Histono deacetilazė hda19 kontroliuoja šaknies ląstelių pailgėjimą ir moduliuoja arabidopsis fosfato badavimo reakcijų pogrupį | mokslinės ataskaitos

Histono deacetilazė hda19 kontroliuoja šaknies ląstelių pailgėjimą ir moduliuoja arabidopsis fosfato badavimo reakcijų pogrupį | mokslinės ataskaitos

Anonim

Dalykai

  • Abiotiška
  • Ląstelių likimas

Anotacija

Šaknies epidermio ląstelių ilgis ir jų išsidėstymas į plaukus turinčių ir be plaukų turinčias ląsteles yra genetiškai nustatomi, tačiau į aplinkos ženklus reaguoja labai plastiškai. Dėl riboto būtinų mineralinių maistinių medžiagų fosfato (Pi) fito prieinamumo padidėja šaknies plaukų skaičius, išilgai sutrumpinant epidermio ląsteles ir perprogramuojant ląstelių likimą tose vietose, kurias paprastai užima ne plaukų ląstelės. Išanalizavę šaknies morfologiją ir transkripcinius profilius iš transgeninių Arabidopsis linijų su pakitusia histono deacetilazės HDA19 išraiška , mes parodėme , kad sudėtingai susiejant Pi prieinamumą ir vidinius veiksnius, HDA19 kontroliuoja epidermio ląstelių ilgį, tikriausiai pakeisdamas padėties paklaidą, kuri diktuoja epidermio raštą. Be to, HDA19 reguliuoja kelis į Pi reaguojančius genus, koduojančius baltymus, turinčius svarbų reguliavimo ar metabolinį vaidmenį aklimatizuojant Pi trūkumą. Visų pirma, HDA19 paveikia genus, koduojančius SPX (SYG1 / Pho81 / XPR) domeno turinčius baltymus, ir genus, dalyvaujančius membranų lipidų rekonstravime, tai yra pagrindinis atsakas į Pi badą, kuris padidina laisvojo Pi kiekį augaluose. Mūsų duomenys prideda naują, ne transkripciškai kontroliuojamą Pi signalizacijos tinklo komponentą ir pabrėžia grįžtamojo posttransliacinio histono modifikavimo svarbą išorinių signalų integracijai į vidines vystymosi ir medžiagų apykaitos programas.

Įvadas

Šaknies plaukelių formavimas, vienaląsčių šaknų epidermio ląstelių išplėtimas, išauginantis iš specializuotų ląstelių, vadinamų trichoblastais, yra gerai ištirtas augalų ląstelių specifikacijos ir diferenciacijos modelis. Arabidopsis ir kiti Brassicales nariai šaknies plaukai yra išdėstyti juostele išilginiais plaukų ir ne plaukų ląstelių failais, kuriuos kontroliuoja sudėtingas mechanizmas, kurio metu transkripcijos reguliatorių judėjimas ląstelėmis nuo ląstelių ir tarpląsteliniai signalizacijos keliai reguliuoti kintamos dvejetainės ląstelės likimo paskirstymą 1, 2, 3 . Padėties signalą, kurį tikriausiai JKD sukelia šaknies žievėje 4, suvokia leucinu turtingas pakartotinio receptoriaus kinazė SCM, lokalizuota ant epidermio ląstelių plazminės membranos 5, 6 . Tariamai signalas yra gausesnis epidermio ląstelėse, kurios liečiasi su priešiklinių žievės ląstelių antiklinine siena (H padėtis) dėl didesnio paviršiaus kontaktinio paviršiaus, palyginti su ląstelėmis, esančiomis virš periklinalinės žievės ląstelių (N padėtis). Šis poslinkis, gautas iš žievės ląstelių, sustiprinamas grįžtamojo ryšio mechanizmu, kuris diktuoja didesnį SCM gausumą H padėtyse, palyginti su ląstelėmis N padėtyse 7 . SCM slopina ne plaukų transkripcijos faktorių WER, o tai lemia didesnį WER gausumą ne plaukų ląstelėse, palyginti su plaukų ląstelėmis. Kartu su bHLH MYC transkripcijos faktoriu GL3 ir WD pakartojamu baltymu TTG1, WER sudaro aktyvatoriaus kompleksą, kuris skatina ne plaukų ląstelių likimą palaikant homeodomeno baltymo GL2 8 transkripciją. Aktyvatorių kompleksas taip pat skatina R3 MYB transkripcijos faktoriaus CPC, teigiamo plaukų likimo reguliatoriaus, išraišką, kuris per plazmodesmatą migruoja į plaukų ląsteles, kur konkuruoja su WER dėl prisijungimo prie aktyvatoriaus komplekso 9 . Didesnis CPC / WER santykis pakenkia aktyvatoriaus komplekso funkcijai ir ląstelės patenka į plaukų ląstelių likimą. Pirmiausia, GL3 yra ekspresuojamas plaukų ląstelėse ir pereina į N padėtyje esančias ląsteles, kad sustiprintų ne plaukų ląstelių likimą.

