Kondensinas i asocijuojasi su stuburinių chromosomų struktūriniais ir genų reguliavimo regionais | gamtos komunikacijos

Kondensinas i asocijuojasi su stuburinių chromosomų struktūriniais ir genų reguliavimo regionais | gamtos komunikacijos

Anonim

Dalykai

  • Chromosomų atskyrimas

Anotacija

Kondenzino kompleksas yra būtinas norint teisingai supakuoti ir atskirti chromosomas mitozės ir mejozės metu visuose eukariotuose. Iki šiol stuburiniams gyvūnams nebuvo įmanoma nustatyti genomo masto ir kondensiną surišančių vietų pobūdžio. Pateikiame viso genomo kondensino I žemėlapį vištienos DT40 ląstelėse. Netikėtai pastebime, kad kondensinas I daugiausia jungiasi su promotoriaus sekomis mitozinėse ląstelėse. Taip pat aptinkame ryškų sodrumą tiek centromeruose, tiek telomeruose, pabrėžiant komplekso svarbą chromosomų atskyrime. Apibendrinus, rezultatai rodo, kad kondensino I heterochromatiniuose regionuose beveik nėra. Šis kondensino I surišimo vietų ant vištos genomo žemėlapis rodo, kad kondensino pasiskirstymo chromosomose modeliai yra išsaugomi nuo prokariotų, per mieles ir paskui stuburinius. Taigi trijose gyvenimo karalystėse kondensinas yra praturtintas aktyvių transkribuotų genų promotoriais ir vietose, svarbiose chromosomų atskyrimui.

Įvadas

Chromosomų (SMC) baltymų struktūrinis palaikymas yra būtinas chromosomų atskyrimui tarp rūšių, pradedant nuo prokariotų ir baigiant žmonėmis. SMC baltymai yra ABC ATPazės, galinčios pakeisti DNR topologiją per ATP surišimo ir hidrolizės ciklus 1, 2 . SMC baltymai jungiasi poromis, o eukariotuose yra šeši skirtingi SMC, kurie sudaro tris kompleksus. Nors SMC yra struktūriškai panašūs, jie turi skirtingas funkcijas: SMC1 / 3 (kohesinas) dalyvauja seserinės chromatidinės darnos ir genų reguliavime, SMC5 / 6 DNR taisyme ir SMC2 / 4 (kondensinas) chromosomų architektūroje 3, 4 . SMC baltymai, kurie filogenetiniu būdu yra prieš histonus, ir yra būtini norint kontroliuoti įvairius ląstelių ciklo aspektus, nes jie gali modifikuoti ir modifikuoti chromatiną. Dėl visapusiško vaidmens atliekant svarbias ląstelių ciklo funkcijas, jie vis labiau vadinami pasaulinio genomo organizatoriais 5 .

Pagrindinė pažintis su chromosomų pakuotėmis buvo padaryta atradus kondensiną - labai konservuotą pentamerinį kompleksą, sudarytą iš dviejų SMC baltymų. Kondensinas yra senovės baltymų kompleksas, konservuojamas nuo prokariotų iki eukariotų 6 . Yra du kondensino pavidalai stuburiniuose: I ir II kondensinai. Juos abu sudaro SMC2 ir SMC4 ATPazės ir trys pagalbiniai subvienetai, vadinami su kondensinu susiję baltymai (CAP): CAP-G, CAP-D2 ir CAP-H, skirti kondensinui I; CAP-G2, CAP-D3 ir CAP-H2 kondensinui II 3, 7, 8 .

Įvairių organizmų tyrimai parodė, kad kondensino kompleksas turi lemiamą reikšmę formuojant ir atskiriant struktūriškai stabilias mitozines chromosomas į dukterinius branduolius 5, 9, 10 . Stuburiniuose gyvūnuose kondensinas I yra apribotas citoplazma interfazės metu ir įkeltas į chromosomas profazės pabaigoje po branduolinio apvalkalo suirimo (NEBD) 11, 12 . Priešingai, kondensinas II lokalizuojasi DNR tarpfazėje ir mitozėje. Kondensato lokalizacija stuburiniuose gyvūnuose buvo intensyviai tiriama fiksuotose ląstelėse, naudojant kondensino antikūnus, ir in vivo su GFP pažymėtais kondensino subvienetais 11, 12, 13, 14 . Tačiau iki šiol stuburinių gyvūnų genomo kondensiną surišančios vietos išliko silpnos.

Kai kurie genomo masto tyrimai su bakterijomis ir mielėmis pateikė keletą įkalčių apie tai, kur kondensinas gali jungtis su stuburiniais gyvūnais. Prokariotinių kondensinų tipo SMC homodimeras, rastas B. subtilis, per ParB / Spo0J yra pakraunamas į centromerą primenančias sekas, vadinamas par S 15, 16 . Ryšio vietos yra arti DNR replikacijos pradžios, tai rodo, kad kondensinas gali padėti sutankinti naujai replikuotą DNR, kad ji būtų pasirengusi atskirti chromosomą 15 . Genomo masto kondensino žemėlapiai S. cerevisiae ir S. pombe rodo, kad kondensinas jungiasi prie atskirų genomo vietų 17, 18 . Mielių kondensinas yra įdarbinamas per kohesino krautuvą Scc2 – Scc4 ir yra praturtintas centromeruose ir išilgai chromosomos ginklų ties labai transkribuota tRNR ir rRNR genais 17 .

Be nustatyto vaidmens chromosomų atskyrime, kondensinas vaidina mažiau suprantamą vaidmenį reguliuojant genų ekspresiją. Mielėse kondensinas moduliuoja rDNR išdėstymą branduolyje ir yra atsakingas už tyliųjų chromatinų domenų palaikymą 19 genome. D. melanogasterio atveju kondensino I subvienetas CAP-G sustiprina ir slopina padėties efektų kitimą (PEV), tuo tarpu CAP-D3 / kondensino II mutantai slopina PEV 20 . Kiti D. melanogasterio tyrimai rodo, kad CAP-D3 tiesiogiai sąveikauja su retinoblastomos baltymu RBF1, reguliuodamas įgimtos imuninės sistemos genų ekspresiją 21, 22 . Žmogaus ląstelėse baltymo fosfatazės 2A (PP2A), pasamdyto HSF2 prie hsp70 promotoriaus, inaktyvuojamas kondensinas I ir dėl to sumažėja mitozės metu promotoriaus srities kompaktiškumas mitozėje 23, 24 . Tai vadinama žymėjimu ir padidina žymėtų genų transkripciją kitame G1 (nuorodos 24, 25).

Norėdami išsiaiškinti, koks yra kondensino I vaidmuo stuburiniuose gyvūnuose, mes panaudojome ChIP-seq analogišką metodą, kad sudarytume pirmąjį genomo masto kondensino I susijusios DNR žemėlapį vištienos DT40 limfomos B ląstelėse. Mūsų genomo masto kondensino I žemėlapį papildo tiesioginė funkcinė analizė, naudojant RNR, išskirto iš CAP-H / kondensino I išmušimo (KO) ląstelių GR fazėje, qRT – PGR.

Nepaisant skirtingo genomo dydžio ir organizavimo tarp bakterijų, mielių ir stuburinių, kondensino I surišimo modeliai yra panašūs. Iš viso kondensinas yra labai praturtintas tRNR ir rRNR genuose ir centromeruose. Vištienos kondensinas I taip pat yra praturtintas RNR polimerazės II sąlygotų genų promotoriais ir nekoduojančiais RNR genais, tokiais kaip tRNR ir rRNR genai. I kondensinas jungiasi prie daugelio negeninių DNR, įskaitant centromerų ir telomerų sekas. Šie rezultatai rodo, kad I kondensinas daugiausia asocijuojasi su lokiais, kurie turi tam tikrą transkripcijos aktyvumą. Laikydamiesi numanomo kondensino I žymėjimo vaidmens, mes nustatėme, kad jo pašalinimas turi įtakos daugelio genų transkripcijai sekančioje G1 fazėje.

