Brca2 antrinis mutacijų sukeliamas atsparumas platinos ir parp inhibitorių terapijai kasos vėžyje | britų žurnalas apie vėžį

Brca2 antrinis mutacijų sukeliamas atsparumas platinos ir parp inhibitorių terapijai kasos vėžyje | britų žurnalas apie vėžį

Anonim

Dalykai

  • Vėžio terapinis atsparumas
  • Kasos vėžys

Šis straipsnis buvo atnaujintas

Anotacija

Pagrindiniai faktai:

Kasos vėžys tapo trečiąja pagrindine mirties nuo vėžio priežastimi, per 40 metų jo rezultatas pagerėjo nedaug. Naujausi gydymo, kurio tikslas - palaikyti netobulą DNR palaikymą, naudojant poli (ADP-ribozės) polimerazės (PARP) inhibitorius, tyrimai rodo daug žadančių rezultatų, tačiau pacientai visada pasikartoja ir pasiduoda ligai. Atsparumo platinos pagrindu veikiančiam ir PARP inhibitorių gydymui kitų tipų vėžiui mechanizmai apima antrines mutacijas, kurios atkuria DNR atstatymo vientisumą per vis daugiau skirtingų mechanizmų.

Metodai:

Pateikiame 63 metų pacientės, turinčios lytinių ląstelių patogeninę BRCA2 mutaciją (išbraukta 6714), kurioms išsivystė kasos vėžys ir turinčias išskirtinį atsaką į gydymą platinos ir PARP inhibitoriais, 63 metų moteris. Atlikdami naujos kartos seką ir atlikdami klinikinius tyrimus, mes koreliavome naviko atsaką ir atsparumą BRCA2 mutacijos būsenai navike.

Rezultatai:

Iš pradžių pacientas turėjo išskirtinį atsaką į gydymą platinos ir PARP inhibitoriais, greičiausiai dėl BRCA2 mutacijos. Tačiau pirminis pažeidimas pasikartojo gydant PARP inhibitoriais ir jame buvo antrinė BRCA2 mutacija , kuri greičiausiai atstatė BRCA2 funkciją PARP inhibitoriams atspariose naviko ląstelėse.

Išvados:

Mūsų žiniomis, tai yra pirmasis pranešimas apie BRCA2 reversinės mutacijos atvejį, kuris suteikė atsparumą PARP inhibitoriais paremtam gydymui kasos latako adenokarcinoma sergančiam pacientui. Būsimi tyrimai reikalingi norint suprasti šį svarbų atsparumo mechanizmą ir kaip tai gali turėti įtakos pasirenkant terapiją pacientams, sergantiems kasos vėžiu.

Pagrindinis

Naujausi duomenys rodo, kad kasos latakų adenokarcinoma (PDA) sergantiems pacientams, kurių navikai turi homologiniame rekombinacijos kelyje dalyvaujančių genų defektus, ypač BRCA1 ir BRCA2 mutacijas, gali būti naudinga poli (ADP-ribozės) polimerazės (PARP) inhibitorių - pagrįsta terapija (Lowery ir kt., 2011; Pishvaian ir kt., 2013; O'Reilly ir kt., 2014; Kaufman ir kt., 2015). Individualizuotos terapijos požiūriu ši pacientų kohorta yra nemaža, nes ankstesniuose pranešimuose teigiama, kad konservatyvios 5–7% PDA turi mutacijas BRCA kelyje, o naujausi sudėtingesni PDA genomų apklausos rodo, kad iki 20% PDA turi DNR defektų. atsakas į žalą, dėl kurio gali atsirasti jautrumas platinos terapijai ir vaistams, kurie konkrečiai nukreipti į šiuos mechanizmus (PARP, ATR ir Wee1 inhibitoriai; Waddell ir kt., 2015; Bailey ir kt., 2016). Tiesą sakant, vykstantys klinikiniai tyrimai atskleidė, kad pacientams, sergantiems PDA, kurių mutacija yra BRCA, išgyvenamas 12 mėnesių ar ilgesnis išgyvenamumo laikotarpis be ligos progresavimo, kai atviras atsakymo lygis yra didesnis nei 50%. Deja, šių pacientų navikai ilgainiui išsivysto prieš PARP inhibitorių pagrįstą gydymą.