Šaknies plaukų formavimasis labai reaguoja į aplinkos signalus. Pavyzdžiui, mažas fosfato (Pi) fito prieinamumas keičia šaknies epidermio ląstelių diferenciaciją, sukeldamas maistingosioms medžiagoms skirtą programą, kuri apima pirminio šaknies augimo slopinimą dėl šaknies viršūninio meristemos išsekimo ir riboto šaknų ląstelių pailgėjimo. Be to, pailgėja šaknies plaukelių pailgėjimo laikas ir padidėja jų augimo greitis, todėl žymiai padidėja šaknies plaukų ilgis 10 . Didesnis augalų, turinčių Pi trūkumą, šaknų plaukų dažnis atsiranda dėl sumažėjusio epidermio ląstelių išilginio pailgėjimo ir dėl N padėtyje esančių ląstelių 11 papildomų plaukų likimo priskyrimo 11 . Šis atsakas buvo ištirtas dėl plačiai naudojamo Columbia (Col-0) štamo, tačiau, atrodo, kad egzistuoja dideli Arabidopsis prisijungimų variantai 12 .

Gausus genų kiekis yra skirtingai išreikštas augalais, kuriuose trūksta Pi ir 13–14, 15 . Bendrosios raiškos analizė atskleidė, kad dideli į Pi reaguojančių genų moduliai yra susiję su šaknies plaukų fenotipo, būdingo augalams, kurių organizme trūksta Pi, sukėlimu16. Tačiau ne visų genų, lemiančių šį fenotipą, reakcija į kintantį Pi tiekimą parodė pakitusią išraišką. Iš anksto atliktame genetiniame tyrime nustatyta, kad ubikvitinui specifinė proteazė UBP14 (PER1) yra būtina šaknų plaukų pailgėjimui, ypač esant mažam Pi tiekimui 17 . Panašus ekranas nustatė homeodomeno baltymą ALF6 (PER2) kaip kritinį Pi trūkumo fenotipo 18 reguliatorių. Manoma, kad ALF6 jungiasi su trimetiliniu histono 3 lizinu 4 (H3K4me3) ir, kaip manoma, turi įtakos nuorašo subrendimui ir pasroviui taikomų objektų stabilumui 18, 19 . Įdomu tai, kad kitos histonų posttransliacinės modifikacijos (PTM), tokios kaip lizino liekanų deacetilinimas histono deacetilaze HDA18, yra svarbios formuojant šaknų plaukus Pi-pakaušio sąlygomis. HDA18 švino ląstelių, esančių N padėtyje, aktyvumo pokyčiai, lemiantys plaukų ląstelių likimą 20, 21 .

Buvo pranešta, kad I klasės HDA, tokie kaip HDA6 ir HDA19, dalyvauja keliuose reagavimuose į biotinius ir abiotinius stresus ir vaidina reguliavimo vaidmenį vystymosi programose 22 . Čia mes išsirinkome ištirti RPD3 / HDA1 superšeimos nario HDA19 vaidmenį perduodant Pi trūkumo signalą į fenotipą, būdingą Pi trūkumo augalams. Mes pranešame, kad HDA19 kontroliuoja kelis atsakus į Pi badavimą, įskaitant šaknų plaukų tankį, epidermio ląstelių pailgėjimą ir membranos lipidų atstatymą, taip pabrėžiant chromatino modifikacijų kritinį dalyvavimą fenotipiniame plastiškume.