Rezultatai

Kondenzino I pasiskirstymas genomo mastu

Norėdami nustatyti, kur mitozės metu kondensinas I yra palei stuburinių viščiukų (DT40) genomą, mes panaudojome genetinius CAP-H (atstovaujantys tik kondensiną I) ir SMC2 (atstovaujantys tiek kondensiną I, tiek II), išgelbėtų streptavidiną surišančiu peptidu (SBP), nokautus. afinitetu pažymėti transgenai (papildomas S1 pav.). Abu transgenai visiškai išgelbėjo savo giminingų išmušimo ląsteles, sukurdami SBP dažymą, būdingą ašinės lokalizacijos I kondensino mitozės metu ir parodantį iš esmės visišką persidengimą su kitu kondensino I komplekso subvienetu CAP-D2 (papildomas S1A pav.). Svarbu vėlesnėms analizėms, SBP pažymėto gelbėjimo baltymo lygis buvo panašus į endogeninį lygį tiek laukinio tipo SMC2, tiek CAP-H (papildomas S1B pav.). Gyvų ląstelių vaizdavimas CAP-H – GFP – SBP (papildomas S1C pav.) Atskleidė viščiukų DT40 ląstelių kondensiną I, kuris turi būti pašalintas iš branduolio tarpfazėje, kauptis chromatinui po NEBD ir išnykti iš chromatino telofazės pabaigoje. . Tai atitinka stuburinių laukinių rūšių kondensino I lokalizaciją kitose ataskaitose 11, 12 . SBP etiketė rodo nepaprastą kondensato komplekso gryninimą tiek nesusietuose, tiek svarbiai sujungtuose mėginiuose (papildomas S2 pav.), Kuris yra raktas į mūsų paskesnių sekos nustatymo programas.

Norint sudaryti viso genomo kondensiną I surišančių vietų žemėlapį, buvo sekos sukondensuotos I subvienetų SMC2 ir CAP-H surištos DNR, taip pat atitinkamos įvestos DNR. Šią analizę mes vadinsime chromatino afiniteto gryninimo sekos nustatymu (ChAP-seq), nes nuleidimai buvo atlikti naudojant SBP pažymėtus baltymus ir streptavidino granules. Todėl tai yra analogiška ChIP-seq, kur antikūnai naudojami chromatino imuniniam nusodinimui.

Kadangi mitozės metu kondensato I yra tik DNR, perdirbti buvo tik mitoziškai blokuoti SMC2 – SBP ir CAP-H – GFP – SBP. Naudodamiesi 24–36 mln. 50 bp vienkartinių skaitinių (papildoma S1 lentelė), mes nustatėme kelis kondensino I praturtėjimo regionus vištos genome. Šioje analizėje buvo pašalintos pasikartojančios sekos, siekiant sumažinti PGR paklaidą. Modelio pagrindu atlikta „ChIP-seq“ (MACS) analizė, pagrįsta smailių iškvietimo programa 26, nustatė 6474 SMC2 ir 4 369 CAP-H specifinius smailius DT40 ląstelėse (1a pav.) Ir identifikavo 2140 regionus, kurie dalijasi tarp jų apima keletą bendrų smailių. Plotis ir intervalai tarp smailių labai skiriasi. Vidutinis SMC2 smailės plotis buvo 1 442 bp (nuo 437 iki 40 356 bp). CAP-H vidurkis buvo 2849 bp (nuo 306 iki 30 276 bp). Vidutinis atstumas tarp smailių buvo 172 kb (nuo 3 bp iki 12 677 kb) SMC2 ir 257 kb (nuo 2 bp iki 8 237 kb) CAP-H, atsižvelgiant į vištos genomo 1, 2 Gb dydį.

Image

a ) SMC2 ir CAP-H praturtėjimo smailių pasiskirstymas pagal genomo ypatybes, įskaitant promotorius, genus ir ekstragenines sekas. Duomenys rodo, kad didžioji dalis SMC2 arba CAP-H praturtinimo regionų yra promotorių regionuose. SMC2 ir CAP-H sodrinimo smailės buvo nepriklausomai vadinamos atsižvelgiant į jų įvestį ir skaičiuojamos pagal šias savybes. Skaičiai skliausteliuose yra neapdorotas kiekvienos funkcijos piko numeris. Genominis pasiskirstymas rodo kiekvieno vištos genomo požymio bazinę aprėptį (galGal4). b ) CAP-H ir SMC2 praturtinimas, įvedamas į dvikrypčių TRIM27 ir TRIM41 genų promotorių regionus. Šio rodinio koordinatė yra chr16: 145, 376-154, 212 vištienos galGal4 genomas. c ) Kondensinas I suriša aktyviai transkribuotus genus. NCBI RefSeq genų transkripcijos lygiai iš laukinio tipo viščiukų DT40 ląstelių buvo gauti iš dviejų nepriklausomų „Affymetrix“ duomenų rinkinių „Genomo Expression Omnibus“ (GSM210532, GSM465893) ir SMC2 (1, 531) arba su CAP-H surinktų genų (1 612) transkripcija. ) ir tie, kurie neturi kondensino smailių (atitinkamai 9137 ir 9, 056). Iš duomenų rinkinių buvo gauti 10 688 „RefSeq“ genų transkripcijos lygiai, iš viso 17 148. y ašis parodo normalizuotas transkripcijos vertes log2. Atkreipkite dėmesį, kad abiejose nepriklausomose „Affymetrix“ duomenų grupėse tarp kondensato surištų ir nesurištų genų (pažymėtų žvaigždute) abi P vertės yra <2, 2 × 10 −6, apskaičiuotos Wilcoxon Rank Sum testu. ( d ) Visų RefSeq genų, esančių vištienos galGal4 genomo rinkinyje, didelis SMC2 ir CAP-H sekų žymių tankis. Atmetus SMC2 ir CAP-H (TSS) viščiukų genome, palyginti su įvestų medžiagų kiekiu, jie yra labai praturtinti. X ašis yra atstumas nuo (TSS) iki 5 kb aukštyn ir pasroviui, o y ašis yra normalizuotas sekos skaitymo tankis. SMC2 arba CAP-H išskleidžiamieji elementai ir įvestis rodomi atitinkamai mėlyna ir žalia spalvomis, o šių dviejų skaitmenų skirtumas yra raudonas.

Visas dydis

Norėdami toliau analizuoti duomenis, mes suskirstėme smailės tiek iš SMC2, tiek iš CAP-H į tuos, kurie užima stimuliatorius, genus (NCBI RefSeq genai ir visi nekoduojantys RNR genai) ir ekstrageninius regionus. Kondensino I ir bendrųjų kondensiną surišančių vietų pasiskirstymas buvo iš esmės panašus (1a pav.). Promotorių regionus mes apibrėžėme kaip 2 kb prieš srovę nuo visų „RefSeqGene“ projekto transkripcijos pradžios vietų (TSS), įskaitant baltymus koduojančius ir nekoduojančius genus, prieinamus iš NCBI RNR atskaitos sekų 27 . Mūsų analizė parodė kondensino I praturtėjimą promotoriuose, turinčiuose 30% SMC2 ir 42% CAP-H smailių šiuose regionuose (1a pav.).

Nepaisant to, kad pritraukėjai sudaro atitinkamai 30% ir 42% SMC2 ir CAP-H, promotoriai sudaro tik 3% vištos genomo (1a pav.). Pažymėtina, kad mažiausia kondensiną surišančių vietų, atitinkančių 31% SMC2 ir 24% CAP-H, dalis buvo transkribuotų genų kūnuose (išskyrus promotorius), kuriuos mes apibrėžėme kaip regionus tarp TSS iki SSD pabaigos. 3 ′ RefSeq genų UTR, sudarantys 43% vištos genomo (1a pav.). Šie rezultatai rodo, kad kondensinas labiau linkęs į asociaciją su „atviro“ chromatino regionais. Nors nekoduojantys RNR genai, įskaitant tRNR ir rRNR genus, sudaro tik 0, 0008 vištienos genomo 28, 29, 1, 4% SMC2 ir 2, 7% CAP-H smailių buvo lokalizuoti nekoduojančiuose RNR genuose. Apie 39% SMC2 smailių buvo ekstrageniški, palyginti su 34% - CAP-H.

Kondensinas I yra praturtintas aktyvių genų promotoriais

Norėdami tiksliau įvertinti bendrą kondensino I praturtėjimą prie promotorių, mes nustatėme 1 247 genus iš viso 17 148 vištos genome, turinčių SMC2 (2, 335) ir CAP-H (2, 360), susijusius su jų promotoriais. Iš jų 1 058 (~ 84%) yra susiję su CpG salomis, palyginti su ~ 52% visų promotorių, susijusių su CpG salomis vištienos genome (papildomas S3 pav.). Dviejų krypčių genų ( TRIM27 ir TRIM41 ) CpG salos promotoriaus praturtinimo kondensinu I pavyzdys pateiktas 1b pav. Kaip UCSC genomo naršyklės momentinė nuotrauka.

Norint nustatyti su kondensinu surištų genų aktyvumą, buvo tiriamos su kondensatu surištų ir nesurištų RefSeq genų transkripcijos, naudojant DT40 ekspresijos duomenų bazę. Affymetrix DT40 raiškos masyvo analizė aiškiai parodė, kad kondensinas jungiasi pirmiausia su genais, kurių transkripcija yra aukšta (1c pav.). Tai sutinka su bakterijų SMC, taip pat kohesino ir kondensino, esančio mielėse, žemėlapių sudarymu, kas rodo stiprų konservuotų baltymų, panašių į kondensiną, evoliucinį požymį 15, 30 . Be to, genų ontologijos analizė rodo, kad svarbiausi su kondensinu susijusių genų funkciniai vaidmenys yra chromosomų ir genomų organizavime, taip pat ląsteliniame ir metaboliniame procesuose (papildoma S2 lentelė).

