Csr sistema reguliuoja viso genomo stabilumą ir transkripciją, taigi ir genų ekspresiją escherichia coli | mokslinės ataskaitos

Csr sistema reguliuoja viso genomo stabilumą ir transkripciją, taigi ir genų ekspresiją escherichia coli | mokslinės ataskaitos

Anonim

Dalykai

  • Bakterijų fiziologija
  • Bakterijų sistemų biologija

Anotacija

Bakterijų adaptacija reikalauja didelio masto genų ekspresijos reguliavimo. Mes atlikome Csr sistemos genomo analizę, kuri reguliuoja daugelį svarbių ląstelių funkcijų. Csr sistema užsiima reguliavimu po transkripcijos, tačiau taip pat buvo pasiūlytas vaidmuo transkripcijos reguliavime. Du baltymai, RNR jungiantis baltymas CsrA ir netipinis signalinis baltymas CsrD, dalyvauja Csr sistemoje. Palygintos genomo plataus transkripcijos stabilumas ir lygis laukinio tipo E. coli (MG1655) ir izogeninių mutantų padermėse, turinčiose CsrA ar CsrD aktyvumą, pirmą kartą parodant, kad CsrA ir CsrD yra atitinkamai globalūs neigiami ir teigiami transkripcijos reguliatoriai. CsrA vaidmuo transkripcijos reguliavime gali būti netiesioginis dėl 4, 6 karto padidėjusios csrD mRNR koncentracijos CsrA trūkumo kamiene. CsrA ir CsrD transkripcinis poveikis keliems genams buvo patvirtintas transkripcijos susiliejimais. Be poveikio transkripcijai, CsrA stabilizuoja tūkstančius mRNR. Tai yra pirmasis įrodymas, kad CsrA yra pasaulinis teigiamas mRNR stabilumo reguliatorius. Prognozuojame, kad šimtui genų, tiesiogiai kontroliuodamas CsrA mRNR stabilumą, jis gali prisidėti prie metabolizmo, reguliuodamas genų, dalyvaujančių anglies metabolizme ir transportavimą, ekspresiją, nepriklausomai nuo transkripcijos reguliavimo.

Įvadas

Organizmai sukūrė įvairius genų ekspresijos reguliavimo mechanizmus, kad pritaikytų savo fiziologiją ir metabolizmą prie besikeičiančios aplinkos, kad galėtų konkuruoti su kitomis rūšimis. Bet kuriuo adaptacijos proceso metu tarpląstelinis mRNR lygis yra tiesioginis genų ekspresijos reguliavimo rezultatas. Kiekvienam genui dviejų nepriklausomų ląstelių procesų balansas, mRNR sintezė ir skaidymas lemia mRNR kiekį. Anksčiau buvo įrodyta, kad šie du lygiai prisideda prie adaptacijos procesų įvairiuose organizmuose 1, 2, 3, 4 .

Genomo mastu globalūs reguliatoriai leidžia suderintai kontroliuoti didelį genų rinkinį, pajutę aplinkos pokyčius. Daugelis žinomų pasaulinių bakterijų reguliatorių yra transkripcijos reguliatoriai (CRP, Fis ir kt.)

.

) su gerai aprašytais veikimo mechanizmais. Jie aktyvuoja arba slopina mRNR transkripcijos inicijavimą RNR polimerazės būdu ir kontroliuoja visuotinį metabolizmą, pavyzdžiui, anglies įsisavinimą ir kvėpavimą. Tik keletas pasaulinių reguliatorių veikia mRNR stabilumą po transkripcijos. Vienas iš pavyzdžių yra RNR jungiantis baltymas Hfq, Sm ir Lsm baltymų homologas, sudarantis eukariotų splaisingo ir mRNR skilimo kompleksų branduolį. Hfq palengvina reguliuojamų nekoduojančių mažų RNR (sRNR) bazinių porų sąveiką keliose tikslinėse mRNR 7, kad destabilizuotų mRNR ir sureguliuotų pagrindinius bakterijų metabolizmo kelius 8, 9 .

Csr / Rsm (anglies kaupimosi reguliatorius / antrinių metabolitų represorius) sistema yra daugiakomponentė visuotinė reguliavimo sistema, gerai išsaugota bakterijose, kontroliuojanti daugelio svarbių ląstelių funkcijų genų ekspresiją. Csr sistema slopina glikogeno apykaitą, gliukoneogenezę, bioplėvelių susidarymą ir kvorumo jutimą, tuo metu suaktyvindama glikolizę, ląstelių judrumą, virulentiškumą ir patogenezę, kaip parodyta γ-proteobakterijose, tokiose kaip Escherichia, Salmonella, Erwinia, Pseudomonas ar Vibrio 10 . Jį sudaro du baltymai, CsrA, RNR jungiantis baltymas, ir CsrD, numanomas signalinis baltymas, ir dvi reguliuojančios sRNR, CsrB ir CsrC 11 . Csr sistema daugiausia žinoma dėl savo post-transkripcijos vaidmens užtikrinant mRNR stabilumą. Įrodyta, kad E. coli K-12 padermėse CsrA ryšys su mRNR destabilizuoja keturis transkriptus ( glgCAP, pgaABCD, ydeH ir ycdT ) 12, 13, 14, 15 ir stabilizuoja vieną ( flhDC ) 16 . CsrD baltymas skatina CsrB ir CsrC 17 skaidymą. Csr sistemos originalumas yra derinti daugiapakopį reguliavimą, veikiantį ne tik transliacijos, bet ir transkripcijos lygmeniu. Be savo vaidmens užtikrinant mRNR stabilumą, Csr sistema iš tiesų yra susijusi su posttransliaciniu reguliavimu per CsrA priklausomą fermento aktyvumą 18 . Pats CsrA aktyvumas yra reguliuojamas sRNR CsrB, CsrC ir McaS 19, 20, 21, 22 sekvestracija . Transkripcijos lygyje CsrA sąveikauja su visuotiniu griežtu atsaku 23 ir „BarA / UvrY“ dviejų komponentų signalo perdavimo sistema 24, 25, dviem pagrindiniais veikėjais reguliuojant E. coli geno raišką. CsrD vaidmuo transkripcijos lygyje dar nėra iki galo suprantamas. Nors CsrD yra GGDEF / EAL domenai, CsrD nėra tiesiogiai susijęs su c-di-GMP metabolizmu 17, 26 . Tačiau įrodyta, kad CsrD reguliuoja transkripcijos reguliatoriaus CsgD ekspresiją mechanizmais, kurie dar nėra visiškai išaiškinti 26 .

