paaiškinimų yra tas, kad TCR + ALK + ląstelės gali palikti užkrūčio ląstą ir išgyventi periferijoje, tačiau dėl TCR signalizacijos, kurią sukelia antigeno stimuliacija, klonai ištrūksta esant onkogeniniam ALK. TCR signalizacijos panaikinimas, kaip matyti iš žmogaus ALCL, ir pakartotinai sukurtas RAG kompetencijai priklausančiame NA / OT1 „tyliame“ transgenere, kai nėra kiaušialąsčių, paliktų ALK signalizaciją nenaudojamą, tokiu būdu palaikant limfoproliferaciją. Gali būti, kad Ag (arba kitas) T-limfoidų stimuliavimas tam tikrame kontekste, be indukuojamų ALCL žymens aktyvavimo žymenų, tokių kaip CD30, perforino ir Granzyme B (3 nuoroda), bei pradinio TCR signalo, gali pasireikšti tam tikru būdu vėliau suaktyvina TCR nutildymą ir nepopuliarų ALK signalizavimą. Atsižvelgiant į tai, buvo aprašytas antigeninis dirgiklis, sukeliantis stiprų imuninį atsaką prieš prasidedant ALCL, pavyzdžiui, sisteminiai ALK teigiami ALCL odos pažeidimai, atsirandantys po vabzdžių įkandimo 29 .

NPM – ALK taip pat gali paskatinti ALCL vystymąsi T-limfoidų pogrupiuose, išskyrus TCRαβ pirmtakus, nes 19% žmonių atvejų išreiškė vienodą TCRγδ imunogenetinį profilį su timos tipo Vδ1 – Jδ1 pertvarkymais 30 . Naivios TCRγδ ląstelės gamina IL-17, o TH17 profilis buvo nustatytas transkripciniu profiliavimu ALCL 31 . Aštuoniose ALCL (14%) išreikštuose CD2, CD4, CD5 ar CD7 deriniuose, tačiau jokių aptinkamų TCR pertvarkymų nebuvo, ir todėl jie atitinka imunogenetinį nulinio ALCL ekvivalentą, kuris gali atsirasti dėl NK ar kitų įgimtų imuninių pogrupių transformacijos. Šios ląstelės reaguoja į uždegiminę citokinų aplinką, užuot klasikiniu būdu apribojusios TCR / MHC. Tačiau dauguma (80%) žmogaus ALCL rodo imunogenetinius bent trumpalaikio TCR ekspresijos ir atrankos ALCL vystymosi metu įrodymus.

Normalios TCRαβ linijos timocitai, nesant arba per daug TCR signalizuojant, ląstelės žūva, kaip dalis teigiamo ir neigiamo TCRαβ repertuaro pasirinkimo. Mūsų duomenys rodo, kad ALK varoma signalizacija, nesant RAG, gali pakeisti trūkstantį timzės pre-TCR proliferacinį signalą nekontroliuojamu žievės timocitų išsiplėtimu (kaip matyti iš NA / RAG - / - modelio), nes nėra TCR- tarpininkavo neigiama atranka. Bendradarbiavimas su funkciniu TCR leidžia užkrėsti užkrūčio liauka, bet po to ląstelė žūva tuo pačiu metu, kai TCR ir NPM – ALK signalizuoja, tokiu būdu, kuris yra analogiškas užkrūčio šlaunies negalavimui. TCR veikia kaip naviko slopintuvas, kuris turi būti sureguliuotas, norint sukurti klasikinį periferinį ALCL. Šiems stebėjimams, be abejo, reikia toliau eksperimentuoti su tiksliais periferinės priešingos selekcijos mechanizmais, tačiau dabartiniai duomenys apibūdina pelių modelį, kuris pirmą kartą labai primena žmogaus ALCL ir kuris bus naudingas vertinant naujus terapinius agentus.

Be to, šis darbas kelia galimybę, kad vaikai, kuriuos paveikė ALCL, užkrėsti „limfomą inicijuojančiomis ląstelėmis“ timocitų populiacijoje, kurios po chemoterapijos galėtų prisidėti prie atkryčio, akivaizdžiai pašalino ligą. Anksčiau mes parodėme, kad ALCL skleidžiančios ląstelės išreiškia su ETP susijusį geno parašą, laikydamosi numanomos timos kilmės, kaip aprašyta dabartiniame modelyje 32 . Iš tikrųjų NPM – ALK nuorašai buvo aptikti 2% naujagimių virkštelės kraujo 33 ir NPM – ALK ekspresiją reguliuoja endogeninis NPM1 promotorius, kuris skatina visur esančią NPM1 raišką, įskaitant ir timos protėvius (papildomas 10 pav.). Taigi nėra neprotinga spėlioti, kad NPM – ALK taip pat išreiškiami šioje ląstelių populiacijoje.