Mūsų duomenys rodo ne tik akumuliaciją tolimiausiuose genų regionuose, bet ir tai, kad kondensinas kaupiasi RefSeq genų TSS. Išanalizavome visų vištienos „RefSeq“ genų bendrą SMC2 ir CAP-H skaitymo tankį TSS. Bendras SMC2 ir CAP-H rodmenų skaičius smarkiai padidėjo, palyginti su TSS (1d pav.). Jei TSS analizė yra išskiriama tarp aukštai ir žemai išreikštų genų, kaip nustatyta pagal Affymetrix genų ekspresijos analizę, kondensino I koncentracija vėl viršija labai išreikštų genų TSS, bet yra santykinai mažesnė silpniau išreikštų genų atžvilgiu (papildomas S4 pav.). Tai taip pat rodo, kad kondenzino genominis pasiskirstymas yra susijęs su atviru chromatinu ir pateikia įtikinamų įrodymų, kad kondensinas I pirmiausia jungiasi su aktyviai transkribuotų genų promotoriais.

Kondensino I praturtinimas nekoduojančiuose RNR genuose

Kondensino I subvienetai buvo labai praturtinti lokusuose, kuriuose yra tRNR ir rRNR genai. Pavyzdžiui, SMC2 ir CAP-H yra praturtinti daugiau nei dvigubai, palyginti su> 70% (198 ir 197 genai SMC2 ir CAP-H atitinkamai) iš 279 tRNR genų, anotuotų 28 vištos genome, ir didžioji jų dalis. iš jų (173 genai) yra praturtinti ir SMC2, ir CAP-H (2a pav., papildomas S5 pav.). Visų tRNR genų vidutinis praturtėjimas atitinkamai 4, 08 ir 4, 67 karto SMC2 ir CAP-H. Kondensino I smailės, apimančios daugybę tRNR genų, pavyzdys pateiktas 2b pav. Kadangi tRNR genai yra trumpi (71–115 bp) ir dažnai sutampa su CpG salomis, mes toliau atskyrėme tRNR genus, kurie persidengia CpG salose (94 tRNR genai), nuo tų, kurie neturi (185 tRNR genai). Mes nustatėme, kad SMC2 ir CAP-H yra vidutiniškai 5, 6 ir 7, 2 karto praturtinti tRNR genais, kurie sutampa su CpG salomis, tačiau tik maždaug dvigubai, kai tRNR genai nepersidengia su CpG salomis (2c pav.). Tai rodo, kad CpG salos ir tRNR genai turi adityvų poveikį kondensino I surišimui ir kad CpG salos nėra būtina sąlyga, norint prisotinti kondensiną I tRNR genuose.

Image

a ) Venno diagrama, rodanti didelį tRNR genų, turinčių daugiau nei dvigubą SMC2 arba CAP-H praturtėjimą, persidengimą per įvestį (198 ir 197 genai SMC2 ir CAP-H, atitinkamai, iš viso 279 tRNR genų). Dauguma tų SMC2 ir CAP-H praturtintų genų sutampa (173 genai). Praturtėjimas matuojamas pagal bendrą SMC2 arba CAP-H sekų nuskaitymo skaičių per visas žinomas tRNR. ( b ) UCSC genomo naršyklės momentiniame vaizde parodytas CAP-H ir SMC2 išplėstinis įėjimo per tRNR klasterį praturtinimas. Koordinatė yra chr16: 161, 127-179, 974 iš „galGal4“. c ) SMC2 ir CAP-H praturtinimo dėžučių brėžiniai, skirti įvesti tRNR genus su CpG salų sutapimais arba be jų (atitinkamai 94 ir 185 genai). Tiek SMC2, tiek CAP-H praturtinimas tRNR genuose su CpG salomis yra ryškesnis (atitinkamai vidutiniškai 5, 6 ir 7, 2 karto, jei yra SMC2 ir CAP-H), palyginti su tRNR genais, neturinčiais CpG salos (vidutiniškai maždaug du kartus, abiem) SMC2 ir CAP-H). Skirtumas tarp šių dviejų grupių yra reikšmingas, kai P vertės yra 1, 2 × 10 –8 SMC2 ir 4, 0 × 10 –14 CAP-H (žymimos žvaigždute), apskaičiuotų Wilcoxon Rank Sum testu. d ) SMC2 ir CAP-H praturtinimo juostų brėžinys, kad būtų įvestos suderintos rRNR genų sekos, turinčios 28S, 18S, 5.8S tarpgeninį tarpiklį, 5S tarpgeninį tarpiklį ir 5S. Reikšmingas SMC2 ir CAP-H praturtėjimas, palyginti su įvestimi, yra stebimas 28S ir 18S rRNR genų sekose, kurių pakoreguotos P vertės atitinkamai yra 7, 34 × 10 −4 ir 5, 99 10 10 −3 (žymimos žvaigždute; n = 5 kaip abiem) SMC2 ir CAP-H). Klaidų juostos žymi standartines klaidas. P vertės buvo apskaičiuotos, naudojant kraštinių R tikslų testą su Benjamini – Hochberg FDR koregavimu 31 .

Visas dydis

SMC2 ir CAP-H taip pat buvo praturtinti rRNR genais. Šis praturtėjimas buvo reikšmingiausias 28S ir 18S rRNR genuose, esant keturis kartus su pakoreguotomis P reikšmėmis - atitinkamai 7, 34 × 10 −4 ir 5, 99 × 10 −3 (apskaičiuotos naudojant kraštinio R tikslinį testą 31 ), tuo tarpu, kai 5S genai (2d pav., Papildomos S6 ir S7 figūros). Svarbu pažymėti, kad tRNR ir rRNR genai taip pat buvo prisodrinto kondensino jungimosi mielėse 17, 18 ir 15 bakterijose vietos. Taigi paaiškėja, kad nepaisant genomo sudėtingumo ir organizavimo skirtumų, bakterijos, mielės ir stuburiniai gyvūnai kondensino jungimosi principus išsaugo.

Centromerinis I kondensino sodrinimas

Daugelį viščiukų centromerų sudaro tandemiškai pakartojamos palydovinės DNR; tačiau 5, 27 ir Z chromosomų centromerai sudaryti iš unikalios sekos DNR, kuri buvo visiškai seka 32 . Tai leidžia nustatyti ChAP-seq žemėlapių specifiškumą, kurio neįmanoma naudojant kitus labai pasikartojančius stuburinių centromerus. Bendras kondensinas ir I kondensinas buvo tankūs 5, 27 ir Z chromosomų centromerų regionuose, atsižvelgiant į jų sutapimą su tomis sritimis, kurios anksčiau buvo nurodytos, kad surištų centromerinį H3 variantą CENP-A - visų aktyvių centromerų parašo ženklą (3a pav. –C, papildomas S8A pav.) 32 . Kondensino padėtis centromeruose atitinka anksčiau parodytą kondensino vaidmenį reguliuojant centromero standumą 12, 33, 34 .

Image

( a - c ) SMC2 ir CAP-H praturtinimas įvestimi CENP-A susijusiose sekose (centromerai; pažymėti violetiniu pavidalu) a ) 5 chromosomoje, b ) 27 chromosomoje ir c ) vištienos Z chromosomoje DT40 UCSC genomo naršyklės rodinyje. Žinomų centromerų koordinatės yra chr5: 3, 075, 314-3, 104, 608 ir chr27: 4, 623-31, 524 ir chrZ: 42, 605, 339-42, 634, 855 galGal4 (nuoroda 32). Centromerų sekos nurodomos kiekvieno genomo naršyklės rodinio viršuje. d ) SMC2 ir CAP-H praturtinimo analizė, kad būtų įvestos kiekvienos konsensuso centromero pakartotinės sekos, gautos iš viščiukų 1, 2, 3, 4, 7, 8 ir 11 chromosomos (nuoroda 32). Klaidų juostos nurodo standartines klaidas. 1, 2, 3 ir 11 chromosomoms P reikšmės buvo 4, 70 × 10 −3, 4, 88 × 10 −2, 1, 50 × 10 −2 ir 5, 99 10 10 −3 (pažymėtos žvaigždute; n = 5, kaip ir SMC2, ir CAP). -H). P vertės buvo apskaičiuotos, naudojant kraštinių R tikslų testą su Benjamini – Hochberg FDR koregavimu 31 .