Kaip Csr sistema suderina transkripcinį ir post-transkripcinį reguliavimą viso genomo mastu, kad būtų galima kontroliuoti pagrindines fiziologines funkcijas, dar nėra nustatyta. Yra nedaug Csr sistemos genominių tyrimų, ir visi jie buvo skirti CsrA. „CsrA“ taikomų genų sąrašai buvo pateikti atliekant mRNR ir baltymo sąveikos analizę 23, bioinformatikos įrankius 27, 28 ir atliekant transkriptominę analizę 15 . Kai mRNR kiekio pokyčiai buvo nustatyti atliekant transkriptominę analizę, reaguojant į csrA 15 padidintą išraišką , mRNR stabilumo matavimas nebuvo atliekamas tuo pat metu, kad būtų galima atskirti transkripcijos ir po transkripcijos taisykles.

Čia mes išaiškinome CsrA ir CsrD reguliavimo tinklus tiek transkripcijos, tiek po transkripcijos lygiu. Mes nustatėme ir palyginkome genomo masto duomenis apie mRNR kiekį ir mRNR stabilumą laukinio tipo MG1655 padermėje, padermėje, kurioje iš dalies pašalinta csrA , MG1655 ( csrA51 ), ir paderme, išbrauktoje iš csrD , MG1655 (Δ csrD ). Taikydami integruotą metodą, parodome, kad mūsų eksperimentinėje būklėje CsrA ir CsrD yra įtrauktos į didžiulį transkripcijos reguliavimą, o genomo masto mRNR stabilumo reguliavimas priklauso tik nuo CsrA. Aptariame šiuos rezultatus, kalbant apie tiesioginį ir netiesioginį poveikį, ir parodome, kaip CsrA tiesiogiai kontroliuoja mRNR stabilumą ir prisideda prie metabolinės adaptacijos.

Rezultatai

MG1655 ( csrA51 ) ir MG1655 (Δ csrD ) mutantų padermių konstravimas ir augimas

CsrA genas yra būtinas ląstelių gyvybingumui E. coli K-12 padermėse, išaugintose iš glikolitinių šaltinių 29, 30 . Hipomorfinis mutantas, atitinkantis transposono įterpimą į csrA geną, yra gyvybingas ir jis buvo naudojamas daugybėje CsrA 31, 32, 33, 34 vaidmens tyrimų . CsrA yra dimerinis 61 aminorūgšties RNR jungiantis baltymas 35 . Dėl transposono įdėjimo gaunamas 50 aminorūgščių baltymas, išbrauktas iš C-galo dimerizacijos domeno 36 . Norėdami sukurti izogenines padermes MG1655 fone, mes sukūrėme MG1655 ( csrA51 ) padermę, įterpdami stop kodoną 51-oje padėtyje. Šioje konstrukcijoje endogeninis transkripcijos pasibaigimo signalas pasroviui nuo stop kodono yra išsaugotas. Kaip tikėtasi 36, MG1655 ( csrA51 ) štamas gamino daug daugiau glikogeno nei MG1655 štamas, ir šis fenotipas panaikinamas papildant laukinio tipo csrA negimdine kopija (papildoma S1 pav.). Kaip tikėtasi, mutantų padermė žymiai mažiau judėjo ir formavosi daugiau plėvelės (papildomas S1 pav.), Kaip tikėtasi 14, 16 . Matuojant CsrB ir CsrC lygius šiaurės pjūviu MG1655 ( csrA51 ) kamiene, paaiškėjo, kad nėra dviejų sRNR raiškos (papildomas S1 pav.), Patvirtinančios CsrA vaidmenį transkripciniame CsrB ir CsrC 24 aktyvavime. Visi šie rezultatai patvirtino, kad C-galo sutrumpinto CsrA varianto aktyvumas mūsų MG1655 ( csrA51 ) padermėje drastiškai sumažėjo.

MG1655 (Δ csrD ) padermė buvo sukonstruota visiškai pašalinus csrD geną E. coli MG1655. Kai auginamos partijoje M9 minimalioje terpėje, papildytoje gliukoze, MG1655 ( csrA51 ) ląstelės, palyginti su laukinio tipo (μ max = 0, 63 ± 0, 01 h - 2 ), sumažino maksimalų augimo greitį (μ max = 0, 31 ± 0, 01 h −1 ). 1 ) (1 pav.); normalus augimas buvo atkurtas papildant negimdinio laukinio tipo csrA geno kopija (1 pav.). MG1655 (Δ csrD ) (0, 52 ± 0, 08 h − 1 ), palyginti su MG1655 kamienu, maksimalų augimo greitį paveikė tik šiek tiek (1 pav.). Siekiant pašalinti augimo greičio poveikį mRNR pusinės eliminacijos periodams ir 3 lygiui bei sudaryti sąlygas palyginti padermes, MG1655, MG1655 ( csrA51 ) ir MG1655 (Δ csrD ) kamienai buvo auginami nepertraukiamoje kultūroje esant lygiaverčiam augimo greičiui 0, 10 h −1. . CsrA51 arba Δ csrD mutacijos nepaveikė padermių makrokinetinės elgsenos (1 lentelė). Gliukozė (3 g / l) buvo sunaudota visiškai, o acetatas nebuvo pagamintas. Šiek tiek didesnis biomasės derlius buvo išmatuotas MG1655 ( csrA51 ) kamiene. CsrA51 mutacija buvo susijusi su 5 kartus didesniu tarpląstelinio glikogeno kiekiu, palyginti su MG1655 kamienu (1 lentelė).

Image

Visas dydis

Pilno dydžio lentelė

CsrA51 ir Δ csrD mutacijų poveikis mRNR stabilumui

Įrodyta, kad CsrA reguliuoja kelių mRNR stabilumą 11 . Tačiau daug daugiau numanomų tikslų siūlo sąveikos tyrimas 23 ir bioinformatikos analizė 27, 28 . CsrD dalyvauja keičiant dvi sRNR CsrB ir CsrC 17, tačiau jo dalyvavimas mRNR stabilumo reguliavime dar nėra ištirtas. Norėdami ištirti CsrA ir CsrD įsitraukimą į mRNR stabilumo reguliavimą, palygėme mRNR stabilumo matavimus genomo mastu MG1655, MG1655 ( csrA51 ) ir MG1655 (Δ csrD ) padermėse, auginamose nenutrūkstamoje kultūroje esant 0, 1 h −1 (papildoma S1 lentelė). Transkriptai visame pasaulyje buvo mažiau stabilūs MG1655 ( csrA51 ) nei MG1655 padermėje, o vidutinis pusinės eliminacijos laikas sutrumpėjo nuo 4, 5 min. MG1655 iki 2, 9 min. Mutanto kamiene (2a pav.). Tiksliau, atliekant statistinį testą (P vertė ≤ 0, 1) buvo nustatyti 1672 pasiuntiniai, turintys skirtingą pusinės eliminacijos periodą tarp MG1655 ( csrA51 ) ir MG1655 padermių: 1618 buvo žymiai destabilizuotas mutantiniame kamiene, o 54 buvo žymiai stabilizuotas (2b pav.). Įdomu tai, kad šie rezultatai rodo viso genomo CsrA įsitraukimą į mRNR stabilumo reguliavimą ir ypač didžiulį mRNR destabilizavimą MG1655 ( csrA51 ) mutanto padermėje .