Metodai

Žmogaus ALCL biopsijos

Naviko biopsijos buvo gautos gavus informuotą sutikimą diagnozavus 57 iš ALK teigiamos ALCL, centrizuoto Tulūzos Universiteto vėžio patologijos skyriuje, vadovaujantis institucijų peržiūros tarybos patvirtintais protokolais (DC 2009-989) ir vadovaujantis 1975 m. Helsinkio deklaracija., pataisytą 2000 m. Visi, išskyrus du (viena minkštųjų audinių masė, vienas storosios žarnos navikas), buvo limfmazgių biopsijos. Tarp 57 pacientų 35 buvo vyrai ir 22 moterys. Tyrimo grupėje dalyvavo 48 vaikų ALCL (jaunesni nei 18 metų) ir 14 suaugusiųjų ALCL. ALCL diagnozė buvo atlikta į formalinu fiksuotus parafinu įterptus audinius remiantis morfologiniais ir imunofenotipiniais kriterijais, aprašytais paskutinėje PSO klasifikacijoje 34, naudojant didelę monokloninių antikūnų prieš CD30 / BerH2, ALK, EMA, keletą T ląstelių grupę. (CD2, CD3ɛ, CD4, CD5, CD7, CD8, CD43) ir B-ląstelių žymekliai (CD20, CD79a) ir citotoksinės molekulės (Perforin, Granzyme B, TiA1). Atvejai buvo klasifikuojami kaip T / NK linija, jei jie reagavo su vienu ar daugiau antikūnų prieš T arba NK ląstelių antigenus CD2, CD3ɛ, CD4, CD5, CD7, CD8, CD43 arba citotoksines molekules ir neturėjo reaktyvumo CD20 ir CD79a B atžvilgiu. su ląstelėmis susijusių antigenų. Nulinis fenotipas buvo paskirtas tiems atvejams, kurie neišreiškė nei su T / NK, nei su B ląstelėmis susijusių žymenų. Visus atvejus peržiūrėjo tarptautinė patologijos komisija. Penkiasdešimt atvejų buvo išreikštas NPM – ALK baltymas, keturiais TPM3 – ALK ir dviem ATIC – ALK; vienu atveju nebuvo identifikuotas ALK partneris.

Sušaldyto naviko mėginiai, gavus informuotą sutikimą, buvo paimti iš CHU de Toulouse naviko audinių banko, vadovaujantis institucijų peržiūros tarybos patvirtintais protokolais (DC 2009-989) ir pagal 1975 m. Helsinkio deklaraciją, pataisytą 2000 m. ląstelės buvo įvertintos užšaldytose atkarpose dažant ALK1 arba CD30 ir buvo didesnės nei 40% visais atrinktais atvejais. Remiantis gamintojo protokolu, visa DNR buvo ekstrahuota iš 10 užšaldytų naviko biopsijų atkarpų (kiekvienos 10 μm storio), naudojant QIAamp DNA Mini rinkinį (Qiagen, Courtaboeuf, Prancūzija). Remiantis gamintojo protokolu, bendras RNR ekstrahavimas atliktas iš 40 užšaldytų naviko biopsijų atkarpų (kiekvienos storis 5 μm), naudojant „Trizol“ bendrojo RNR išskyrimo reagentą (Invitrogen, San Diegas, JAV). Koncentracija buvo įvertinta NanoDrop spektrofotometru (NanoDrop Technologies, Wilmington, JAV). RNR vientisumas buvo įvertintas naudojant „Agilent 2100 Bioanalyzer“ (Agilent, Massy, ​​Prancūzija). DNR vientisumas buvo įvertintas atliekant 6% poliakrilamido gelio elektroforezę. RAG1 nuorašų kiekybinis įvertinimas buvo atliktas, kaip aprašyta anksčiau 35 .

Žmogaus thymi buvo gauti iš vaikų chirurginio audinio išmetimo, gavus informuotą tėvų ir Necker Enfants Malades ligoninės Paryžiaus Descartes etikos apžvalgos komisijos sutikimą.