Visas dydis

Taip pat buvo tiriamos kitos su CENP-A susijusios sekos iš chromosomų su pakartotinai gausiais centromerais, kad būtų praturtintas kondensinu. Į šią analizę buvo įtrauktos kartotinių centromerų sekos iš 1, 2, 3, 4, 7, 8 ir 11 chromosomų, pagal kurias neįmanoma tiksliai nustatyti CENP-A pasiskirstymo 32 . Ši analizė atskleidė tam tikrą visų centromerų praturtėjimą SMC2 ir CAP-H ir reikšmingą padidėjimą iki trijų kartų, palyginti su 1, 2, 3 ir 11 chromosomomis (3d pav.). Šie rezultatai rodo, kad kondensinas gali būti praturtintas visais DT40 ląstelių centromerais; tačiau svarbu atkreipti dėmesį, kad šie pasikartojimai pasitaiko ir kitur vištos genome.

Kondensino sodrinimas vištienos centromere taip pat atsispindi naudojant citologinius metodus. Imunofluorescencinė analizė rodo, kad tiek SMC2, tiek CAP-H yra praturtinti pirminiuose viščiukų DT40 ląstelių chromosomų susiaurėjimuose (papildomas S8B pav.).

Kondensino I sodrinimas telomeruose

Mes išplėtėme savo žemėlapių sudarymą, kad į vištos genomą būtų įtrauktos visos pagrindinės pasikartojančios DNR šeimos. Siekdami sumažinti artefaktų, atsirandančių dėl atvaizdavimo paklaidų, analizę kondensino sodrinimą, analizavome dviem skirtingais būdais: Repbase pagrįsta analize, naudodamiesi konsensuso pasikartojančiomis sekomis, gautomis iš Genetinės informacijos tyrimų instituto (GIRI), kaip pamatinį genomą, ir genomo masto analize, naudodamiesi „RepeatMasker“ anotacijomis. UCSC lentelės naršyklė 29 . Į šias analizes mes įtraukėme pasikartojančias sekas, atsižvelgiant į pasikartojančių sekų pobūdį. Apskritai ši analizė patvirtino, kad kondensinas yra labiau susijęs su regionais, kuriuose yra didelis GC kiekis (papildomos S9 ir S10 pav.).

Atlikus „Repbase“ analizę, pastebimas ryškus sodrumas kondensino I telomerų pakartojime (TTAGGG) n (papildomas S9 pav.). Šis kondenzino I praturtėjimas telomerų pakartotinėmis sekomis taip pat buvo aptiktas mūsų viso genomo pakartotinėje analizėje (papildomas S10 pav.). Taip pat buvo pastebėtas telomerinių sekų sodrinimas kondensinu I, kai buvo analizuojami visi išskleidžiamų ir įvestų sekų heksamero deriniai, siekiant nustatyti SMC2 ir CAP-H (papildomas S11 pav.).

Vidutinis kondensino I subvienetų sodrinimas buvo akivaizdus ir subtelomeriniuose pakartojimuose (papildomas S12 pav.). Šiuo atžvilgiu kondensino pasiskirstymas primena kito SMC baltymų komplekso - kohesino, kuris neseniai buvo įrodytas praturtėjęs subtelomeriniuose regionuose, pasiskirstymą 35 .

Svarbu tai, kad vištienos pakartojimas 1 (CR1), kuris sudaro didžiausią retrotransposonų dalį ir kuris taip pat sudaro didžiausią pakartojimų dalį vištos genome, neparodo reikšmingo kondensino I praturtėjimo. Iš tiesų, ilgesni CR1 elementai mažiau jungiasi su kondensinu nei trumpi fragmentai (papildomas S13 pav.).

Kondensiną I rišančių vietų patvirtinimas

Tiek molekulinis, tiek citologinis požiūris patvirtino mūsų kondensino I surišimo vietų žemėlapius (4, 5 pav.). Kiekybinė PGR (qPCR) analizė, susijusi su CAP-H susijusios DNR (mėlyna, n = 8), naudojant pasirinktų tRNR genų pradmenis CpG salose, parodė ryškų sodrumą iki šešiskart, palyginti su kontroliniais regionais, neturinčiais su kondensinu susijusių sekos žymių (1 pav. 4a). CAP-H taip pat buvo keturis kartus praturtintas tRNR genais be CpG salų ir CpG salose, kuriuose nėra tRNR genų (4b pav., C). Keletas histonų genų, kurie mūsų skaičiavimo analizėje parodė preferencinį ryšį tiek su SMC2, tiek su CAP-H, taip pat parodė, kad qPCR analizė parodė vidutinį ir aukštą prisotinimų sumažėjimą (4d pav.). Norėdami pašalinti galimybę, kad DNR nespecifiškai prisijungia prie žymės (SBP) ar rutuliukų, mes sukūrėme DT40 ląstelių liniją, išreiškiančią tik GFP – SBP, ir parodėme, kad po SBP ištraukimo keliose kondensatais praturtintose vietose nepastebėta jokio praturtėjimo (4 pav. žalia, n = 3, papildomas S14 pav.).

Image

( a – e ) Pasirinktiems kondensino I sodrinimo regionams patvirtinti buvo naudojamas kiekybinis PGR, įskaitant ( a ) tRNR genus, persidengiančius su CpG salomis, ( b ) tRNR genus, kuriuose CpG salos nesutampa, c ) CpG salas, be tRNR geno sutapimo, ( d) ) histono genai ir ( e ) rRNR sekos CAP-H išskleidžiamoje DNR ( n = 8 kiekviename regione; mėlyna). Y ašis išreiškia pasirinktų sričių sodrinimo pokyčius nuo įėjimo į nuleidimą, palyginti su valdikliu. Buvo atlikti aštuoni nepriklausomi afinitetų gryninimai naudojant CAP-H – GFP – SBP ir vidutinis kiekis buvo normalizuotas, palyginti su kontrole. Visuose šiuose atrinktuose regionuose tRNR, 28S ir 18S rRNR genuose, CpG salose ir histono genuose CAP-H buvo labai praturtintas. Priešingai, praturtėjimas nebuvo pastebėtas tuose pasirinktose neigiamos kontrolės srityse, atimamose iš DT40 ląstelių, ekspresuojančių tik GFP-SBP žymę ( n = 3 kiekvienam regionui; žalia), palaikant kondensino I surišimą šiuose regionuose. Kontrolinė seka neparodė jokio kondensino sodrinimo pagal mūsų sekos profilius (chr11: 13, 498, 471-13, 498, 576 iš galGal4), todėl nesitikima, kad qPCR praturtėtų. Klaidų juostos nurodo standartinę klaidą.

Visas dydis

Image

a ) Telomeras-FISH zondai (žali) ir turintys imuninę apsaugą nuo SMC2 arba CAP-H SBP pažymėtų baltymų (raudonos) tiek neištemptoje, tiek ištemptoje mitozinėje chromosomoje viščiukų DT40 ląstelėse. DNR dažoma kartu su DAPI. FISH zondo (telomeras) ir SBP signalų (SMC2 arba CAP-H) sutapimas nurodomas balta rodykle abiejose netempiamose (viršutinės dvi plokštės) ir ištemptos chromosomose (dvi apačios). Jų signalas taip pat aptinkamas centromerinėse srityse (pirminiai didelių chromosomų susiaurėjimai) CAP-H – GFP – SBP ląstelėse (geltona rodyklė). ( b ) Chromosomos telomerų sekų, pateiktų 1-ojoje chromosomoje kartu su I kondensinu (CAP-H – GFP – SBP), kuris buvo naudojamas kiekybiškai įvertinti c punkte, pavyzdys. Atkreipkite dėmesį, kad 1 chromosoma turi ryškų intersticinį telomerų praturtėjimą 36 . Buvo atrinktos chromosomos, kurių CAP-H – SBP (raudonos spalvos) buvo šiek tiek ištemptos, todėl signalas buvo pertraukiamas, taip sumažinant atsitiktinio sutapimo galimybę. Vertinant balus, buvo ištirtos visos septynios makrologinės paukščių chromosomos iš intersticinės ir kanoninės telomerų-CAP-H persidengiančių sričių, abiejuose regionuose pastebimas labai didelis CAP-H ir telomerų signalo sutapimas. Mastelio juosta yra 4 μm. c ) Telomerų ir CAP-H sutapimas mitozinėse DT40 ląstelėse. Maždaug 67% telomero-FISH sutampa su SBP (CAP-H). Tai skiriasi nuo 31% SBP užimtumo DNR (atspindinčią SBP sutapimo su atsitiktine DNR galimybę). Telomeras, CAP-H ir DNR signalai buvo apskaičiuoti iš chromosomų iš 43 atskirų ląstelių ( n = 43). P reikšmė 1, 29 × 10 −7 matoma naudojant Pearsono χ 2 testą, lyginant CAP-H ir telomerų sutapimą su CAP-H užimtumu DNR (žymima žvaigždute).