Image

a ) MG1655, MG1655 ( csrA51 ) ir MG1655 (Δ csrD ) padermių (n = 3351 mRNR) transkripcijos pusinės eliminacijos periodo dėžutės. Vertės yra padalintos į keturias kvartiles horizontaliomis juostomis. Centrinė juosta (stačiakampio viduryje) žymi vidurinę vertę, nurodytą virš juostos. MRNR pusinės eliminacijos laikas ( b ) tarp MG1655 ( csrA51 ) ir MG1655 (n = 3028 mRNR) ir ( c ) tarp MG1655 (Δ csrD ) ir MG1655 padermių (Log 2 FC) Log 2 kartos (Log 2 FC) „VolcanoPlot“. n = 3333 mRNR). P-reikšmė ≤ 0, 1 buvo reikalinga norint pakeisti raukšlės reikšmingumą (virš horizontalios brūkšninės linijos). Žymiai stabilizuotos mRNR mutantiniame kamiene, palyginti su MG1655 kamienu, yra raudonos spalvos, tuo tarpu žymiai destabilizuotos mRNR yra žalios spalvos.

Visas dydis

Vidutinis mRNR pusinės eliminacijos laikas MG1655 (Δ csrD ) buvo tik šiek tiek didesnis nei MG1655 padermėje (2a pav.). Tačiau taikant tą patį statistinį testą, kuris buvo naudojamas MG1655 ( csrA51 ) kamienui (P vertė ≤ 0, 1), tarp MG1655 (Δ csrD ) ir MG1655 kamienų (2c pav.) Nerasta jokios mRNR, turinčios reikšmingą stabilumo pokytį (2c pav.). nedidelis sistemingas pasaulio mRNR stabilumo padidėjimas. Šis pastebėjimas yra gana stebinantis, nes pagal nusistovėjusį Csr sistemos reguliavimo tinklą manoma, kad CsrD teigiamai reguliuoja CsrA veiklą per CsrB ir CsrC destabilizaciją 17 . Todėl buvo tikimasi MG1655 ( csrA51 ) padermės destabilizacijos, kaip jau pastebėta MG1655 ( ą csrD ) padermėje . Norėdami geriau suprasti šį fenotipą, mes išmatuojome CsrB ir CsrC pusinės eliminacijos periodus ir lygmenis. Kaip parodyta anksčiau 17, CsrB ir CsrC sRNR buvo stipriai stabilizuotos MG1655 (Δ csrD ) padermėje (papildomas S2 pav.), Tačiau jų lygis nebuvo atitinkamai modifikuotas, kas rodo transkripcijos retrokontrolę: iš tikrųjų CsrB lygis padidėjo tik maždaug po dviejų kartus mūsų eksperimento metu, tuo tarpu CsrC lygis netgi sumažėjo maždaug dvigubai (3 pav.). Kadangi CsrD CsrB ir CsrC apykaitos reguliavimas priklauso nuo ląstelių fiziologinės būklės 37, CsrB ir CsrC sRNR stabilizavimas rodo, kad CsrD buvo aktyvus mūsų augimo sąlygomis. Tikimasi, kad priešingas CsrB ir CsrC lygio reguliavimas tik šiek tiek pakeis CsrA kiekį, kurį sekvestravo dvi sRNR MG1655 (Δ csrD ) kamiene, palyginti su MG1655 kamienu. Todėl CsrA abiejų štamų aktyvumas turėtų būti gana panašus. Šią išvadą fenotipiniu lygiu patvirtino tai, kad MG1655 (Δ csrD ) štame nėra CsrA susijusio glikogeno atsako, palyginti su MG1655 kamienu. Išmatuojome glikogeno kiekį MG1655 (Δ csrD ) kamiene ir neradome glikogeno kiekio padidėjimo (1 lentelė). Mūsų augimo sąlygomis CsrD buvimas / nebuvimas neturėjo įtakos mRNR stabilumui nei per tiesioginį CsrD taikymą, nei pagal CsrA aktyvumą.

Image

a ) Visų RNR šiauriniai blotai nustatyti, nustatant CsrB ir CsrC. ( b ) hibridizacijos signalai, įvertinti kiekybiškai „PhosphorImager“. „MG1655“ signalai buvo nustatyti 100%.

Visas dydis

CsrA51 ir Δ csrD mutacijų poveikis mRNR lygiams

Norėdami įvertinti CsrA ir CsrD transkripcinę įtaką, pirmiausia išmatuojome transkriptominį atsaką MG1655 ( csrA51 ) ir MG1655 (Δ csrD ) mutantų padermėse (papildoma S2 lentelė). Priešingai nei didžiulis mRNR destabilizavimas MG1655 ( csrA51 ) padermėje , transkriptominės analizės parodė, kad mRNR sumos visame pasaulyje padidėja, kai 2195 mRNR yra žymiai didesnės, palyginti su 249 žymiai mažesnėmis mRNR (4a pav.). Aukščiau sureguliuotos išraiškos daugiausia buvo susijusios su ląstelės sienelės ir membranos biogeneze bei signalo perdavimo mechanizmais, o žemyn sureguliuotos išraiškos buvo susijusios su ląstelių judrumu, angliavandenių pernešimu ir metabolizmu (papildoma S3 lentelė). Šie rezultatai atitinka mūsų fenotipinį apibūdinimą ir literatūrą (mažesnis judrumas, daugiau biofilmų formavimosi ir glikogeno kaupimasis). Grupės „Flagellum organizacija“ ir „Ciliarinis ar pilvelinis judrumas“ (turinčios flhDC geną, fli ir flg operonus) buvo praturtintos žemyn reguliuojamu mRNR lygiu, koreliuojančiu su sumažėjusiu judrumu 16, 38 . GO terminas „vienos rūšies biofilmų formavimasis“ (įskaitant csg ir ydeH genus) buvo praturtintas aukščiau reguliuojamų mRNR lygių grupėje, bet taip pat yddV, yjjC ir daugiauE mRNR, koduojančiuose GGDEF / EAL baltymus, dalyvaujančius c-di-GMP metabolizme. 15, 33 . Visi transkriptai, dalyvaujantys glikogeno sintezėje ( glgC, glgB, glgA ir glgP / Y ), buvo bent 3 kartus padidinti ir reguliuojami nuosekliai atsižvelgiant į aukštą glikogeno, gaminamo MG1655 ( csrA51 ), lygį mūsų eksperimentinėje būklėje (1 lentelė). Be to, daugybė nuorašų, kurių išraiškas, kaip žinoma, kontroliuoja CsrA, įskaitant pck, cstA, hfq, relA ir spoT , elgiasi taip, kaip nurodyta literatūroje 23, 36, 39, 40 .