Kasos latakų adenokarcinomos ląstelės, pakeistos DNR taisymo genuose, BRCA2 , FANCC ir G (pažymėtuose kaip „ BRCA trūkumas“), yra visos padidėjusio jautrumo kryžminių jungčių agentams ir vaistams iš platinos in vitro ir in vivo. (van der Heijden ir kt., 2005). Ashworthas ir jo kolegos parodė, kad ląstelėse, kuriose trūksta genų, turinčių homologinį rekombinacijos atstatymo kelią dvigubo pluošto pertraukas (įskaitant BRCA1, BRCA2, RAD51, RAD54, DSS1, RPA1, NBS1, ATR, ATM, CHK1, CHK2, FANCD2, FANCA ar FANCC) ) taip pat yra padidėjęs jautrumas PARP inhibitoriams (Farmer ir kt., 2005; McCabe ir kt., 2006). Taigi PARP inhibitoriai yra tiriami kaip įvairių vėžio rūšių, pažeistų BRCA kelyje, gydymo galimybė, o PARP inhibitorius olaparibas (Lynparza, Astra Zeneca, Kembridžas, JK) neseniai buvo patvirtintas dėl BRCA mutavusio kiaušidžių vėžio.

Poli (ADP-ribozės) polimerazė yra branduolinis fermentas, atliekantis kritinį vaidmenį atkuriant DNR žalą (McCabe ir kt., 2006; Donawho ir kt., 2007; Kummar ir kt., 2009). Taigi PARP slopinimas sukelia mažiau efektyvų DNR atstatymą po citotoksinio įžeidimo. Taigi PARP inhibitoriai veikia kaip sensibilizuojančios medžiagos įvairiems DNR kenkiantiems chemoterapiniams preparatams ir radioterapijai. Veliparibas (ABT-888, Abbvie Inc., Lake Bluff, IL, JAV) yra PARP inhibitorius, įrodantis in vivo aktyvumą (Kummar ir kt., 2009) ir padidinantis naviko ląstelių jautrumą chemoterapijai, įskaitant cisplatiną, irinotekaną, ir temozolomidas, ir radiacija (Curtin ir kt., 2004; DePinho ir Polyak, 2004; Langelier ir kt., 2008; Sharpless ir DePinho, 2004). Taigi šiuo metu vyksta dešimtys klinikinių PARP inhibitoriais pagrįstų kombinuotų terapijų tyrimų (Clinical trials.gov).

Nuo 2000-ųjų vidurio PARP inhibitoriais pagrįstas gydymas parodė daug žadančių rezultatų pacientams, sergantiems BRCA mutavusiais vėžiais (Audeh ir kt., 2010; Fong ir kt., 2010; Tutt ir kt., 2010; Gelmon ir kt., 2011; Lowery ir kt.)., 2011; Kaye ir kt., 2012; Ledermann ir kt., 2012; Sandhu ir kt., 2013; Kaufman ir kt., 2015; Mateo ir kt., 2015; Oza ir kt., 2015). Pavyzdžiui, Audeh ir kt. (2010) įrodė, kad pacientams, sergantiems BRCA mutavusiu pasikartojančiu kiaušidžių vėžiu, 33% atsako į vienkartinį agentą olaparibą, vartojamą po 400 mg du kartus per parą, buvo 33%. Panašius rezultatus paskelbė Fong ir kt. (2010), nors jų, sergančių BRCA mutavusių kiaušidžių vėžiu, grupėje atsakas į platinos jautrią ligą buvo 61%. Čia pateikiame PDA paciento, turinčio lytinės ląstelės BRCA2 mutaciją, atvejo, parinkto terapijai PARP inhibitoriais, atvejį.