Visas dydis

Norėdami patvirtinti kondensino I ryšį su pasikartojančiais rRNR genais, mes sukūrėme pradmenis, naudodami rDNR konsensuso sekas, ir palyginome amplikono sodrinimo pokyčius nuo įėjimo į nuleidžiamą DNR su kontroliniais. Ši analizė atskleidė labai reikšmingą 28S, 18S ir 5.8S rDNR sekų praturtėjimą chAP-seq nuleidimo metu. Taigi kondensinas I yra praturtintas šiais RNR polimerazės I transkribuotais genais (4e pav., Mėlynas). Priešingai, kondensinas I nebuvo praturtintas 5S rRNR genais, kuriuos perrašo RNR polimerazė III. Vėlgi, qPCR ištirti santykiniai lokų sodrinimai buvo teigiamai koreliuojami su sodrinimo lygiu, matytu atliekant ChAP-seq analizę (2d pav.). Panašiai kaip ir aukščiau, qPCR ant išskleidžiamo GFP – SBP taip pat neparodo jokio rRNR geno praturtėjimo (4e pav., Žalia).

Taip pat patvirtinome kondensino I sodrinimą telomerais ir rRNR lokusais, naudodamiesi citologiniu imuno-FISH metodu. FISH (fluorescencinės in situ hibridizacijos) zondai buvo sukurti taip, kad apimtų kondensino I praturtintus regionus, įskaitant telomerus ir 18S rRNR genus. Šiai analizei ląstelių citospunai ant plokštelių buvo nudažyti dėl kondensino I, naudojant anti-SBP antikūną, kuris atpažįsta SBP, prijungtą prie CAP-H arba SMC2, ir vėliau tiriamas telomere arba rDNR-FISH zondais (5a pav., Papildomas S15 pav.) .

Mūsų ChAP-seq analizėje pastebėtas kondenzino I sodrumas telomeruose buvo patvirtintas imuno-FISH eksperimentais (5a pav.). Neištemptose chromosomose, kur buvo išsaugotas ašinis kondensino I dažymas, telomero-FISH signalai dažnai sutapdavo su ašinėmis sritimis tiek chromosomos galuose, tiek intersticinėse telomerinėse sekose (5a pav.). Jau seniai žinoma, kad telomerinės sekos egzistuoja ne tik chromosomų galuose, bet ir intersticiškai. Paukščių chromosomos pasižymi išplėstomis intersticinės telomerų sekos pėdomis keliose chromosomose 36 . Mūsų pačių duomenys rodo, kad CAP-H ir telomerų sekos taip pat pasirodė sutampančios šalia centromerų ir kitų intersticinių vietų (5a pav.). Šis sutapimas taip pat buvo pastebėtas tiek SMC2, tiek CAP-H, kai chromatinas buvo ištemptas ruošiant mėginį (5a pav.). Tada mes nustatėme, kad telomeras – kondensinas I sutampa ir nustatėme aukštą koreliaciją tarp CAP-H ir telomero signalo (67%, P reikšmė = 1, 29 × 10 –7 iš Pearsono χ 2 testo), palyginti su 33% bendro užimtumo fone. CAP-H mitozinėje chromosomų DNR (5b, c pav.).

Imuninės-FISH analizė rDNR lokusuose, naudojant klonuotą vištos 18S rRNR zondą, taip pat parodė nuoseklų FISH signalų ir kondensino I signalų persidengimą chromatinu iš SMC2 – SBP ir CAP-H – GFP – SBP išreiškiančių ląstelių linijų (papildomas S15 pav.).

Kiekybinio PGR ir imuno-FISH derinys suteikė nepriklausomą mūsų kondensino I ChAP-seq žemėlapio patikrinimą DT40 ląstelėse.

Akivaizdus kondensato I žymėjimo poveikis

Plačiai pripažįstama, kad mitozės 37 metu transkripcija nutrūksta, tačiau reiškinys, vadinamas žymėjimu, gali sukurti pozicinę atmintį, kad transkripcijos veiksniai galėtų greitai atsistatyti prie promotoriaus sekų G1 (nuoroda 25). Kaip alternatyva, buvo pasiūlyta, kad mitozės metu transkripcijos faktorius HSF2, jungiantis prie CAP-G, pasisavina baltymo fosfatazės 2A, kad defosforiluotų ir dezaktyvuotų kondensino I kompleksus, taip skatindamas transkripcijos faktoriaus surišimą 24 . Taigi kondensino buvimas prie promotorių gali sukelti arba slopinti transkripciją mitozinio išėjimo metu.

Mūsų „ChAP-seq“ duomenys rodo, kad kondensinas I suriša daugybę promotoriaus sekų. Mes iškėlėme hipotezę, kad jei žymėjimo modelis buvo teisingas, kondensino pašalinimas gali neteisingai sureguliuoti susijusių genų ekspresiją G1 metu. Norėdami patikrinti šią hipotezę, mes atlikome qRT – PGR ant G1 ląstelių, naudodami anksčiau sukurtą CAP-H / kondensino I KO ląstelių liniją 38 (6a, b pav.). Pridėjus efektoriaus molekulę doksicikliną (dox), šios ląstelės greitai nutraukia CAP-H transkripciją.

Image

a ) CAP-H imunoblotacija CAP-H nokauto ir laukinio tipo viščiukų DT40 ląstelėse su doksiciklinu (dox) ir be jo. RNR, ekstrahuoti iš CAP-H ON ir CAP-H OFF tarpfazių sinchronizuotų ląstelių, naudojant 14 h timidino bloką, buvo tiriami qRT – PGR. Bendras CAP-H OFF (įskaitant 14 h timidino bloką) dokse laikas buvo 36 valandos. Imunoblotologinė analizė rodo, kad CAP-H išstūmimo ląstelėse yra visiškai uždarytas, tuo tarpu CAP-H raiška laukiniame tipe neturėjo įtakos. Tai yra CAP-H išeikvojimo metodas, naudojamas atliekant qRT – PGR analizę. ( b ) Eksperimentinis analizės planas, parodantis, kad CAP-H KO buvo apdorotas doksu iki 36 h, įskaitant 14 h timidino bloką. Srauto citometrijos profiliai rodo, kad dauguma CAP-H KO ląstelių yra G1 fazėje po timidino bloko. Ląstelės buvo nudažytos propidium jodidu ir analizuotos FACS. CAP-H OFF ląstelių derliaus nuėmimo metu praktiškai nepastebėta jokio segregacijos defekto (po 36 val. Dokso gydymo) 38 . c ) CAP-H KO ląstelių qRT – PGR analizė. Iš viso genomo masto ChAP-seq duomenų analizei iš viso buvo pasirinkta 17 genų, įskaitant vieną tRNR geną ir šešis histono genus. CAP-H transkripcija taip pat parodyta šioje diagramoje. Pašalinus CAP-H, šie genai yra sureguliuoti. Klaidų juostos nurodo standartinę klaidą ( n = 3).

Visas dydis

CAP-H ON / OFF ląstelių genų ekspresija G1 buvo analizuojama naudojant qRT – PGR, naudojant pradmenis, būdingus genams, kurie, mūsų ChAP-seq analizės metu, praturtėjo kondenzinu I. Analizė buvo atlikta praėjus 36 val. Po dokso papildymo. Šiuo metu CAP-H baltymai efektyviai išeikvojami, tačiau ląstelės dar neparodo akivaizdaus augimo ar ląstelių defektų 38 (6a, b pav.). FACS analizė patvirtino, kad didžioji dalis ląstelių buvo G1.

Iš viso mes analizavome 17 pasirinktų genų, įskaitant tRNR geną, ekspresiją, kuris sutapo su kondensino I smailėmis ties jų promotoriais, ekspresiją. Stebėtina, kad visi 17 rodikliai sumažino transkripcijos lygį G1 metu po kondensino I pašalinimo, atsižvelgiant į kondensino vaidmenį žymint genus, skirtus ekspresijai ankstyvajame G1 (6c pav.).

Diskusija

Čia aprašome pirmąjį viso genomo kondensino I žemėlapį ant stuburinių mitozinių chromosomų, naudojant sąlygines išstūmimo ląstelių linijas, kuriose SBP pažymėtos SMC2 arba CAP-H yra vieninteliai biriųjų kondensinų ir I kondensino šaltiniai. Streptavidino nuleidimai, po to sekantys naujos kartos afinitetu išgrynintos DNR sekos, davė kondenzino I pasiskirstymo žemėlapį mitotiškai blokuotose DT40 chromosomose.