Rezultatai

I klasės HDA mutacijos pakenkia Pi trūkumo sukeltam plaukų šaknies tankio padidėjimui

Pi trūkumas daro įtaką epidermio ląstelių vystymuisi specifinėmis maistinėmis medžiagomis, todėl padidėja šaknies plaukelių ilgis ir tankis 23, 24 . Šiuos pokyčius reguliuojantis molekulinis mechanizmas išlieka sunkus. Šaknies plaukų modeliavimas kontroliuojamomis (Pi-pakartotinėmis) sąlygomis priklauso nuo teisingo branduolio histonų N-galo uodegų acetilinimo 20, 21 . Norėdami ištirti, ar grįžtamasis histono acetiliavimas taip pat svarbus Pi trūkumo sukeltų plaukų šaknies fenotipui, mes ištyrėme homozigotinius mutantus ar nugrimzdimo linijas, turinčias HDA18 (II klasės RPD3 / HDA1 supermama) raišką , HDA17 , neklasifikuotą narį. iš RPD3 tipo šeimos, o I klasės nariai HDA6 , HDA9 ir HDA19 - už jų šaknies plaukų fenotipus kontroliuojamose ir žemose Pi sąlygose. Visos linijos parodė reikšmingą šaknies plaukų tankio padidėjimą, auginant žemoje Pi terpėje. Šis padidėjimas buvo mažiau ryškus visų trijų I klasės HDA atžvilgiu, o tai ypač akivaizdu hda19 mutante (1a pav.). HDA19-RNRi augalai parodė panašų atsaką kaip ir hda19 mutantas. Transgeniniai augalai, kurie ekspresuoja HDA19, veikiami 35S promotoriaus (35S: HDA19), išaugino daugiau šaknies plaukelių žemo Pi sąlygomis, palyginti su laukiniu tipu (1 pav.). Pabrėžtina, kad HDA19-RNR formavo mažiau šaknies plaukelių nei laukiniai, taip pat esant kontroliuojamoms sąlygoms, o mutantai, turintys HDA18 ir HDA17 ekspresijos trūkumą, išaugino žymiai daugiau šaknies plaukelių nei laukiniai, kai Pi-pilnas.

Image

a ) Šakninių plaukų skaičius. b ) šaknies plaukų ilgis. Daigai buvo auginami kontrolinėje ir žemoje Pi terpėje 14 dienų. Duomenys rodo dešimties augalų vidurkį kiekvienam genotipui ir augimo tipui ± SE. Žvaigždutės žymi statistiškai reikšmingus skirtumus tarp Pi papilą turinčių laukinio tipo augalų, remiantis Studento t-testu (* P <0, 05, ** P <0, 01, *** P <0, 001). HDA19-Ri, HDA19-RNAi.

Visas dydis

Šakninių plaukų ilgis padidėjo daugiau nei du kartus po Pi bado; pastebėtas Pi trūkumo sukeltas padidėjimas visose linijose, išskyrus hda18 (1b pav.). Pi-pakaitalo sąlygomis tik HDA9-RNRi augalams buvo stebimas šaknies plaukų ilgio nuokrypis nuo laukinio tipo.

HDA19 aktyvumas kontroliuoja epidermio ląstelių ilgį

Arabidopsis'e variklinė jėga, didinanti šaknų plaukų tankį, kai trūksta Pi, yra sumažėjęs trichoblastų išilginis pailgėjimas 11 . Norėdami ištirti, ar pakitęs HDA19 ekspresija sukelia šaknies plaukelių dažnį, yra pakeisto trichoblastų ilgio pasekmė, mes išanalizavome tiriamų genotipų epidermio ląstelių ilgį. Šiuo tikslu mes sudarėme atskirų šaknų mikrografus, apimančius šešis – aštuonis šaknies galiuko milimetrus, ir išmatuojome ląstelių ilgį, atsižvelgiant į jų atstumą nuo ramybės centro. Ši procedūra buvo pakartota naudojant tris skirtingas šaknis kiekvienam genotipui (laukinio tipo, HDA19-RNR ir 35S: HDA19) ir augimo tipui (Pi-pilnas ir žemas Pi). Atitinkami šaknies plaukų fenotipai parodyti 2 pav. Ląstelių ilgio matavimai parodė, kad abiejų augimo tipų HDA19 gausa yra kritiška kontroliuojant tiek trichoblastų, tiek atrichoblasts ilgį (3 pav.). Nors numuštos linijos gamino žymiai ilgesnes nei laukinio tipo ląsteles, 35S: HDA19 augaluose buvo pastebėtos trumpos epidermio ląstelės. HDA19-RNRi augalai parodė didelius ląstelių ilgio pokyčius Pi-pilnas sąlygomis, kurios buvo vidutiniškai panašios į laukinio tipo. Ląstelės ilgio pasiskirstymas palei šaknis parodytas 3c – j pav.