Metodai ir rezultatai

Mūsų pacientė yra 63 metų moteris, kuriai buvo diagnozuotas kasos vėžys, kai 2014 m. Balandžio mėn. Jai iš pradžių pasireiškė pykinimas, vėmimas, pilvo skausmas ir gelta. Ji sirgo stipria vėžio istorija šeimoje, o brolis sirgo krūties vėžiu., o jos motina serga krūties ir gimdos vėžiu, o tėvas serga prostatos vėžiu. Anksčiau pacientas pasirinko lytinių takų tyrimus (iš žandikaulio tampono) per „Myriad“ 2010 m. Balandžio 22 d., Tai parodė žalingą 6714 delecijos mutaciją BRCA2 . Atlikus MRT 2014 m. Balandžio 03 d. Nustatyta kasos galvos 1, 7 × 2, 1 cm masė, o pacientas buvo nukreiptas į Johns Hopkins universitetinę ligoninę įvertinti. Kasos protokolo kompiuterinė tomografija, gauta atliekant stadiją, parodė lokalizuotą naviką, kuriame nedalyvavo kraujagyslės. Ji dalyvavo priešoperaciniame trumpo skiepijimo (GVAX) kurso tyrime, kuriame prieš operaciją buvo skiriama 7 dienų peroralinis ciklofosfamidas (50 mg per parą). Tada 2014 m. Gegužės 1 d. Pacientui buvo atlikta chirurginė apžiūra, kad būtų atlikta planuojama kasos kardiotikodenektomija. Deja, operacijos metu jai buvo nustatyta metastazavusi kepenų liga, kuri buvo įrodyta intraoperaciniame užšaldytame skyriuje. Kepenų pažeidimas buvo išpjaustytas ir išsiųstas į „Foundation Medicine“, kad būtų galima sekti su vėžiu susijusius genus naujos kartos („Foundation ONE“ testas), kurio rezultatai atskleidė patogeninę BRCA2 mutaciją (c.6486_6489delACAA p.K2162fs * 5), keturių bazių porą. ištrynimas, dėl kurio priešlaikinis STOP kodonas atsirado (1 pav.). Atidus BRCA2 mutacijos, aptiktos naviko mėginyje, nustatymas „Foundation Medicine“ (diskusija su „Foundation Medicine“), patvirtino, kad specifinė mutacija buvo tokia pati kaip paciento gemalinės linijos BRCA2 mutacija, nustatyta ant žando tampono. Atkreiptinas dėmesys, kad įvertinus mutacinį alelio dažnį (MAF), paaiškėjo, kad BRCA2 mutacijos MAF buvo 61% - taigi didesnis alelių dažnis, nei būtų galima tikėtis grynai heterozigotinės būklės atveju, ir tai rodo, kad heterozigotumas buvo prarastas. vėžinių ląstelių dalis. Tačiau kadangi tirtas mėginys nebuvo iš išskirtų naviko ląstelių, gretimų stromos ląstelių užterštumas galėjo turėti įtakos MAF rezultatams, o grynai naviko ląstelėse MAF iš tikrųjų galėjo būti didesnis nei 61%. Auglyje taip pat buvo KRAS G12V ir TP53 mutacijų (P295fs * 50), būdingų kasos adenokarcinomoms.

Image

Paciento vaizdai. Pradiniame skenavime nuo 2014 m. Gegužės 28 d. Nustatyti kepenų pažeidimai ir kasos masė. Šie pažeidimai lėtai pagerėjo gydant veliparibu, 5-FU ir oksaliplatina, o iki 2015 m. Kovo 23 d. Kepenų pažeidimas nebuvo matomas, o kasos masė buvo vos matoma. Tačiau nuo 2015 m. Gegužės mėn. Iki 2015 m. Rugpjūčio mėn. Kasoje išaugo atsparus klonas, ekscentriškas nuo pradinės masės.

Visas dydis

Po operacijos pacientas buvo pastebėtas Džordžtauno universitete siekiant dalyvauti IRB patvirtintame I / II fazės tyrime su 5-FU, oksaliplatina ir veliparibu (NCT01489865). Jos išankstinis gydymas CA 19-9 buvo 31, 5, o pradinis vaizdas parodė kasos galvos masę 1, 7 cm × 1, 7 cm, taip pat kairiojo skilties kepenų pažeidimą, 2, 3 cm × 2, 0 cm (1A paveikslas, pradinis vaizdas). Gydymas susideda iš standartinės modifikuotos FOLFOX6 schemos su oksaliplatinos (85 mg m – 2 ) 1-ą dieną ir nepertraukiamos infuzijos 5-fluorouracilu (2400 mg m – 2 ) 1–3 dienomis, tačiau be 5-fluorouracilo boliuso. Ji taip pat vartojo 200 mg veliparibo per burną du kartus per dieną 7 dienas, o ciklai buvo kartojami kas 2 savaites. Mūsų pacientas pradėjo gydymą 2014 m. Birželio 05 d. Ir turėjo nemažą pykinimą ir vėmimą, todėl veliparibą reikėjo sumažinti 50% iki 100 mg du kartus per parą. Ji taip pat turėjo nutraukti oksaliplatinos vartojimą po 13 ciklo dėl neuropatijos. Nepaisant to, pacientas tęsė gydymą 31 ciklą iki 2015 m. Rugpjūčio 10 d. (Išgyvenimas be progresijos = 15 mėnesių). Tyrimo metu ji patyrė beveik visišką atsaką, kai kepenų pažeidimas ir kasos galvos pažeidimas radioaktyviuoju būdu rentgenografiškai išnyko iki 2015 m. Kovo 23 d. (1B paveikslas, šalia visiško vaizdo vaizdavimo). Tada, pradedant 2015 m. Gegužės 18 d., Jos vaizdavimas parodė atnaujintą kasos galvos masės progresavimą. Įdomu tai, kad pakartotinis augimas, palyginti su pirminės kasos mase, buvo ekscentriškas, vizualiai rodo, kad periferijoje auga nepriklausomas, atsparus klonas (1C ir D paveikslai, atsirandantis atsparumo vaizdas).