Image

MRNR kiekių (n = 4254 mRNR) log 2 kartų kitimas (Log 2 FC) ( a ) tarp MG1655 ( csrA51 ) ir MG1655 padermių ir ( b ) tarp MG1655 (Δ csrD ) ir MG1655 padermių. Kad rakto pokyčio reikšmingumas būtų reikalingas, P vertė ≤ 0, 01 (virš horizontalios brūkšninės linijos) ir log 2 FC, didesnė kaip 0, 5 arba mažesnė kaip –0, 5 (už vertikalių brūkšniuotų linijų). Tarp padermės mutantų ir MG1655 padermės žymiai padidintos vertės buvo nudažytos raudona spalva, o žymiai sumažintos lemputės - žalia spalva.

Visas dydis

Palyginti su MG1655 kamienu, pastebėtas stiprus MG1655 (Δ csrD ) kamienų transkriptominis atsakas (4b pav.). Didžioji dauguma genų buvo nepakankamai reguliuojami (3345/4254) ir tik 61 buvo žymiai labiau sureguliuoti. Tikimasi, kad MG1655 ( csrA51 ) štame bus ryšys tarp CsrA ir CsrD ekspresijos, nes CsrA 15, 17 neigiamai reguliuoja csrD geno ekspresiją. Mūsų rezultatai rodo, kad csrD mRNR kiekis buvo stipriai padidintas MG1655 ( csrA51 ) padermėje ( padidėjimas 4, 6 karto). Atsižvelgdami į šį rezultatą, mes palyginome MG1655 ( csrA51 ) ir MG1655 (Δ csrD ) kamienų transkriptominius atsakus. 77% (1878/2444) diferencijuotai ekspresuotų MRNR MG1655 ( csrA51 ) taip pat buvo diferencijuotai išreikštos Δ csrD ir daugumai jų (1653/1878) reguliavimas buvo priešingomis kryptimis: didžioji dalis aukščiau sureguliuotų mRNR MG1655 ( csrA51 ) buvo nepakankamai sureguliuotas MG1655 (Δ csrD ) kamiene. Iš viso šie rezultatai rodo, kad CsrA ir CsrD mutacijos sukelia stiprų, bet priešingą visuotinį mRNR lygio reguliavimą ir kad MG1655 ( csrA51 ) kamiene stebimą transkriptominį atsaką bent iš dalies galėjo tarpinti CsrD.

CsrA ir CsrD dalyvauja masiniame transkripcijos reguliavime

Norėdami iššifruoti globalius CsrA ir CsrD vaidmenis transkripcijos lygiu, mes integravome mRNR stabilumo ir mRNR kiekio duomenų rinkinius, išmatuotus MG1655, MG1655 ( csrA51 ) ir MG1655 (Δ csrD ) kamienuose. Kiekvienos mutantės ir laukinio tipo padermės mRNR koncentracijos skirtumai gali būti mRNR sintezės (transkripcijos), skilimo ir (arba) mRNR skiedimo pokyčių padarinys, nes ląstelės dalijasi nebūtinai tuo pačiu greičiu. Mūsų eksperimentuose visos padermės buvo auginamos tuo pačiu augimo greičiu, todėl mRNR skiedimo poveikį genų ekspresijai galima pašalinti. Todėl visus mRNR lygio pokyčius mūsų tyrime galima paaiškinti tik transkripcijos ir (arba) mRNR stabilumo reguliavimu.

MG1655 (Δ csrD ) paderme individualus transkripto stabilumas reikšmingai nepakito , tuo tarpu neigiamas transkriptominis atsakas buvo stebimas 3345 genams. Todėl šie mRNR lygio pokyčiai daugiausia atsiranda dėl žemo transkripcijos reguliavimo. Panašiai, MG1655 ( csrA51 ), 542 mRNR buvo sureguliuotos mRNR lygiu (teigiamai 82%), bet ne stabilumu. Tai rodo, kad mutavus csrA, atsiranda transkripcinis atsakas, kuris paprastai yra teigiamas. Šie rezultatai rodo, kad CsrD ir CsrA reguliuoja daugybę genų veikdami tik transkripcijos lygiu. Plataus CsrA ir CsrD transkripcijos veikimo molekulinis patvirtinimas buvo atliktas transkripcijos susiliejimais, naudojant lacZ reporterio geną. Mes patvirtinome didesnę lacZ ekspresiją kontroliuodami glgB ir ydeH promotorius MG1655 ( csrA51 ) kamiene, palyginti su MG1655 kamienu, ir mažesnę lacZ ekspresiją kontroliuodami frdA ir csrC promotorius MG1655 (Δ csrD ). kamienas MG1655 (papildoma S4 lentelė).

Norėdami gilintis į transkripcijos reguliavimą, mes ieškojome genų mRNR lygio pokyčių, susijusių su funkcine kategorija „Transkripcija, priklausoma nuo DNR“ tiek MG1655 (Δ csrD ), tiek MG1655 ( csrA51 ), palyginti su MG1655 kamienu. Įdomiai priešingas reguliavimas buvo stebimas mutantų padermėse, nes genai, koduojantys baltymus, dalyvaujančius transkripcijoje, buvo žemai sureguliuoti MG1655 (Δ csrD ) štame, bet aukščiau sureguliuoti MG1655 ( csrA51 ) (2 lentelė). Šie genai atitinka RNR polimerazę (β ir β subvienetai, rpoB ir rpoC ), sigmos faktorius ( rpoD, rpoE, rpoH, rpoN, rpoS ir fecI ), griežto atsakymo veiksnius ( relA, spoT ir dksA ) ir globalią transkripciją. reguliatoriai. Tiksliau, transkripcijos reguliatoriai buvo crp, cyaA ir fruR / cra, skirti reguliuoti anglies srautą, fnr ir arcA, dalyvaujantys reguliuojant aerobinius / anaerobinius metabolizmus ir ihfA bei ihfB, koduojantys IHF faktorių, dalyvaujantį chromosomų struktūroje. Kartu su pakoreguota csrD mRNR išraiška MG1655 ( csrA51 ) štame , šie rezultatai patvirtina išvadą, kad CsrD tarpininkaujama transkripcijos reguliacija prisideda prie transkripcijos atsako, stebimo MG1655 ( csrA51 ).