Žmogaus TCR pertvarkymų genetinė analizė

TCRγ multipleksinė PGR buvo atlikta, kaip aprašyta 36 . Trumpai tariant, 500 ng DNR buvo amplifikuota 35 ciklams su 0, 25 μM kiekvienu pradmeniu, 2, 5 mM MgCl2 ir 1 U Taq Gold (Life Technology).

TCRβ ir TCRδ multipleksiniai PGR buvo sukurti „Biomed-2 BMH4-CT98–3936“ suderintame veiksme @JJM 37 . Trumpai tariant, 100 ng DNR buvo amplifikuota 35 ciklų metu, esant 0, 2 μM kiekvienam pradmeniui, 2 mM MgCl2 ir 1 U Taq Gold (Perkin Elmer). TCRβ geno konfigūracija buvo įvertinta naudojant trijų mėgintuvėlių multipleksinį PGR, iš kurių du buvo 27 Vβ šeimai būdingi priešakiniai pradmenys, turintys devynis (PGR A) arba keturis (PGR B) pasroviui Jβ pradmenis (5 papildoma lentelė). Trečiajame (PGR C) buvo visi 13 Jβ pradmenų ir Dβ1 ir Dβ2 pradmenys priešakyje (5 papildoma lentelė). TCRβ ir TCRδ PGR produktai buvo analizuojami atliekant heterodupleksinę analizę ir daugkartinės fluorescencinės PGR analizę Genscan analizėje, atskiriant fluorochromu pažymėtus vienos grandinės (denatūruotus) PGR produktus kapiliarų sekos sudarymo polimere ir aptikimą naudojant automatinį lazerinį skenavimą. Tai lemia Gausso pasiskirstymą keliomis smailėmis, atspindinčiomis daugybę skirtingų PGR produktų, esant polikloniniams pertvarkymams, tačiau atskirą, siaurą smailę, jei klonų populiacija sudaro mažiausiai 1–5% DNR.

Didelis skaičius Vα ir Jα segmentų neleidžia PCR aptikti kloninių pertvarkymų iš DNR, nors TCRα VJC nuorašus galima aptikti iš cDNR. TCRα pertvarkymai buvo amplifikuoti iš cDNR, naudojant Cα ir Vα pradmenis penkiose daugialypėse RT – PGR reakcijose 38 . RNR buvo išskirta naudojant „RNeasy“ rinkinį pagal gamintojo instrukcijas („Qiagen“, „Courtaboeuf“, Prancūzija) ir 1 μg visos RNR buvo paversta cDNR naudojant „SuperScript III RT“ („Invitrogen“, San Diegas, JAV). RNR kokybė ir kiekis buvo įvertinti atsižvelgiant į „ ABL“ namų tvarkymo geną, remiantis Europoje prieš vėžį naudojamu tinklu 39 parengtais protokolais, naudojant „AB 7900HT“ („Applied Biosystems“, Foster City, CA, JAV). RNR (20 ng) buvo amplifikuota kiekviename PGR su 1 U Hotstart Taq (Qiagen, Courtaboeuf, Prancūzija), 10 mM dNTP, 2 mM MgCl2, 20% Q tirpalu ir 10 pmol kiekvieno grunto. Taq polimerazė buvo aktyvuota 15 minučių 95 ° C temperatūroje, po to sekė 37 ciklai, kai 94 ° C 30 s, 63 ° C 45 s ir 72 ° C 1, 5 minutės. Paskutinis pailginimo žingsnis buvo 72 ° C 10 minučių. Neigiamą kontrolę sudarė RNR, išskiriama iš periferinio kraujo mononuklearinių ląstelių iš donorų, o teigiama kontrolė - RNR, išskirta iš Jurkato ląstelių linijos. Pradmenų sekos, naudojamos TCRA transkripto amplifikacijai, išvardytos 3 lentelėje.

Pilno dydžio lentelė

CGH TCR pertvarkymų analizė

Diagnozės metu DNR buvo analizuojama atliekant masyvo lyginamąją genominę hibridizaciją (masyvo-CGH, ​​Agilent žmogaus CGH MicroArray, 180K) ir didelio tankio afiometrijos Cytoscan (2, 7 mln. Zondai) pagal gamintojo rekomendacijas. TCR lokusų ištrynimas, kaip V (D) J rekombinacijos atspindys, buvo apibrėžtas CGH log 2 egzempliorių skaičiaus santykiu, išbraukiant / pertvarkant vieną alelį kaip 0, 5–1, 5, o log 2 kopijų skaičiaus santykį <1, 5 kaip bialleliniai trynimai / pertvarkymai. Su duomenimis galima susipažinti NCBI GEO duomenų bazėje, GSE67131.