Image

Paveikslėliai rodo sudarytus konfokalinius vaizdus. Masto juosta = 100 μM.

Visas dydis

Image

( a, b ) Laukinio tipo (wt), hda19 , HDA19-Ri (Ri) ir 35S: trichoblastų ( a ) ir atrichoblasts ( b ) ilgis: kontroliuojami HDA19 (35S) augalai ( c, e, g, i ) ir žemo fosfato (LP; d, f, h, j ) sąlygos. ( c – j ) Duomenys a ir b langeliuose rodo trijų genotipų ir apdorojimo šaknų vidurkį (vidutiniškai 550 ląstelių augimo ir genotipo atžvilgiu). Vidurkis parodytas raudonai. ( Cj ) duomenys yra gauti iš analizuotų sudarytų konfokalinių mikrografijų iš trijų skirtingų šaknų kiekvienam apdorojimui ir genotipui. QC, ramybės centre.

Visas dydis

Dėl per didelio HDA19 ekspresijos augalai, kuriems trūksta Pi, priskiria papildomą plaukų ląstelių likimą

Be to, kad sumažėja ląstelių ilgis ir, atsižvelgiant į šį atsaką, padidėja šaknies plaukų tankis H padėtyje, augimas terpėje, kurioje ištuštėja Pi, padidina epidermio ląstelių, esančių N padėtyje, tikimybę priimti H ląstelių likimą 24 . Norėdami ištirti, ar šaknies plaukų tankio padidėjimas 35S: HDA19 augaluose, reaguojant į Pi badavimą, yra tik dėl epidermio ląstelių sutrumpėjimo, ar papildomas H ląstelių likimo nustatymas prisideda prie fenotipo, atlikome išsamią šaknų plaukų dažnio analizę. negimdinėse vietose, remiantis skerspjūviu. Ši analizė atskleidė dramatišką (33 kartų) negimdinių šaknų skaičiaus padidėjimą 35S: HDA19 augaluose, auginant žemoje Pi terpėje. Nors šį didžiulį padidėjimą lėmė labai mažas negimdinių šio genotipo šaknų skaičius kontroliuojamomis sąlygomis (0, 3 prieš 1, 1 laukinio tipo), negimdinių šaknų plaukeliai, susiformavę žemomis Pi sąlygomis, 35S vis tiek buvo tris kartus didesni: HDA19 linija, palyginti su laukinio tipo linija (4 pav.), Rodo, kad labai padidėjo tikimybė, kad plaukai susiformuos negimdinėse vietose.

Image

a ) Konfokusinis mikrografas, rodantis trichoblastą likus atrichoblast ląstelėms šaknyje, kurioje trūksta Pi. b ) Skerspjūvis, rodantis šaknies plaukų formavimąsi H ir N padėtyse (*). c ) Šaknies plaukų, esančių N padėtyje, kiekybinis įvertinimas, remiantis skerspjūvio analize. Daigai buvo auginami kontrolinėje ir žemoje Pi terpėje 14 dienų. Duomenys rodo maždaug 40 skerspjūvio iš 10 augalų kiekvienam genotipui ir augimo tipui ± SE. Žvaigždutės žymi statistiškai reikšmingus skirtumus tarp Pi papilą turinčių laukinio tipo augalų, remiantis Studento t-testu (* P <0, 05, ** P <0, 01, *** P <0, 001).