Remiantis RECIST kriterijais, pacientui iki 2015 m. Rugpjūčio 10 d. Buvo išsivysčiusi progresuojanti liga, tačiau jos ligos našta vis dar buvo minimali ir nebuvo įrodymų apie papildomą kasos ligą. Remdamasis tuo, kad nebuvo sukurti papildomi kepenų pažeidimai ir nebuvo reaguota į sisteminę terapiją, pacientas 2015 m. Rugsėjo 10 d. Buvo atliktas chirurginis tyrimas Johns Hopkins universiteto ligoninėje, turint tikslą atlikti pankreatikodudenektomiją. Vienintelis identifikuojamas kepenų pažeidimas buvo pašalintas ir rastas rando audinys, esantis operacinėje sušaldytoje dalyje. Dėl šių operacijų operacijos pacientui tuo metu buvo atlikta ribinė neigiama pankreatikoduodenektomija. Galutinė patologija atskleidė pirminę kasos adenokarcinomą, pasireiškusią 3 iš 24 vietinių limfmazgių, kuriems nustatyta liga. Galutinė patologija patvirtino tik kepenų pažeidimo randą. Po operacijos ji nepaprastai atsigavo.

Po rezekcijos, dėl paciento nenoro skirti papildomą citotoksinę chemoterapiją, ji vietoj citotoksinio adjuvantinio gydymo pradėjo palaikomąją strategiją olaparibą. Ji buvo gydoma po 400 mg per burną du kartus per dieną, tačiau dėl pykinimo ir nuovargio greitai reikėjo sumažinti dozę iki 200 mg du kartus per dieną. Per tą laiką rezekcijos mėginys buvo pakartotinai nusiųstas „Foundation Medicine“, kuris vėl pranešė apie originalias mutacijas (įskaitant identiškas KRAS ir TP53 mutacijas), tačiau taip pat atskleidė naują somatinę (antrinę) BRCA2 mutaciją (c.6448_6473delAAAGTTTCTCCATATCTCTCTCTCAATT p.K2150fs *). 17). Ši somatinė 26 bazės delecija BRCA2 gene buvo 13 bazių prieš 4 gemalo linijos bazės poros to paties alelio deleciją. Ši antrinė somatinė delecija atkūrė BRCA2 geno, kuriame buvo keturios bazinės delecijos, skaitymo rėmus (2 paveikslas). Įdomu tai, kad kasos rezekcijos pavyzdžio antrinės mutacijos MAF buvo tik 8%, tuo tarpu gemalinės linijos BRCA2 mutacijos MAF sumažėjo iki 52%. Šie rezultatai rodo, kad tik palyginti nedidelė mutavusių alelių dalis patyrė šią antrinę mutaciją. Kliniškai, iškart po pankreatikodudenektomijos, nebuvo pasikartojančios metastazavimo požymių, o šios antrinės mutacijos funkcinės pasekmės šiame kontekste nebuvo žinomos. T. y., Nors skaitymo rėmelis buvo atkurtas, nebuvo žinoma, ar tai sukuria visiškai, ar net hipofunkcinį BRCA2 . Dėl to olaparibas buvo tęsiamas. Deja, iki 2016 m. Sausio mėn. Pradžios pacientui buvo akivaizdu, kad nėra simptomų, o vaizdavimas parodė ankstyvą pilvaplėvės karcinomatozę, o tai rodo, kad olaparibas negalėjo kontroliuoti savo ligos. Taigi jai buvo nutraukta terapija ir ji galėjo dalyvauti CXCR2 antagonisto AZD5069 ir durvalumabo (NCT02499328) derinio imunoterapijos tyrime. Studijuodama ji sukūrė pūlingą cholecistitą ir mirė 2016 m. Gegužės 24 d.

Image

Lytinės ir antrinės BRCA2 mutacijos sergant kasos vėžiu. ( A ) Mutacijų vieta 11 egzone - pastabos artumas. ( B ) Ląstelinės linijos mutacija su delecija išryškinta geltonai, C parodant gautą nuorašą su priešlaikiniu STOP kodonu. D parodo antrinę somatinę mutaciją normalioje BRCA2 sekoje, o E parodo antrinę mutaciją, kai gemalo linija ištrinama atkuriant skaitymo rėmus. Žalias langelis su rodykle rodo, kaip antrinė mutacija sugrąžina kodavimo sritį į teisingą skaitymo rėmelį. Spalvotą šio paveikslėlio versiją galite rasti „ British Journal of Cancer“ žurnale internete