Transgeninės pelės

CD4 / NPM-ALK (CD4NA) pelės buvo pagamintos, kaip aprašyta anksčiau (maloniai pateikė profesorius G. Inghirami, Turino universitetas, Italija) 12 . NPM – ALK / OTI (CD4NA / OTI) pelės buvo gautos sukryžminus CD4NA liniją su OT1 transgenine T ląstelių linija (maloniai parūpinta profesoriaus G. Griffiths iš Kembridžo universiteto, JK) 14 . NPM – ALK / RAG2 - / - (NARAG2 - / - ) pelės buvo generuojamos kertant CD4NA liniją iki RAG2 - / - linijos (maloniai parūpinta Kembridžo universiteto, JK profesoriaus C. Rudd). NPM – ALK / RAG2 - / - / OT1 (NA / OTI / RAG2 - / - ) pelės buvo gautos sukryžminus NARAG2 - / - liniją su OT1 transgeninės T ląstelių linija, kuri buvo perbraukta į RAG2 - / - liniją. OTINA pelės buvo paveiktos 2x104 pfu MHV-Ova (MHV68), tris kartus per mėnesį, kas mėnesį nuo 6 savaičių. Virusas buvo paruoštas, kaip aprašyta ref. 21, ją pateikė dr. PG Stevensonas iš Kembridžo universiteto. Visos pelės buvo laikomos nustatytomis patogenų neturinčiomis sąlygomis ventiliatoriniuose narvuose Kembridžo universiteto barjeriniame skyriuje, laikomos C57 / Bl6 genetiniame fone ir buvo tiriamos 4–12 savaičių amžiaus, jei nenurodyta. Visos procedūros buvo atliktos pagal JK vidaus reikalų ministerijos licenciją 80/2630 Kembridžo universitete pagal UKCCR gaires.

Pelių genotipas buvo atliktas PGR metodu iš DNR, ekstrahuotos iš ausų biopsijos, ir PGR produktai buvo atskirti agarozės gelio elektroforeze, kaip aprašyta anksčiau, 12, 40, 41, naudojant šiuos pradmenis: OT1 FWD 5′- ACGTGTATTCCCATCTCTGG -3 ′, OTI R 5′- CTGTTCATAATTGGCCCGA -3 ′; NPM – ALK FWD 5′– TCCCTTGGGGGCTTTGAAATA -3 ′, NPM – ALK RVS 5′ – CGAGGTGCGGAGCTTGCTCAG -3 ′; RAG A 5′- GGGAGGACACTCACTTGCCTATA -3 ′, RAG B 5′ – AGTCAGGAGTCTCCATCTCACTGA -3 ′ ir NeoA 5′ – CGGCCGGAGAACCTGCGTGCAA -3 ′.

Histologija

Pelės, turinčios klinikinius požymius, buvo išnaikintos ir atliktos pomirtinės operacijos, tiriant visus audinius, ar neatsirado naviko. Navikai ir (arba) susiję audiniai buvo fiksuoti 10% formalino, o vėliau parafinas buvo įterptas, pjaustytas ir nudažytas hematoksilinu ir eozinu histologiniam tyrimui. Visas audinių apdorojimas buvo atliktas Kembridžo universiteto (JK) Patologijos skyriuje arba Vienos medicinos universitete, Austrijoje, ir skyrius atskirai tikrino bent du histopatologai.

Imunohistochemija

Imunohistochemija buvo atlikta su šiais antikūnais: CD30 (monokloninė pelė antižmogiška; Ber-H2 klonas, 1:50, Dako, Danija); TCR β-F1 (monokloninė pelė nuo žmogaus, 8A3 klonas, 1: 100, „Thermo Scientific“, IL 61105, JAV); ALK1 monoklonas (1: 100, maloniai pateiktas dr. Karen Pulford, Oksfordo universitetas), kaip aprašyta nuorodoje. 42.