Visas dydis

HDA19 gausa daro įtaką lapų reakcijai į Pi badą

Kitas augalų, turinčių Pi trūkumą, požymis yra antocianino kaupimasis lapuose, siekiant apsaugoti nukleorūgštis ir chloroplastus nuo fotooksidacinių pažeidimų dėl ribotos fotosintezės. Laukinio tipo augaluose buvo pastebėtas maždaug 4 kartus padidėjęs antocianinų koncentracija po augalų perkėlimo į žemą Pi terpę (5a, b pav.). Pi-deficito hda19 mutantai parodė labai nedidelį antocianinų lygio padidėjimą, palyginti su augalais, kuriuose pilna Pi; Pi-deficito HDA19-RNRi augaluose antocianinų kiekis, palyginti su laukiniu tipu, buvo sumažintas, kai auginami Pi-pilne arba žemoje Pi terpėje. Antocianinų koncentracija 35S: HDA19 augalai nesiskyrė nuo laukinio tipo (5a, b pav.). Kadangi antocianinų sintezę kontroliuoja R3 ir R2R3 MYB transkripcijos veiksniai, kurie taip pat reguliuoja epidermio ląstelių likimą ( ty CPC ir GL3), buvo pagunda manyti, kad HDA19 gausa keičia šaknų plaukų tankį, pakeisdama jų išraišką. Tačiau CPC ir GL3 nuorašo gausa tiriamuose genotipuose reikšmingai nesiskyrė.

Image

a ) Antocianinų kiekis normalizuotas, kai laukiniai augalai papildo pi. b ) Tiriamų linijų lapai kontroliuojami ir esant žemoms Pi sąlygoms. c ) fosforo koncentracija lapuose ir d ) geležies koncentracija šaknyse, nustatyta ICP-OES. Daigai buvo auginami kontrolinėje ir žemoje Pi terpėje 14 dienų. Duomenys rodo dešimties augalų vidurkį kiekvienam genotipui ir augimo tipui ± SE. Žvaigždutės žymi statistiškai reikšmingus skirtumus tarp Pi papilą turinčių laukinio tipo augalų, remiantis Studento t-testu (* P <0, 05, ** P <0, 01, *** P <0, 001).

Visas dydis

Lapo Pi koncentracijos nustatymas naudojant ICP-OES neparodė reikšmingų skirtumų tarp laukinio tipo ir 35S: HDA19 augalų abiem augimo sąlygomis. HDA19-RNRi augaluose Pi koncentracija lapuose reikšmingai sumažėjo kontroliuojamomis sąlygomis, tačiau augalų auginimo žemoje Pi terpėje pokyčių nepastebėta (5c pav.). Pi koncentracija šaknyse nesiskyrė tarp genotipų. Geležis kaupiasi augaluose, kuriuose trūksta Pi 13 ir gali trukdyti ląstelėms pailgėti. Kaip buvo galima tikėtis iš ankstesnių tyrimų, geležies koncentracija nepaprastai padidėjo esant Pi trūkumui, tačiau jis labai nesiskyrė tarp genotipų, išskyrus reikšmingą 35S šaknų padidėjimą: HDA19 augalai, auginami žemoje Pi terpėje (5d pav.). Tarp tiriamų genotipų lapų geležies koncentracijos skirtumų nepastebėta.