Pilno dydžio lentelė

CsrA yra pasaulinis teigiamas mRNR stabilumo reguliatorius

Norėdami iššifruoti tikslų CsrA vaidmenį didelės apimties mRNR stabilumo reguliavime, mes apsvarstėme tiek mRNR stabilumo, tiek koncentracijos pokyčius tarp MG1655 ( csrA51 ) ir MG1655. MG1655 ( csrA51 ) stabilumas ir lygio kitimai, palyginti su MG1655, schematiškai buvo suskirstyti į tris grupes (5a pav. Ir papildoma S5 lentelė). I grupė atitiko mRNR kiekio pokyčius, nesusijusius su stabilumo pokyčiais. Šioje grupėje buvo aukščiau paminėtos 542 mRNR, kurių lygiai buvo kontroliuojami transkripcijos metu. Dviejose kitose grupėse tiek stabilumas, tiek kiekis skyrėsi MG1655 ( csrA51 ), palyginti su MG1655. II grupėje (n = 1217) stabilumas ir kiekis kito priešinga kryptimi (mažesnis stabilumas, susijęs su didesniu MG1655 kiekiu ( csrA51 ), palyginti su MG1655, arba atvirkščiai), tuo tarpu III grupei (n = 455) buvo įtrauktos mRNR, turinčios stabilumą su panašiais arba aukštesnis lygis ir destabilizacija su panašiu ar žemesniu lygiu.

Image

a ) MRNR stabilumo ir kiekio pokyčiai tarp padermių MG1655 ( csrA51 ) ir MG1655. mRNR, kurių lygis skiriasi, bet nėra stabilus MG1655 ( csrA51 ), palyginti su MG1655, yra I grupėje, tos, kurių stabilumas ir kiekis skiriasi priešingomis kryptimis, yra II grupėje, o tos, kurių stabilumo ir kiekio pokyčiai nėra priešingos, yra III grupėje. b ) Transkripto pusinės eliminacijos periodo brėžiniai ( minutėmis ) kaip nuorašo kiekio funkcija (savavališkai išreikštais vienetais 1 mg sausos ląstelės svorio) MG1655 kamiene (n = 3074 mRNR) ir MG1655 ( csrA51 ) (n = 4098 mRNR) ). Visos vertybės buvo logiškai pakeistos ir sukoncentruotos. Pearsono koreliacijos koeficientas yra –0, 81, kai P vertė <2, 2E –16 .

Visas dydis

Ankstesniame tyrime mes įrodėme, kad E. coli mastu yra genomas, kad mRNR kiekis yra pagrindinis jos stabilumo veiksnys 41 . Braižant mRNR pusinės eliminacijos periodą, atsižvelgiant į jo kiekį MG1655 ( csrA51 ) ir MG1655, nustatyta stipri neigiama koreliacija (5b pav.). Tai rodo, kad tam tikros mRNR stabilumo pokytis tarp MG1655 ( csrA51 ) ir MG1655 gali būti susijęs su koncentracijos pasikeitimu. Kitaip tariant, mRNR stabilizavimas MG1655 ( csrA51 ) gali atsirasti dėl mažesnio mRNR kiekio, tuo tarpu destabilizacija gali kilti dėl didesnio kiekio. Šis ryšys buvo patvirtintas molekuliniu lygmeniu (Nouaille ir kt ., Rengiamas rankraštis). Todėl 1217 II grupės nuorašams, turintiems antagonistinį MG1655 stabilumą ir kiekį ( csrA51 ), mRNR stabilumo reguliavimas galėtų atitikti tiesioginį CsrA poveikį mRNR stabilumui arba netiesioginį poveikį, atsirandantį dėl mRNR lygio pokyčių, atsižvelgiant į transkripcijos reguliavimas. Šių mRNR stabilumo reguliavimas CsrA yra sudėtingas dėl tiesioginio ir netiesioginio sutapimo. Dauguma mRNR (1215/1217) buvo destabilizuotos aukščiau reguliuojamo lygio, o šioje grupėje buvo praturtintos tokios funkcinės klasės kaip „DNR replikacija“ ir „signalo perdavimas“ (papildoma S5 lentelė). Buvo ištirtas bendro sutarimo su CsrA rišamosios vietos RUACARGGAUGU 27 buvimas 1217 nuorašų –100 / + 100 nt srityje (+1, atitinkančiame pradinį kodoną). 635 parodė bent vieną numanomą CsrA surišimo vietą.

III grupės 455 mRNR, kurių stabilumas ir kiekis kinta tomis pačiomis kryptimis, pusinės eliminacijos trukmės pokyčiai negali būti paaiškinti dydžio pokyčiais pagal koreliaciją, parodytą 5b pav. Taigi tikėtina, kad jų stabilumą tiesiogiai kontroliuoja CsrA; todėl šios mRNR buvo numatytos kaip numanomi tiesioginiai CsrA tikslai po transkripcijos. Daugelis jų buvo nauji CsrA tikslai, nes kryžminiai mūsų sąrašo palyginimai su ankstesniais tyrimais parodė, kad tik 10 ir 93 jau buvo numatyti silico 28 arba, kaip įrodyta, kad jie apsivalo atitinkamai su CsrA 23 (papildoma S6 lentelė). Kaip ir anksčiau, 455 nuorašuose buvo tiriamas sutarimas dėl CsrA jungties vietos. Mes nustatėme, kad 180 mRNR turėjo unikalią tariamą CsrA surišimo vietą, o 78 turėjo bent 2 vietas su karštųjų taškų lokalizavimu 5′UTR srityje (papildoma S6 lentelė). Prognozuojama, kad daugiau kaip 65% (297/455) eksperimentiškai jungiasi su CsrA 23 ir (arba) turi tariamą CsrA jungimosi vietą. Šie rezultatai rodo, kad dauguma nustatytų numanomų tiesioginių CsrA po transkripcijos taikinių gali fiziškai sąveikauti su CsrA baltymu, nors negalima visiškai atmesti klaidingo teigiamo eksperimentinio prisijungimo 23 ir išsigimusios CsrA jungties motyvo. Mes nustatėme, kad daugiau kaip 88% (403/455) CsrA tiesioginių po transkripcijos taikinių buvo destabilizuoti MG1655 ( csrA51 ) kamiene (papildoma S6 lentelė). Kartu su rezultatais, parodytais 2b pav., Mūsų darbas rodo, kad CsrA vaidina svarbų vaidmenį stabilizuojant daugybę pasiuntinių.

Metabolinis tiesioginio mRNR stabilumo reguliavimo CsrA poveikis

Nesitikima, kad numatytas tiesioginis CsrA reguliuoja 455 mRNR stabilumą, tokiu pat būdu prisidės prie metabolinės adaptacijos kontrolės. 356 mRNR stabilumo pokytis tarp dviejų padermių nebuvo susijęs su reikšmingu mRNR lygio pokyčiu, kurio paprastai reikia norint išprovokuoti baltymų koncentracijos pokyčius. Šių mRNR stabilumo reguliavimui neutralizavo transkripcijos reguliavimas. Šios mRNR daugiausia buvo susijusios su transliacija ir angliavandenių transportavimu bei metabolizmu (papildoma S5 lentelė). Atvirkščiai, 99 nuorašų (papildoma S7 lentelė) stabilumo pokyčiai buvo susiję su mRNR kiekio pokyčiais, todėl jie gali prisidėti prie metabolinių skirtumų tarp dviejų padermių.