Ląstelių linijos

Žmogaus ląstelių linijos SUDHL-1, Karpas-299, HPB-ALL, DND41 ir Jurkat buvo įsigytos iš DSMZ ir buvo auginamos RPMI1640, papildytame 10% FCS. COST ir PIO ALCL ląstelių linijos buvo sukurtos Lamant laboratorijoje ir buvo auginamos ISCOVE terpėje (Invitrogen, Cergy Pontoise, Prancūzija), papildyta 10% FCS. Visos ląstelių linijos buvo tiriamos kas ketvirtį mikoplazmos ir nėra ICLAC ir NCBI biosample klaidingai identifikuotų ląstelių sąraše.

Srauto citometrija

Pavienių ląstelių suspensijos buvo gautos iš pavienių audinių mėginių. Ląstelės buvo nuplaunamos, suskaičiuotos ir nudažytos šiais pelių fitoeritrinu, fluoresceino izotiocianatu, alofikocianinu arba cianinu 7 (Cy7) konjuguotais antikūnais: CD4, CD8, CD44, CD25, CD30, CD117, CD3, Vα2 TCR, Notch1 (BD Biosciences, Ox)., JK). Po dažymo (30 min. 4 ° C, 1: 1 000) ląstelės buvo plaunamos ir analizuojamos naudojant fluorescenciniu būdu aktyvuotą ląstelių rūšiatorių (FACS) Canto arba Fortessa srauto citometrus (BD Biosciences). Norėdami nustatyti tarpląstelinę dėmę, ląstelės 10 minučių buvo fiksuotos 0, 01% formaldehidu, permeabilizuotos 0, 5% Tween 20, tūrio / tūryje PBS (15 min. Tamsoje, kambario temperatūroje), ląstelės plaunamos 0, 1% Triton PBS ir vėl suspenduojamos 100 μl 0, 1% Tritono PBS, ląstelės buvo nudažytos ir išanalizuotos, kaip aprašyta anksčiau. Kaip alternatyva, ląstelių populiacijos buvo rūšiuojamos naudojant FACS Aria mašiną, kaip aprašyta nuorodoje. 11.

RT – PGR analizė

RNR iš ląstelių buvo išgauta naudojant „RNeasy Micro Kit“ (Qiagen) pagal gamintojo instrukcijas ir paversta į cDNR naudojant „Superscript II“ atvirkštinę transkriptazę (RT) (Invitrogen), naudojant dNTP ir atsitiktinius heksamerius. PGR buvo atlikta naudojant pradmenis, būdingus NPM – ALK 24, RAG2 arba Vα2 (OTI transgenui) (OT1 FWD 5′ – ACGTGTATTCCCATCTCTGG -3 ′, OTI R 5′ – CTGTTCATAATTGGCCCGA – 3 ′; NPM – ALK FWDT 5′ – TCCCCTGGTGGTGGCCTGGCCCGA – NPC – NPG – GGGTGGCCTGG – 3C; 3 ′, NPM – ALK RVS 5′– CGAGGTGCGGAGCTTGCTCAG -3 ′; RAG A 5′ – GGGAGAGACACTCACTTGCCAGTA -3 ′, RAG B 5′ – AGTCAGGAGTCTCCATCTCACTGA -3 ′ ir NeoA 5′-CGGCCGGCGGCGGCGG

Pelių TCR pertvarkymo analizė

DNR buvo ekstrahuota iš 5 × 106 pelės naviko ląstelių arba timocitų, naudojant DNeasy kraujo ir audinių rinkinį (Qiagen). PGR buvo atlikta, kaip aprašyta anksčiau, 13, 43 . Trumpai Vβ2 (5′-GTAGGCACCTGTGGGGAAGAAACT -3 ′) arba Dβ2 pirmyn (5′-GGGTCACTGATACGGAGCTG -3 ′) pradmenys ir Jβ2 atvirkštiniai (5′-TGAGAGCTGTCTCCTACTATCGATT -3 ′) gruntas (naudojamas VJ, ir VJ). amplifikuoti pertvarkytas TCRβ sritis, kurios vėliau buvo atskirtos elektroforeze. Visi neiškirpti vaizdai yra pateikti papildomuose 11–14 pav., Pateikiant visus pateiktus PGR duomenis.