Kondensino pasiskirstymo chromosomose modelis rodo puikų evoliucijos išsaugojimo laipsnį. Daugiausia kondensino buvo rasta labai transkribuotų genų promotorių regionuose, tačiau kondensino I praturtėjimas taip pat buvo aiškus tRNR ir rRNR genuose ir pagrindinėse genomo struktūrose, būtinose tinkamai chromosomų atskyrimui, įskaitant centromerus ir telomerus. Šis stuburinių kondensino žemėlapis turi daug bruožų su žemėlapiais, anksčiau išleistais dėl B. subtilis SMC baltymo 15 pasiskirstymo ir kondensino pasiskirstymo mielių genomuose 17, 18 . Tai ypač nuostabu, kai atsižvelgiama į tai, kad bakterijos nepakeičia savo DNR su histonais ir kad mielių chromosomos mitozės metu nepastebi matomos morfologinės kondensacijos. Be to, stuburiniuose gyvūnuose kondensino I kompleksas fazės metu iš tikrųjų yra citoplazminis.

Nors mūsų analizė nenustatė jokio kondensino ryšio su vieno tipo DNR seka, mes stebėjome neabejotinus kondensino pasiskirstymo per genomą modelius. Mielėse kondensinas yra praturtintas tRNR ir rRNR genais 17, 18, o tRNR genų B-BOX motyvas buvo įtrauktas į kondensino įdarbinimą 17 . Šį kondensino ryšį su tRNR genais mielėse taip pat gali skatinti fizinės sąveikos tarp kondensino subvienetų SMC2 ir SMC4 bei RNR polimerazės III ir jo transkripcijos faktoriaus TFIIIC 39 .

Vištienos kondensinas pasižymi prioritetine asociacija su CpG salų rengėjais. Jis taip pat yra praturtintas labai išreikštų genų TSS, tuo tarpu kompleksas yra gana išeikvotas iš genų kūnų. Šie rezultatai kartu parodo, kad kondensato padėtis mitozinėse chromosomose stipriai koreliuoja su genų aktyvumo modeliais. Kadangi transkripcija nutrūksta mitozinės chromosomos tankinimo metu ir kadangi kondensinas I yra citoplazminė interfazės metu, todėl mažai tikėtina, kad pats transkripcijos procesas paveiks šį kondensino pasiskirstymą mitozinėse chromosomose. Vietoj to, vienas galimas paaiškinimas yra tas, kad chromatino žymės gali paveikti kondensino ryšį su chromatino regionais. Iš tikrųjų ankstesnis tyrimas susiejo histono modifikaciją, H4 lizino 20 metilinimą, su kondensino II ryšiu su chromosomomis 40- osios fazės metu. Mitozinėse ląstelėse „Aurora B“ kondensato I fosforilinimas skatina jo ryšį su H2A ir H2A.Z 41, patvirtindamas chromatino dalyvavimą kondensino prisijungime prie chromosomų. Žinoma, bakterijų chromosomose trūksta histonų, tačiau, tikėtina, jų transkripcija vyksta ląstelių dalijimosi proceso metu, todėl norint išlaikyti kondensino ryšį su labai transkribuotais genais, gali prireikti chromatino žymių 15 .

Buvo pasiūlyta kondensuoti „žymių“ genus, kad juos būtų galima veiksmingai perrašyti mitozinio išėjimo metu arba iškart po jo. Mūsų duomenys patvirtina šį kondensino I vaidmenį ir rodo, kad jungtis stipriai koreliuoja su aktyviai perrašytais genais.

Būsimuose eksperimentuose bus svarbu nustatyti, ar daugybė promotoriaus regionų, pirmiausia siejamų su kondensinu I, yra susiję su lokusais, kurie turi tendenciją į ankstesnę ekspresiją mitozinio išėjimo į G1 metu, ir ar iš tikrųjų, ar jų ekspresiją mitozinio išėjimo metu keičia kondensinas I išeikvojimas. SMC baltymų, reguliuojančių transkripciją, samprata įgauna pagreitį atlikus keletą tyrimų, siejančių kohesiną su genų ekspresijos reguliavimu, visų pirma per didelio stipriklio sąveiką 42 . Todėl tikėtina, kad kondensinas taip pat gali veikti trans, norėdamas reguliuoti genų ekspresiją ir galbūt reguliuoti promotorius, kurie nėra tiesiogiai praturtinti kondensinu. Žinoma, išlieka galimybė, kad kondensinas „skaito“ su transkripcija susijusius chromatino žymenis, kai užmezga stabilų ryšį su mitozinėmis chromosomomis, tačiau aktyviai nedalyvauja transkripcijos reguliavime. Paprasčiausiu lygmeniu stebimas aktyvių promotorių jungimasis rodo, kad kondensinas I susijęs su atviruoju (prieinamuoju) chromatinu.

Neatsitiktinis kondensino I ryšys su genomu taip pat išryškėja tiriant komplekso ryšį su pakartotiniais DNR elementais. Panašu, kad kondensinas I yra gana išeikvotas iš daugelio pasikartojančių šeimų, tačiau jis yra žymiai praturtintas tiek centromeriniais, tiek telomeriniais pakartojimais. Kondenzino I surišimas mielių centromeruose yra gerai aprašytas 10, 17, o kondensinas taip pat yra praturtintas į centromerą panašiame par S lokuse, taip pat tRNR ir rRNR genuose B. subtilis 15 . Taigi šios kondensino pasiskirstymo ypatybės yra nepaprastai išsaugotos evoliucijos metu.

Stuburiniuose gyvūnuose kondensinas yra svarbus nustatant centromerinio „spyruoklės“, jungiančio seserų kinetochorijas ankstyvosios mitozės metu, atitikimą (tamprumą). Ankstesni mūsų tyrimai parodė, kad CENP-A chromatinas yra sandariau supakuotas ir atsparus tempimui, nei birus chromatinas 43, 44 . Vidinis centromerinis chromatinas tampa neįprastai lankstus, nesant kondensino, todėl kinetochoros, veikiamos verpstės, dažnai išsikiša iš chromosomų kūnų centromerais, parodydamos reikšmingą tarpkinetochorinių atstumų padidėjimą 33, 34 . Šis nenormalus atsakas į vidinio centromerinio chromatino įtempimą atrodo koreliuojamas su suklio mazgo patikrinimo punkto įvykdymo atidėjimu.

Apie telomerinį kondensino I praturtėjimą molekuliniu lygmeniu nepastebėta nė vienai kitai rūšiai, nors kondensinas daro įtaką telomerų atskyrimui S. pombe , kai Cut14 / SMC2 ir Cut3 / SMC4 mutantai rodo telomerų susipynimą 45 . Pažymėtina, kad pranešta, kad CAP-H citologiškai persidengia su telomeru pelių patinų mejozės ir mitozės metu, remiantis kolokalizacijos būdu su telomere esančiu baltymu TRFI 46 . Šis citologinis stebėjimas gali būti susijęs su dideliais telomerų pėdsakų pasikartojimais pelėje 47 . Mūsų FISH duomenys taip pat atskleidžia telomerų ir kondensino I kolokalizaciją chromosomos galuose ir intersticinėse telomerų sekose. Ateities tyrimų metu lieka klausimas, ar yra speciali kondensato funkcija stuburo telomeruose.

Daugybė įrodymų patvirtino, kad kondensino kompleksas (-ai) turi esminį vaidmenį mitozinės chromosomos struktūroje. Pažymėtina, kad praėjus 20 metų nuo kondensino atradimo, tikslus jo veikimo mechanizmas išlieka paslaptingas. Viena akivaizdi galimybė yra tai, kad kondensinas dalyvauja nustatant kilpinės srities struktūrą mitozinėse chromosomose 14 . Iš tiesų, klasikiniai elektroninės mikroskopijos tyrimai parodė, kad mitozinės chromosomos yra suskirstytos į ~ 30–100 kb kilpų domenus 48, 49 . Mūsų genomo kondensino žemėlapių rezultatai iš esmės atitinka jų pastebėjimus.

Mes stebėjome vidutinį atstumą tarp smailių: 172 kb SMC2 (bendras kondensinas) ir 257 kb CAP-H (kondensinas I), atsižvelgiant į 1, 2 Gb dydį haploidiniame viščiuko genome. Atstumas tarp SMC2 smailių yra didesnis nei 90 kb, apskaičiuotas pagal proteomikos eksperimentus 50 ; however, the latter estimate assumed that condensin molecules were evenly spaced along the genome, whereas our measurements likely reflect the presence of clusters of condensin at highly enriched loci.