Tiksliau tariant, 64 mRNR buvo destabilizuotos esant žemyn reguliuojamam lygiui, tuo tarpu 35 buvo stabilizuotos aukštyn reguliuojamu lygiu tarp MG1655 ( csrA51 ) ir MG1655 kamienų (papildoma S7 lentelė). Tarp destabilizuotų ir žemai sureguliuotų mRNR MG1655 ( csrA51 ) padermėje radome tpiA , suderinę su ankstesniu rezultatu, parodantį, kad triozės-fosfato izomerazės aktyvumą teigiamai reguliuoja CsrA aktyvumas 42 . Mes taip pat nustatėme „ zwf“ nuorašą, anksčiau praneštą kaip bendro gryninimo su CsrA 23, tačiau niekada nebuvo įrodyta, kad jo stabilumas ir kiekis buvo reguliuojami Csr sistemos. Mūsų rezultatai aiškiai parodė žemai sureguliuotą mRNR stabilumą ir genų, koduojančių angliavandenių transportą ( araF, malE, alsB, idnT, melB, glpF, srlAEB ir agaVW ), kiekį ir tam tikrus metabolizmo kelius, pvz., Idonatų / gliukonato metabolinį procesą ( idnDOT ) ir galakturonato katabolinį kiekį. procesas ( uxaCA) MG1655 ( csrA51 ) (papildoma S5 lentelė). rastas mRNR stabilumas ir daugybė metabolinių fermentų ( aldA, ldhA, udp, yfaU, hdhA, glpK, dmlA, gloB, aes, fdhF, speB, tpx, thiH, ydiB, ilvC, pptA, ebgC ir frlB ). taip pat turi būti neigiamai reglamentuojamas MG1655 ( csrA51 ).

MG1655 ( csrA51 ) kamiene stabilizuotose ir aukštyn reguliuojamose mRNR glikogenezės ir gliukoneogenezės keliuose priklausė keli genai: maeA, maeB, pck, spragaA, pgm ir glgB (papildoma S5 lentelė). Buvo žinoma, kad kai kurių iš šių genų / baltymų ekspresiją ir (arba) aktyvumą neigiamai kontroliuoja CsrA 36, 42. Mūsų rezultatai leidžia geriau suprasti CsrA poveikį šiems taikiniams - reguliatoriui veikiant tiek mRNR stabilumo, tiek kiekio lygiu. Buvo nustatyta, kad kelių Krebso ciklo genų ekspresija (stabilumas ir lygis) ir aminorūgščių metabolizmas yra sureguliuoti MG1655 ( csrA51 ) kamiene: acnB, fumA, sdhC, leuB, leuC, glnA ir asd . Pastebėjome, kad mannozės PTS permeazės ( manXYZ ), piridino nukleotido transhidrogenazės ( pntAB ) ir riebalų rūgščių sintezės ( fabD ir fabF ) pasiuntiniai buvo stabilizuoti ir pasižymėjo aukštesniu lygiu MG1655 ( csrA51 ) kamiene. CsrA51 mutacija taip pat stabilizuoja ir padidina mRNR kiekį, susijusį su transkripcija ( RpoD, koduojančiu RNR polimerazės vegetatyvinį sigmos faktorių σ 70 ) ir su vertimu (ribosominiai rplP, rplN ir rpsS nuorašai). Tai ir glikogeno kaupimasis (1 lentelė) galėtų iš dalies paaiškinti šiek tiek didesnį MG1655 ( csrA51 ) kamieno biomasės derlių, palyginti su MG1655 (1 lentelė).

99 mRNR, kurių lygis ir stabilumas buvo sureguliuoti MG1655 ( csrA51 ) kamiene, mes ištyrėme stabilumo reguliavimo indėlį į mRNR kiekio kontrolę. Normatyviniai koeficientai buvo apskaičiuoti tarp MG1655 ( csrA51 ) ir MG1655 kamieno. Tai kiekybiškai apibūdina atitinkamą transkripcijos reguliavimo ir stabilumo reguliavimo poveikį mRNR 3 kiekiui. Didžiajai daugumai šių mRNR (85/99) stabilumo reguliavimas daugiausia kontroliuoja mRNR lygį. Tai rodo, kad būtent stabilumo pokytis išprovokavo diferencinį mRNR kiekį MG1655 ( csrA51 ) kamiene ir tai yra tiesa, net jei yra transkripcijos reguliavimas; mes tokio tipo reguliavimą vadinome skaidoma mRNR kiekio kontrole (papildoma S7 lentelė). Iš viso šie rezultatai yra pirmasis įrodymas, kaip CsrA tiesiogiai reguliuojantis (teigiamą / neigiamą) mRNR stabilumą reguliuoja šimtą mRNR kiekį nepriklausomai nuo transkripcijos reguliavimo ir todėl prisideda prie pasaulinio metabolizmo kontrolės.

Diskusija

Šiame tyrime pirmą kartą taikėme integruotosios biologijos metodą, kad iššifruotume CsrA ir CsrD transkripcijos ir post-transkripcijos vaidmenis. Nors paprastai manoma, kad Csr sistema dalyvauja po transkripcijos, baltymas CsrD yra susijęs su didžiuliu teigiamu transkripcijos reguliavimu. CsrA geno mutacija, priešingai, sukelia ir transkripcinį, ir post-transkripcinį atsaką. Tarp MG1655 ( csrA51 ) ir MG1655 padermių skiriasi daugiau nei 500 genų transkripcija ir daugiau kaip 1600 mRNR stabilumas. Priešingos transkripcijos reakcijos buvo gautos MG1655 ( csrA51 ) ir MG1655 (Δ csrD ) kamienuose. Kadangi mes patvirtinome stiprų csrD ekspresijos reguliavimą MG1655 ( csrA51 ), tikėtina, kad MG1655 ( csrA51 ) pastebėta transkripcijos reakcija bent iš dalies buvo tarpininkaujama CsrD. Neigiamo grįžtamojo ryšio, sukurto CsrA reguliuojant CsrD išraišką, svarba anksčiau buvo pabrėžta dinaminėje Csr sistemos reakcijoje 43 . CsrA tikslinių baltymų ekspresijos įjungimo ir išjungimo laikas priklausė nuo CsrD ekspresijos lygio. Mūsų tyrimas rodo, kad reguliuojanti Csr sistemos kontrolė apima genų ekspresijos, transkripcijos ir po transkripcijos, genų ekspresijos, sujungtos CsrA ir CsrD, reguliavimą (6 pav.).

Image

Užpildytos rodyklės žymi ryšio tipą „veikti“, o tuščia rodyklė žymi koreliaciją.

Visas dydis

Galima pasiūlyti keletą CsrD veikimo mechanizmų transkripcijos lygiu. This may occur indirectly via transcriptional factors whose expressions are CsrD-dependent. Many transcriptional regulators are down-regulated in the absence of CsrD. The actions of CsrD on transcriptional regulators could involve regulation of enzymes of the c-di-GMP signaling pathway, as shown for CsgD 26 . Another possibility is that CsrD regulates the turnover of sRNAs other than CsrB and CsrC 17, which in turn control transcriptional regulator expression at the post-transcriptional level. Finally, we cannot exclude a direct transcriptional effect of CsrD on targeted genes through a still unknown mechanism.