HDA19 moduliuoja į Pi reaguojančių genų raišką

Norėdami suprasti molekulinius įvykius, lemiančius linijų, turinčių pakitusią HDA19 raišką, fenotipus , atlikome HDA19-RNR ir 35S: HDA19 augalų, auginamų kontroliuojamose ir žemose Pi sąlygose, transkripcijos profiliavimo eksperimentus. Palyginus su 35S: HDA19 linijomis, HDA19-RNRi augaluose 86 Pi reaguojančių genų raiška buvo du kartus mažesnė (1 papildoma lentelė). Tarp genų, turinčių didžiausią skirtumą, buvo SPX3, kuris parodė 17 kartų didesnį skirtumą tarp dviejų genotipų. SPX1 , kuris koduoja pagrindinį Pi badavimo atsako reguliatorių, ir kitas SPX (SYG1 / Pho81 / XPR) domeno baltymas, At2g38920, mažiau reaguoja į Pi HDA19-RNAi linijose. Be to, MGD3 , pagrindinis galaktolipidų biosintezės fermentas, ir purpurinės rūgšties fosfatazės PAP23 buvo sureguliuotos HDA19-RNRi augaluose. Galaktolipidų biosintezę skatina Pi trūkumas kaip metabolinio kelio dalis, kurios metu fosfolipidai (PL) membranose yra pakeičiami galaktolipidų digalaktozildiacilgliceroliu ir sulfolipidų sulfoquinovosyldiacylgliceroliu („membranos lipidų atstatymas“ 25 ). PAP išskyrimas, skirtas pakartotinai mobilizuoti Pi, yra dar vienas svarbus PSR atsakas. PAP23 yra ekspresuojamas kartu su SPX1 / SPX3 ir genais, dalyvaujančiais galaktolipidų biosintezėje, kurie buvo stipriai sukelti po Pi bado, pavyzdžiui, MGD3 . Fosfolipazės D PLDζ2 ir glicerofosfodiesterio fosfodiesterazės GDPD6 raiška sumažėjo HDA19 numušimo linijoje. Taip pat PLDζ2 ir GDPD6 buvo siejami su PL hidrolize kaip membranos lipidų atstatymo dalis 26, 27 . Pabrėžtina, kad PLDζ2 indukcija Pi badaujant priklausė nuo funkcinio CPC, teigiamo reguliuojančio šaknies plaukų ląstelių likimą 28 . GDPD konvertuoja lizofosfatidilcholiną, gautą iš PL, į glicerolio-3-fosfatą, galaktolipidų pirmtaką. CAR8 , dar vienas represuotas genas HDA19-RNRi linijoje, yra sandariai ekspresuojamas kartu su genais, dalyvaujančiais galaktolipidų biosintezėje. Penki genai, kurių raiška yra sumažinta HDA19-RNRi augaluose, koduoja baltymų kinazes ( CRK24 , CRK6 , CRK45 , HT1 , At2g17170), rodančius galimą ląstelės ilgio reguliavimą po transkripcijos. Taip pat atkreipkite dėmesį, kad du genai, dalyvaujantys signalizacijoje iš ląstelių į RALFL9 ir RALFL27 , peptidų šeimos nariai, panašūs į tabako greito alkalinizacijos faktorių (RALF), buvo mažiau ekspresuojami HDA19-RNR, palyginti su 35S: HDA19 augalais.

Atsižvelgiant į HDA19, kaip genų repressoriaus, vaidmenį, šiek tiek daugiau genų (106) parodė didesnį indukciją Pi badaujant HDA19-RNR, palyginti su 35S: HDA19 augalais. Ryškiausi skirtumai buvo pastebėti keliuose genuose, koduojančiuose nežinomus baltymus (2 lentelė). Įdomu tai, kad 11 genų, esančių šiame rinkinyje ( IGMT2 , GSTL1 , At3g01260 , NMT3, SKOR , GSTF3 , At5g22555, At2g43590, At4g01430, At4g19370 ir FRD3 ), anksčiau buvo apibrėžti kaip Fe-responsive 29, tuo tarpu tik vienas toks genas ( NAS2 ) buvo tarp genai, kurių HDA19-RNAi linijoje buvo mažesnė ekspresija. Maždaug pusė šios grupės genų buvo sureguliuoti dėl geležies trūkumo, o kita pusė - sumažėjusios ekspresijos augaluose, kuriuose trūksta geležies, ir tai rodo, kad dėl funkcinio HDA19 trūkumo gali būti pažeista ląstelių geležies homeostazė. Atsižvelgiant į ląstelių diferenciacijos vaidmenį, keli genai (20 iš 106) koduoja baltymus, kurie, kaip prognozuojama, yra tarpląsteliniame regione. Trys genai (At5g48540, At1g07560 ir ATPI4Kγ3 ) koduoja baltymų kinazes.

Norėdami patvirtinti pastebėtus genų ekspresijos pokyčius, qRT-PGR nustatėme pasirinktų genų nuorašo lygius. Ws-2, laukinio tipo transgeninių linijų, šaknyse SPX3 nuorašus dramatiškai padidino Pi trūkumas. Norėdami palyginti su plačiai naudojamu Col-0 prisijungimu, mes taip pat nustatėme SPX3 raišką Col-0 šaknyse, kurie parodė panašų transkripto gausos padidėjimą. Abiejuose HDA19 numušimo linijų augimo tipuose SPX3 transkripto lygis buvo žymiai sumažėjęs, palyginti su laukiniais tipais; 35S: HDA19 linijos pokyčių nepastebėta (6 pav.). Panašus vaizdas buvo stebimas SPX1 , nors ir su ne tokiais ryškiais pokyčiais.