Our data, which were confirmed using qPCR and immuno-FISH, most likely reflect the most abundant or stable condensin I sites in the chicken genome, as condensin I is relatively mobile on chromosomes 12 . Highly mobile or less-enriched sites might be beyond the detection limits of ChAP-seq analysis. Furthermore, as our analysis is on mitotically blocked cells that enrich for more condensed chromosomes. Our ChAP-seq data therefore might be under-represented in non-blocked metaphase chromosomes where condensin I could possibly occupy additional positions given the dynamic nature of the complex. However, overall our data are consistent with earlier models that condensin complexes might help to define structural domains that are essential for stable mitotic chromosome architecture.

A prominent feature of our analysis is that the highest accumulation of condensin I was found at structural regions of the chromosome, including centromeres and telomeres. Significantly, both of these features display a cytological constriction, most visibly with centromeres but also seen in telomeres using FISH analysis 51, 52 . Furthermore, secondary chromosome constrictions are observed at rRNA genes, which also exhibit a higher enrichment of condensin. In light of these observations we suggest that structural domains on the chromosome may be differentially constrained by condensin I-mediated looping (Fig. 7). The higher concentration of condensin I at telomeres and centromeres may lead to the shortening of chromatin loops and thereby provide these regions with greater rigidity.

Image

The condensin complex (yellow circles) gathers the chromatin into lateral loops (blue), which are centred along a chromatid axis. Chromatin loop size determines the overall width of mitotic chromatids. Large loops are regularly spaced within and between genes to compact most of the genome into sausage-shaped chromatids. At specialized loci such as the centromeres, telomeres and rDNAs, chromatin loops are smaller, producing constricted regions.

Visas dydis

Our most surprising result is that the distribution of condensin I in the chicken genome is so reminiscent of the distribution of condensin in B. subtilis 15 and in the budding yeast 17, 18 . This suggests that condensin must have roles that are independent of the packaging of the DNA into chromatin and chromosome condensation during mitosis. One possibility is that condensin's ability to supercoil DNA 53 may be important for gene regulation–for example in gene bookmarking. The analysis reported here has created an important resource that not only may explain some of condensin's known functions but also encourages new avenues of research as we search for a common role for condensin across the three kingdoms of life where its distribution has been mapped.

Metodai

Cell culture and synchronization

Chicken lymphoma B DT40 cell culture was performed as previously described 9, 54 . SBP-tagged SMC2 or CAP-H rescue cell lines were cultured in 200 ng ml −1 doxycycline (dox). Repression of the tetracycline-repressible CAP-H gene was induced by addition of 100 ng ml −1 dox for 36 h for qRT–PCR 38 . For synchronizing chicken DT40 cells in mitosis, cells were blocked in 500 ng ml −1 nocodazole for 13–14 h as described previously 50, resulting in a mitotic index of at least 80%. The mitotic index was calculated by both counting cells with the NEBD and flow cytometic analysis with anti-MPM2 mitotic marker staining (Millipore). For synchronizing the DT40 cells in G1 phase, the cells were blocked in 4 mM thymidine for 13–14 h.

Chromatin Affinity Purification-sequencing (ChAP-seq)

ChAP-seq was performed using chromatin affinity purification method as previously described 55 . In brief, 3 × 10 8 DT40 cells with SBP-tagged SMC2 and CAP-H transgene rescuing the knockout background 38, 54 were fixed in 1% formaldehyde (Merck) for 5 min and the crosslinking was stopped in 125 mM glycine. The crosslinked cells were lysed in 1 ml lysis buffer (0.5% ( w / v ) SDS, 100 mM EDTA, 50 mM Tris/HCl (pH 7.4), 30 mg ml −1 RNase A and freshly added protease inhibitors (Roche)). The chromatin in the crude lysate was sheared to 100–500 bp by sonication (Covaris) and the supernatant was subjected to affinity purification using streptavidin-resin beads (Pierce) resuspended in 10 ml binding buffer (50 mM Tris/HCl (pH 7.4), 250 mM NaCl, 0.5% ( v / v ) NP-40, 0.1% ( w / v ) deoxycholate and freshly added protease inhibitors (Roche)) for 2 h at 4 °C. Streptavidin-bound protein-DNA was natively eluted in 0.5 ml elution buffer (50 mM Tris/HCl (pH 7.4), 250 mM NaCl, 0.5% ( v / v ) NP-40, 0.1% ( w / v ) deoxycholate, 4 mM biotin) at 4 °C for 1 h following several washing steps. The eluates were reversely crosslinked at 65 °C overnight with protein digestion in 1 mg ml −1 proteinase K (Roche), followed by DNA extraction using phenol/chloroform and ethanol precipitation. The precipitated DNA was resuspended in TE buffer (10 mM Tris-Cl (pH 7.5), 1 mM EDTA) and subjected to the Illumina sequencing with 12 million 50-bp single-end reads per sample, which allows 50% of the haploid chicken genome coverage. Such coverage is thought to be sufficient according to previous studies 40, 56 . Glycogen (4% ( v / v ); Roche) was used as a carrier during the DNA precipitation.

ChAP-seq data analysis

The sequence reads from the Illumina Hiseq 2000 sequencing were aligned to the latest chicken genome (galGal4) obtained from UCSC table browser following the quality control by FASTQC 57 . Primary alignment analysis was performed using Burrows–Wheeler Aligner (BWA) v0.5.8 (ref. 58) with default mapping parameters for all the data analysis in this study. Additional mapping was performed using Bowtie v0.12.7 (ref. 59) with default mapping parameters to confirm the data reproducibility. The output data were converted to BAM using Samtools for further analysis 60 . The total numbers of sequence tags aligned using BWA are shown in Supplementary Table S1. The duplicate sequences were removed using SAMtools v0.1.8 (ref. 60) before further analyses except for the repetitive sequence analysis (see below).

The enrichment regions of the pulldown sequences of SMC2/CAP-H, also referred as peaks, were identified using MACS v1.4.1 (ref. 26). The parameters used for peak calling includes the chicken reference genome size as 1, 016 Mb (excluding the repetitive sequences from the original chicken genome size 1.2-Gb), tag size as 49 bp and band width as 200 bp; other parameters remained default. As major peaks were consistent between each replicate, pulldown DNA sequences were pooled in order to increase the DNA coverage before peak calling. Respective input sequences were scaled to the size of the pooled pulldown sequence data for unbiased analysis. The number of regions that overlap between SMC2 and CAP-H peaks were identified using Bioconductor v2.3 package ChIPpeakAnno v2.8.0 (ref. 61). For peak distribution analysis, the number of peaks landing in each genomic feature including promoters, genes (including 5′UTR, coding exons, introns and 3′UTR of RefSeq genes) and extragenic were counted. We defined promoters as 2 kb upstream of TSSs of all RefSeq genes in the galGal4 chicken genome. The coordinates of the RefSeq genes were obtained from the NCBI 27 . The genomic distribution of each feature was calculated as their base-coverage in the total chicken genome.

Genų ontologijos analizė

Gene ontology analysis was performed on a list of genes overlapping with both SMC2 and CAP-H peaks and CpG islands using DAVID/EASE 62 .

Non-coding RNA gene analysis

The coordinates of the tRNA genes in galGal4 were obtained from the Genomic tRNA database (gtrnadb.ucsc.edu) 28, and the enrichment of pulldown sequence tags mapped to all 279 tRNA genes were calculated using bedtools 63 . Duplicate sequence tags were removed to prevent PCR amplification bias. If no input sequences were counted in a region for an experiment, the average number of input sequence tags aligned in the feature was used for enrichment calculation. Venn Diagrams (Fig. 2a) showing the tRNA genes having more than twofold enrichment over the input from this analysis were generated using Cistrome integrative analysis tools 64 .

rRNA coordinates were extracted from the RepeatMasker table from the UCSC table browser and calculated as described above. The pooled pulldown sequences mapped to the galGal4 genome were used for this analysis. Duplicate sequence tags were retained in this analysis.

Pulldown sequences were aligned to each type of rRNA gene consensus sequence obtained from GenBank as reference genome using BWA with default parameters and the numbers of aligned sequences were calculated using SAMtools. Each set of replicate sequence data was independently used for this analysis.

Repetitive sequence analysis

In order to prevent mapping bias, the pulldown enrichment in repetitive sequences were analysed in two ways: using genome-wide RepeatMasker annotation of the chicken genome from UCSC table browser 65 or using the consensus sequences of each type of repetitive sequences called Repbase from Genetic Information Research Institute (GIRI; www.girinst.org) 29 . The duplicate sequences were retained for this analysis due to the nature of repetitive sequences appearing in multiple locations in the genome. For genome-wide analysis, bedtools was used to count sequence tags overlapping each annotation of RepeatMasker 63 . For Repbase analysis, the pulldown and input DNA sequences were aligned to the Repbase sequences using BWA with default parameters, and the aligned sequence read numbers on each type of the consensus sequence were counted using SAMtools for pulldown enrichments and coverage analysis.