RAG statuso RQ-PCR

RAG ekspresijos nuorašo Ct vertės buvo normalizuotos RNR kokybei ir kiekiui Abl atžvilgiu, kaip aprašyta anksčiau 35 . Kaip aprašyta 39, viena mikrograma visos RNR buvo perrašyta atvirkščiai, o RNR kokybė ir kiekis buvo įvertinti ABL namų tvarkymo geno atžvilgiu ABI PRISM 7900HT (Applied Biosystems, Foster City, CA, JAV). Rag1 analizei naudojami pradmenys buvo: RAG1 prasmė, 5′- AGCCTGCTGAGCAAGGTACC -3 ′; antisense, 5′- GAACTGAGTCCCAAGGTGGG -3 ′; zondas, Fam-5′- AGCCAGCATGGCAGCCTCTTTCC -3′-Tamra

Imunohistochemija

Dvigubo dažymo imunohistochemija buvo atlikta naudojant automatizuotą „Ventana Benchmark“ platformą („Ventana Medical Systems Tuscon“, AZ, JAV), nuosekliai dažant abu antikūnus (pirmiausia TCR β-F1, paskui CD30). Preliminarus gydymas buvo atliekamas su fermentu I (Leica AR9551) TCR β-F1 ir Epitope Retrieval 1 (Leica AR9961) CD30. Dažymas buvo atliktas naudojant „Bond Polymer Refresh“ aptikimo rinkinį (DAB TCR β-F1) ir „Bond Polymer Refresh Red“ aptikimo rinkinį („AP Fast Red for CD30“) pagal gamintojo rekomendacijas. ALK1 dažymas buvo atliktas naudojant standartinį protokolą. HIER procedūra buvo atlikta antigenui išgauti naudojant „Target Retrieval Solution“ (DAKO S2369). Kūrimas buvo atliktas naudojant IDetect Super Stain System HRP (ID Laboratories, IDSTM007). Signalas buvo vizualizuotas naudojant 3-amino-9-etilkarbazolą (ID Laboratories, BP1108).

Timocitų švitinimas ir intraveninė injekcija

Prieš injekciją laukinio tipo pelės recipientas buvo paveiktas dviem švitinimo etapais iš viso 11 pilkų, kad būtų galima išvalyti šeimininko kaulų čiulpus. Timocitai buvo gauti iš CD4NR pelės užkrūčio šlaunies, kuri parodė displazijos požymius, įvertintus pagal ląstelės paviršiaus baltymų ekspresiją. CD44 hi ir CD44 lo populiacijos buvo suskirstytos į PBS naudojant FACS Aria (BD). Išrūšiuoti timocitai iš CD45.2 donoro BL / 6 pelių (3x105) buvo sumaišyti su CD45.1 donoro laukinio tipo kaulų čiulpų ląstelėmis (6, 6x104) ir į veną sušvirkšti į švitintus CD45.2 gavėjus.

Liuciferazės tyrimas

Kiekvienoje transfekcijos reakcijoje 1 × 107 Jurkat ląstelės buvo sumaišytos su plazmidės DNR 0, 4 cm ilgio elektrodo tarpo „Gene Pulser“ kiuvetėje (40 μg pGL2-CD44 - žvirblinės luciferazės, 2 μg pRL-TK vektoriaus ir įvairus NPM kiekis). ALK vektorius, kaip nurodyta) ir elektroporacija atlikta Gene Pulser II (Bio-Rad) esant 0, 25 kV ir 950 μF, for 25 ms. Po 48 valandų kultūros Firefly ir renilla luciferazė buvo paveikti atitinkamais substratais, naudojant „Stop and Glo“ rinkinį (Promega), o išėjimas išmatuotas „Victor 3“ etikečių skaitiklyje (Perkin Elmer, Waltham, MA), kaip aprašyta anksčiau 16. .

In vivo EdU ląstelių proliferacijos analizė

Pelėms į pilvaplėvės ertmę buvo sušvirkšta 300 μl 10 mM EdU tirpalo PBS. After 3 h, mice were killed and the thymus of each mouse was isolated before FACS staining for T cell markers as described in the main text. After staining (30 min at 4 °C), cells were washed and then fixed, permeabilized and EdU incorporation detected using a Click-iT EdU Flow Cytometry Assay Kit (Invitrogen). The amount of EdU incorporated was then measured by Flow Cytometry.

Statistika

Data were analysed using a two-tailed Student's t -test (assuming equal variance) or log-rank test, as indicated using GraphPad Prism 6 software (La Jolla, CA).

Prisijungimai

Genų ekspresijos omnibusas

  • GSE67131

Papildoma informacija

PDF failai

  1. 1.

    Papildoma informacija

    Supplementary Figures 1-14 and Supplementary Tables 1-5

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.