A strong negative correlation between mRNA half-life and its amount has been observed here for the whole genome, indicating that as a general trend mRNA stabilization can be due to a decrease in mRNA amount and vice versa. The regulation of mRNA stability by CsrA was complex for the 1217 transcripts with opposite variations of stability and quantity in MG1655( csrA51 ). For these genes, direct effect of CsrA on stability and the potential indirect effect of CsrA on stability due to change in mRNA level cannot not be discriminated (Fig. 6). Nevertheless for more than 400 mRNAs with stability varying in the same direction as mRNA quantity or not associated with mRNA quantity variation, we predicted that CsrA regulates directly their stability. For the majority of these mRNAs, control may be attributed to a physical interaction between CsrA and the mRNA molecule as indicated by the prediction of a putative binding site and/or high throughput binding analysis. For one third of these mRNAs, there was no experimental proof of CsrA binding 23 and we did not identify any consensus CsrA binding site. Either the sequences of the CsrA binding site were highly degenerated compared to the consensus in these mRNAs or CsrA may act on their stability through other post-transcriptional regulators (such as the RNA-binding protein Hfq) whose expression is CsrA-dependent 39 . About 88% of the half-lives directly regulated by CsrA were shorter in the MG1655( csrA51 ) strain than in the MG1655 strain. This result is surprising because, to date, most of the known targets of CsrA are repressed and/or destabilized, and at the molecular level, examples of repression are more numerous than positive regulation 11, 13, 44, 45, 46 . Thus, contrary to earlier studies on selected targets, our genome-wide analysis shows that CsrA has a significant role as a positive regulator of mRNA stability. The protective effect of CsrA binding on mRNA by sequestering RNase E cleavage sites, only described until now in the case of flhDC 45, might be common.

In terms of gene expression regulation, for one hundred mRNAs, the direct regulation of mRNA stability by CsrA led to a significant variation in mRNA concentration. We confirmed previously identified metabolic targets of CsrA such as glgB, pgm, tpiA and pck mRNAs 36, 42 . In addition, many new direct mRNA targets of CsrA were discovered with a potential metabolic impact via mRNA level changes. Functional analysis of these transcripts underlined that the Csr system is strongly involved in the control of E. coli metabolism by regulating expression of enzymes involved in the central carbon metabolism and carbohydrate transport but also in other specific metabolic pathways (syntheses of amino acids and fatty acids). In the MG1655( csrA51 ) strain, mRNA stability regulation favors gluconeogenesis especially anaplerotic reactions (eg malic enzyme, PEP carboxykinase), whereas the transport of glycolytic substrates (such as sorbitol, melibiose, gluconate, allose, maltose and arabinose) is down-regulated. Therefore, compared to MG1655, the MG1655( csrA51 ) strain is more likely to efficiently metabolize gluconeogenic substrates. Consequently, our results provide the first evidence at the genome-wide scale of the role of CsrA-dependent regulation of transcript stability in metabolic adaptation.

Our study provides new insights into the Csr regulatory network. We determined the extent, the nature and the metabolic effect of the CsrD and CsrA regulations. Our results highlight the superimposition at the genome-wide scale of the transcriptional and post-transcriptional controls that likely contribute to the robustness and dynamics of gene expression reprogramming during bacterial adaptation.

Metodai

Bakterijų padermės ir plazmidės

E. coli K-12 MG1655 strain (λ F rph −1 ) was the genetic background for mutation of csrA and csrD genes. Mutagenesis was carried out using λ red recombination 47 and primer pair OKT-24/OKT-25. As the csrA gene is essential 29, 30, the ORF was mutated using the csrA mutant obtained by Romeo and coworkers as a model 36 . The MG1655( csrA51 ) strain expresses a truncated variant of CsrA in which 11 amino acids at the C-terminal end of the protein have been deleted. The MG1655(Δ csrD ) strain has a total deletion of the csrD gene, which was obtained from the KEIO collection 29 . The mutations were transferred into E. coli K-12 MG1655 wild type background by P1 phage-mediated transduction before removing the antibiotic-resistance cassette by FLP recombination. MG1655( csrA51 ) strain was complemented by a low copy number plasmid containing the wild type csrA gene. Briefly, csrA was amplified using primer pair OCT-29/OCT-30 and cloned in pSAB11 48 at Eco RI site. To perform gene expression assays, csrC - lacZ, glgB - lacZ, frdA - lacZ and ydeH - lacZ transcriptional fusions were constructed. The transcriptional fusions were cloned in pJYB79 (CmR), a plasmid that was constructed by inserting the omegon kan from pHP45-kan into pACYC184 using the restriction site Bam HI and subsequently by cloning at Pst I site a PCR amplified fragment containing plac- lacZ from E. coli . First, a 5′UTR sequence containing a ribosome binding site and a start codon (GAATTCCCGGGGATCCTAAGTAAGTAAGGAGAAAAAAATGGCTGATCCC) was fused to lacZ 10 th codon. Then, the vector was amplified by PCR with primers MBO-200/-199 and assembled with the promoter regions using In-Fusion® HD cloning kit (Clontech). The promoters regions upstream of the transcription starts of csrC (249 nt), glgB (200 nt), frdA (205 nt) and ydeH (421 nt) were amplified on MG1655 genomic DNA with oligonucleotide pairs MBO-137/-138, MBO-203/-204, MBO-207/-208 and MBO-197/-198, respectively. For glgB, frdA and ydeH , the promoter regions that were chosen using information available on the EcoCyc E. coli Database listing previously characterized transcriptional regulators. For csrC , the promoter region is as used in Suzuki et al . 17 . The strains and plasmids were validated by sequencing. The oligonucleotides are listed in Table S8.

Culture conditions

For RNA extraction and microarray analysis, cells were grown in continuous culture at 37 °C in M9 minimal medium supplemented with glucose as described 3 . The MG1655, MG1655( csrA51 ) and MG1655(Δ csrD ) strains were cultured at the same growth rate, μ = 0.10 h −1, which corresponds to doubling time of 6.9 h. Each culture was repeated three times to provide independent biological replicates. Biomass was estimated from absorbance at 600 nm (Libra S4, Biochrom): 1 unit of absorbance corresponding to 0.42 g of dry cell weight l −1 for the MG1655 strain, 0.27 g of dry cell weight l −1 for the MG1655( csrA51 ) strain and 0.44 g of dry cell weight l −1 for the MG1655(Δ csrD ) strain. To determine the maximal growth rate of each strain, the strains were grown in batch culture (identical medium, oxygen concentration, pH and temperature) and the rates were determined in exponential growth phase.