TSS analysis

Sequence alignment data in BAM format were transformed into BED format using bedtools and used for sequence density analysis at TSSs with EpiChip v0.9.7 (ref. 66). Default parameters were used. Duplicate sequence tags were removed using SAMtools 60 before performing this analysis. All RefSeq annotated gene TSS coordinates were obtained from NCBI 27 .

Accession numbers of sequence data

A number of the sequences were obtained from GenBank/DDBJ/EMBL in this study for condensin enrichment in centromere and rRNA gene sequences. Accession numbers of the rRNA sequences includes FM165415.2, AF173612.1, DQ018753.1, AF419701.3, AF419700.1 for 28S, 18S, and 5.8S intergenic spacer, 5S intergenic spacer, and 5S rRNA genes, respectively. Centromere sequences accession numbers include: AB556722.1, AB556723.1, AB556724.1, AB556725.1, AB556726.1, AB556727.1, AB556728.1 for centromere sequences of chromosome 1, 2, 3, 4, 7, 8, 11, respectively. Accession numbers of the fully sequenced centromeres of chromosome 5, 27, Z are AB556729.1, AB556730.1, AB556731.1, respectively. For transcription level analysis between condensin-bound and unbound genes, two independent Affymetrix array data of wild-type DT40 cells (GSM210532 and GSM465893) were obtained from Genome Expression Omnibus (GEO).

Statistical analysis of pulldown enrichment

We calculated the significance of the enrichment of each replicate pulldown compared with the input samples in some analysis (for example, rRNA genes and centromere; Figs 2d and 3d and Supplementary Fig. S8) using the Bioconductor v2.3 package edgeR v.3.2.3 (ref. 31). EdgeR uses empirical Bayes estimation and exact tests based on the negative binomial distribution to perform differential signal analysis of genome-scale count data. We calculated differential enrichment of the pulldown versus input using the edgeR exact test with tag-wise dispersion estimation. P -values were corrected for false discovery rate using the Benjamini–Hochberg method 31 .

The significant difference between two groups (for example, transcription between condensin-bound and unbound genes (Fig. 1c), tRNA genes with and without CpG islands (Fig. 2c), comparison between subtelomere and other satellite sequences (Supplementary Fig. S12)) were calculated using the Wilcoxon Rank Sum test, which is appropriate for comparing two groups with different sample sizes.

In order to show that the overlap between condensin (CAP-H–GFP–SBP) and telomere-FISH is not by chance, χ 2 test was applied (Fig. 5c). The proportions of telomere-FISH signals overlapping with CAP-H were counted and the proportions of CAP-H signal occupancy in DNA (representing the probability of condensin binding to any part of chromatin) were measured using ImageJ, and these two data sets were analysed using Pearson's χ 2 test.

Sidabrinis dažymas

The pulldown eluents from the chromatin affinity purification were boiled in SDS-sample buffer (Life Technology) at 95 °C for 5 min and subjected to SDS–PAGE on 4–12% BisTris gels (Life Technologies), followed by silver staining as previously described 67 . The gel was fixed in fixing solution (50% ( v / v ) methanol, 12.5% (v/v) acetic acid and 0.05% ( v / v ) formaldehyde) for 30 min, followed by two washing steps in washing solution (30% ( v / v ) ethanol). Following sensitization of the gel in 0.02% ( w / v ) sodium thiosulfate and hydration, the gel was silver-stained in the silver staining solution (0.2% ( w / v ) silver nitrate and 0.076% ( v / v ) formaldehyde) for 30 min, followed by developing in developing solution (10% ( w / v ) sodium carbonate, 0.1% ( v / v ) formaldehyde and 0.001% ( w / v ) sodium thiosulfate). Developing was stopped with incubation in the fixing solution.

Immuno-FISH

18S rRNA gene probe primers were designed to the complete 18S ribosomal RNA gene, GenBank accession number, AF173612; primer sequences: 18Sgg-f ATTAAGCCATGCATGTCTAAGTAC and 18Sgg-r CTTCCTCTAGATAGTCAAGTTCG. The product size was 1, 733 bp. The DNA fragment was amplified using standard PCR conditions, purified and then cloned into pGEM-T-easy (Promega). A telomere (TTAGGG) n probe, plasmid htel/neo was used for immuno-FISH.

The 18S rRNA and telomere probes were labelled with DIG or biotin for use as a FISH probe after nick translation using standard protocols. Immuno-FISH was performed according to standard protocols 68 . Briefly, 1 h nocodazole-blocked CAP-H–SBP and SMC2–SBP cells were hypotonically swollen and cytospun onto slides and the resulting stretched chromatin was co-stained with anti-SBP (1/200) and labelled with 18S rRNA or telomere probes. The cytospin process produced both stretched and unstretched chromosomes and representatives of each were displayed in the figures.

Imunoblotų analizė

Wild type (WT) and SMC2–SBP or CAP-H–GFP–SBP DT40 cell lines were lysed in lysis buffer (50 mM Tris/HCl (pH 7.4), 250 mM NaCl, 0.5% ( v / v ) NP-40, 30 μg ml −1 RNase A and freshly added protease inhibitors (Roche)), followed by sonication using the Bioruptor (Diagenode). Equal amounts of protein from crude lysate were run on 4–12% BisTris gels (Life Technologies) and immunoblotted as described previously 55 . The blots for both WT and SBP-tagged SMC2 or CAP-H were probed with rabbit anti-SMC2 or rabbit anti-CAP-H antibodies, respectively, both at 1:2, 500 in 1% ( w / v ) bovine serum albumin (BSA) PBS/ 0.2% ( w / v ) Tween20 (PBST) for 2 h, followed by anti-rabbit horseradish peroxidase staining (Millipore) at 1:60, 000 in PBST for 2 h. The blots were analysed using a chemiluminescence kit (GE Healthcare).

Srauto citometrija

DT40 cells were washed in PBS and homogenized, followed by fixation in 70% ethanol at 4 °C overnight. For cell cycle analysis, cells were washed three times in PBS and either stained in propidium iodide (Sigma) for 5 min at room temperature or immunostained using mouse anti-MPM2 antibody (Millipore) for 1 h followed by donkey anti-mouse Alexa-488 antibody (Life Technologies) staining for 30 min at room temperature. For apoptosis analysis, annexin 5-PE-Cy5 (Bio Vision, Inc) was applied according to the manufacturer's instruction. All assays were analysed using FACSCalibur (Becton Dickinson) and CellQuest (Becton Dickinson).

Kiekybinis PGR

The purified DNA was analysed by qPCR using 7900HT Fast Real-Time PCR System machine (Life Technology) and FAST SYBR Green Master Mix (Life Technology).

Primers are designed specifically for regions tested including tRNA genes and rRNA genes as well as negative control, and their sequences are available in Supplementary Table S3. The assay was performed on eight and three independent pulldown samples from CAP-H–GFP–SBP and GFP–SBP (tag only) affinity purification, respectively, for each primer pair.

Kiekybinė RT – PGR analizė

Total RNAs were extracted from both CAP-H ON and CAP-H OFF cells blocked in interphase by 4 mM thymidine using a mir Vana miRNA Isolation Kit (Ambion) according to the manufacturer's instruction. Residual DNA was removed using TURBO DNA-free Kit (Ambion). Total RNA (2 μg) from each sample was reverse-transcribed with High Capacity cDNA Reverse Transcription Kits (Applied Biosystems) according to the manufacturer's protocols. All cDNA samples were diluted to 15 ng μl −1 for qRT–PCR analysis. qRT–PCR was performed to examine the relative quantification of the expression level of selected genes based on the ChAP-seq. cDNA (15 ng) of each sample was amplified using SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer's protocol. Primers used in this experiment are available in Supplementary Table S4. The reaction was carried out in optical 384-well standard plates (Applied Biosystems) using HT9600 Fast real-time PCR system (Applied Biosystems). The relative quantification of the selected gene expression was calculated using 2 − ΔΔCt method after the threshold cycle ( Ct ) was normalized with the Ct of CENP-C . To ensure accuracy, at least three different experiments were performed individually and each sample was run in triplicates.

Papildoma informacija

Deposition of data : Raw and processed data from this study have been deposited in the NCBI Gene Expression Omnibus under accession number GSE45552.

How to cite this article: Kim, JH et al . Condensin I associates with structural and gene regulatory regions in vertebrate chromosomes. Nat. Bendruomenė. 4:2537 doi: 10.1038/ncomms3537 (2013).

Prisijungimai

„GenBank“ / EMBL / DDBJ

  • AF173612

Genų ekspresijos omnibusas

  • GSE45552

Papildoma informacija

PDF failai

  1. 1.

    Papildoma informacija

    Supplementary Figures S1-S15 and Supplementary Tables S1-S4

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.