Visas dydis

Išvados

Pasiūlyta daugybė PARP inhibitorių atsparumo mechanizmų (Montoni ir kt., 2013), tačiau Sakai ir kt. (2008) ir Edwardsas ir kt. (2008) pirmieji apibūdino, kad BRCA2 reversijos mutacijos gali sukelti atsparumą PARP inhibitoriais pagrįstai terapijai (Ashworth)., 2008). Jie parodė, kad PDA ląstelių linija CAPAN1, praradusi vieną BRCA2 geno kopiją ir turinčią c.6174delT mutaciją kitoje, yra nepaprastai jautrūs stipriems PARP inhibitoriams (McCabe et al., 2005). Ląstelių linijoje šią mutaciją lydėjo BRCA2 geno laukinio tipo kopijos praradimas, tačiau baltymai sudarė apytiksliai 2000 aminorūgščių. Šis tyrimas, nors ir atliktas tik vienoje ląstelių linijoje, parodė, kad PARP inhibitoriai nukreipė į šį BRCA2 genetinį pažeidimą, parodydami, kad izogeninės ląstelės, susidariusios tapti> 1000 kartų atsparios, patyrė antrinę mutaciją, kuri atkūrė atvirą BRCA2 sekos skaitymo rėmą, taigi atkuriant DNR taisymo funkciją (ty kartojasi RAD51 jungtis su BRCA; Ashworth, 2008).

Vėliau kiti taip pat parodė antrinių BRCA1 / 2 mutacijų, kurios suteikia atsparumą terapijai pacientams, sergantiems BRCA1 / 2, turinčiu mutaciją su kiaušidžių vėžiu, kuriems navikai tapo atsparūs terapijai, kurios pagrindas yra platinos (Swisher ir kt., 2008; Norquist ir kt., 2011). ) ir gali atsirasti naudojant įvairius mechanizmus, kurių nebūtų galima aptikti naudojant NGS pasirinktiems genams ir kuriems gali reikėti viso genomo sekos nustatymo (Patch ir kt., 2015). Svarbu tai, kad Sakai ir kt. (2008) įrodė, kad platinai atsparios, BRCA2 funkciškai atstatomos kiaušidžių vėžio ląstelių linijos taip pat rodo atsparumą PARP inhibitorių terapijai. Papildomi tyrimai su pacientais, sergančiais krūties ir kiaušidžių vėžiu, aprašė BRCA reversijos ir PARP inhibitorių atsparumo raidą (Barber ir kt., 2013). Pažymėtina, kad Ang ir kt. (2013) įvertino atsaką į chemoterapiją, įskaitant chemoterapiją iš platinos, pacientams, kuriems nustatytas PARP inhibitorių (olaparibas) atsparus kiaušidžių vėžys. Keista, tačiau šie PARP inhibitoriams atsparūs kiaušidžių vėžiai išlaikė jautrumą chemoterapijai, įskaitant platiną. Tačiau šiuos pastebėjimus supainiojo tai, kad nė viename PARP inhibitoriui atspariame kiaušidžių vėžyje nebuvo nustatyta BRCA reversijos įvykių, taigi buvo įrodymų, kad gali būti naudojami kiti mechanizmai, tokie kaip vaistų transportavimo ar vaistų metabolizmo defektai.

Kadangi mūsų pacientas buvo gydomas keliais būdais, įskaitant tuos, kurie nukreipti į panašius mechanizmus, tokius kaip platinos ir PARP slopinimas, sunku tiksliai apibrėžti. Vis dėlto pagrįsta, kad platinos ir (arba) PARP inhibitoriai sukėlė selekcinį spaudimą navikui, kad būtų atstatyti sugedę DNR pažeidimo atsako mechanizmai. Mūsų žiniomis, tai yra pirmasis pranešimas apie BRCA2 reversijos mutaciją, kuri PDA pacientui suteikė atsparumą PARP inhibitoriais pagrįstai terapijai. Būsimi tyrimai reikalingi norint suprasti šį svarbų atsparumo mechanizmą ir kaip tai gali turėti įtakos pasirenkant terapiją pacientams, sergantiems kasos vėžiu. Pagrindinis šio požiūrio aspektas yra naviko biopsijų įvertinimas prieš ir po gydymo.

Pokyčių istorija

Šis darbas publikuojamas pagal standartinę licenciją skelbti sutartį. Po 12 mėnesių darbas taps laisvai prieinamas, o licencijos sąlygos bus pakeistos į „Creative Commons“ priskyrimo - nekomercinio - bendro naudojimo - nepanaudotą 4.0 licenciją.