Sampling and RNA extraction

Sampling and RNA extraction were conducted as described 3 with additional cell samplings after rifampicin addition at 9, 15, 20 and 30 min.

Northern Blot

For each sample, 10 μg of total RNA was denatured for 5 min at 95 °C in RNA loading buffer (95% [v/v] formamide, 0.1% [w/v] xylene cyanole, 0.1% [w/v] bromphenol blue, 10 mM EDTA), separated on a 7 M urea/6% polyacrylamide gel at 250 V and transferred to Hybond-XL membranes (GE Healthcare) by electroblotting (1 h, 50V, 4 °C) in 1X TBE. After UV crosslinking, the membranes were hybridized overnight in Roti®-Hybri-Quick (Roth) at 65 °C with [ 32 P] body-labeled riboprobes specific of CsrB (primers OCT-50/OCT-51) or CsrC (primers OCT-52/OCT-53) or at 42 °C with a 5S specific [ 32 P] end-labeled oligonucleotide (MBO-59). Hybridization with CsrB or CsrC riboprobe is followed by 15 min washes in 2X, 1X and 0.1X SSC/0.1% SDS solutions at 65 °C. Hybridization with 5S oligonucleotide is followed by 15 min washes in 5X, 1X and 0.1X/0.1% SDS solutions at 42 °C. Hybridization signals were quantified on a PhosphorImager (Typhoon Trio – GE Healthcare) with MultiGauge software (Fujifilm).

Mikro matricų procedūros

A double-stranded cDNA synthesis kit (InvitroGen) was used to produce cDNA from 2 μg of total RNA. cDNA (1 μg) was labeled using the one color DNA labeling kit (Nimblegen – Roche) and labeled cDNA (2 μg) was hybridized onto E. coli K-12 gene expression arrays (Nimblegen – Roche) for 17 h at 42 °C according to the manufacturers' instructions. Arrays were washed and then scanned with a MS200 Microarray Scanner (Nimblegen – Roche). The images were analyzed with DEVA 1.2.1 software. Only raw data were used for further analyses. All array procedures were performed by the GeT-Biopuces platform (//get.genotoul.fr).

mRNA level and half-life determination

mRNA quantity determination by transcriptomic analysis was conducted as described 3 . Intensity values were multiplied by the total RNA extraction yield (in μg total RNA per mg of dry cell weight) to provide mRNA amount value in arbitrary units per mg of dry cell weight. RNA extraction yields were 13.1 ± 2.2, 8.7 ± 0.9 and 8.9 ± 1.5 μg RNA per mg of dry cell weight for the MG1655, MG1655( csrA51 ) and MG1655(Δ csrD ) strains, respectively. Differences in mRNA level were evaluated as described in 3 . The P-values were adjusted for multiple testing by the 'Benjamini and Hochberg' (BH) false discovery rate method 49 . Differences in mRNA quantity were considered as significant for adjusted P-values lower than 1% and log 2 fold change (Log 2 FC) higher than 0.5 or lower than −0.5. mRNA half-life determination was performed as previously described 3 . The statistical significance of differences in half-life was evaluated using the probability value of interaction between time and the type of strain (MG1655, MG1655( csrA51 ) or MG1655(Δ csrD )) in a global model of linear regression. A statistical threshold of 10% was used for adjusted P-values by the “BH” false discovery rate method 49 .

Determination of mRNA level regulatory coefficients

For the selected mRNAs, the coefficient ρ D, corresponding to the relative contribution of the mRNA stability regulation in the control of mRNA level was calculated as previously described 3 using data of mRNA stability and quantity obtained in the MG1655( csrA51 ) and MG1655 strains. Regulatory classes were defined according to the ρ D value: 0 < ρ D < 0.6, mRNA quantity mainly controlled by transcription or controlled by both transcription and mRNA stability; 0.6 < ρ D, mRNA quantity mainly controlled by mRNA stability.

Enrichment methods

R free statistical software (www.r-project.org) was used for enrichment methods. Functional categories enriched in transcript subgroups were determined by a hypergeometric test on data using the Biological Process of Gene Ontology annotation database (GO project; //www.geneontology.org/). Only GO terms with associated P-value ≤ 0.05 were considered as significant.

In silico research of CsrA binding sites

To determine if an mRNA contained a potential CsrA binding site, the software PatScan was used 50 . The SELEX-derived consensus RUACARGGAUGU was searched in a −100/+100 nt window (+1 corresponding to the start codon) allowing a maximum of 5 mismatches. Subsequently, only sequences that included a conserved GGA motif were considered as a potential CsrA binding site.

Analizės metodai

Glucose and acetate concentrations were measured by HPLC coupled to a refractometer and with UV detection. The device was equipped with a Bio-Rad HPX87H column maintained at a temperature of 48 °C and 5 mM H 2 SO 4 was used as the eluent, at a flow rate of 0.5 ml min −1 . Glycogen staining by iodine vapor, biofilm formation by cristal violet staining and motility assays on 0.3% agar plate were carried out as previously described 51 . The intracellular glycogen quantification was done as previously described 52 . Briefly, the cells were lysed to extract the glycogen which was then hydrolyzed by amyloglucosidase into glucose subunits. The glucose subunits were then quantified using glucose oxidase coupled to the colorimetric reagent o-dianisidine dihydrochloride. Three independent experiments were performed for each assay.

The csrC - lacZ, glgB - lacZ, frdA - lacZ and ydeH - lacZ gene expression assays were performed using cells grown in batch culture at 37 °C in M9 minimal medium supplemented with fructose (2.7 gL −1 ), casamino acids (0.2%) and chloramphenicol (25 μg.ml −1 ). Under these conditions, the MG1655, MG1655( csrA51 ) and MG1655(Δ csrD ) strains have similar growth rates (0.39 h −1, 0.39 h −1 and 0.31 h −1 respectively). These conditions aimed at mimicking growth in continuous cultures. In exponential growth, the cells were centrifuged, suspended in Tris (6 mM)/Tricarballylate (1.8 mM) buffer pH 7.2 and lysed mechanically with glass beads. β-galactosidase activity was assayed using 2.5 mM orthonitrophenyl-β-galactoside 53 . Total protein was measured by the Bradford method with bovine serum albumin as the protein standard 54 . Three independent experiments were performed for each assay.

Papildoma informacija

How to cite this article : Esquerré, T. et al . The Csr system regulates genome-wide mRNA stability and transcription and thus gene expression in Escherichia coli. Mokslas. Rep. 6, 25057; doi: 10.1038/srep25057 (2016).

Papildoma informacija

PDF failai

  1. 1.

    Papildoma informacija

„Excel“ failai

  1. 1.

    Papildoma S1 lentelė

  2. 2.

    Papildoma S2 lentelė

  3. 3.

    Papildoma S3 lentelė

  4. 4.

    Papildoma S4 lentelė

  5. 5.

    Papildoma S5 lentelė

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.