Image

a ) SPX3 ir SPX1 raiškos analizė naudojant qRT -PGR. b ) subrendusios miR399d gausos Northern blot analizė. c ) pri-miR399d raiškos qRT -PGR analizė. Daigai buvo auginami kontrolinėje ir žemoje Pi terpėje 14 dienų. Reikšmės yra trijų biologinių pakartojimų vidurkis ± SE.

Visas dydis

„miRNA399“ yra sisteminis PSR reguliatorius. Norėdami nustatyti, ar sisteminė Pi signalizacija yra paveikta linijų su pakitusiomis HDA19 ekspresijomis, mes išmatuojome subrendusio miR399d gausą ir pirminį jo nuorašą (pri-miR399d) atitinkamai atlikdami Northern blotting ir qRT-PCR. „MiR399d“ Northern blot analizė parodė didžiulį RNR gausos padidėjimą, kai trūksta Pi trūkumo, šiek tiek sumažinus HDA19-RNRi liniją ir ryškesnę juostą 35S: HDA19 linijos šaknims (6a pav.). Pri-miR399d raiškos analizė palaikė šį modelį. Laukiniame tipe pri-miR399d gausa padidėjo maždaug 7 kartus (6b pav.). Pri-miR399d išraiška reikšmingai nepakito tiesiosios linijos atžvilgiu; nors buvo pastebėta sumažėjusios raiškos tendencija. 35S: HDA19 augaluose pastebimas ryškus pri-miR399d nuorašo lygio padidėjimas augalų, auginamų tiek pildant, tiek esant žemoms Pi sąlygoms, šaknims (6b pav.), Rodantis didesnį miR399d aktyvumą 35S: HDA19 augaluose. Taigi paaiškėja, kad HDA19 yra labai svarbus sisteminiam Pi signalizavimui.

Diskusija

Grįžtamasis branduolių histonų modifikavimas yra svarbus genų aktyvumo reguliatorius, moduliuojantis DNR templuojamus procesus, tokius kaip transkripcija ir taisymas. Specifinių lizino liekanų ε-amino grupės acetilinimas neutralizuoja teigiamą histono uodegos krūvį, taip susilpnindamas sąveiką su DNR ir padidindamas DNR prieinamumą transkripcijos reguliatoriams 30 . Histonų acetilinimas paprastai susijęs su genų aktyvacija. Tačiau histono PTM galutinai nenusprendžia genų ekspresijos, todėl histonų žymių aiškinimas buvo apibūdinamas kaip „histono kalbos“ vertimas, o ne iššifruotas griežtas kodas 31 . Taigi, nors HDA paprastai apibrėžiami kaip transkripcijos represoriai, sumažėjęs acetilinimas nėra privalomas genų represijų partneris. Tai patvirtina faktas, kad šiame tyrime daugiau nei du kartus padidėjusių Pi reaguojančių genų skaičius padidėjo HDA19-RNR, palyginti su 35S: HDA augalų buvo tik šiek tiek daugiau nei genų, kurių ekspresija dvigubai mažesnė. numušta linija. Taigi fenotipinius pokyčius, pastebėtus transgeninėse linijose, gali sukelti genų aktyvacija ir slopinimas dėl pakitusios HDA19 gausos.

HDA19 moduliuoja signalų perdavimą iš vienos ląstelės į kitą

Išilginį epidermio ląstelių ilgį kontroliuoja dar nenustatytas signalas, kuris, greičiausiai, kyla iš šaknies žievės. Mutantai, kurie negali pajusti ar perduoti šio signalo, tokie kaip scm ar wer, sukuria trumpas ląsteles, būdingas šaknis plaukus formuojančioms ląstelėms 11 . Matematinis modeliavimas parodė, kad stokos signalo suvokimas arba sumažėjęs stiprumas prailgina laiką, kuriame ne plaukų ląstelės išeina iš numatytojo trichoblastinio kelio, ir susidaro trumpos, į trichoblastus panašios epidermio ląstelės 11 . Taip pat buvo pasiūlyta sumažinti žievės paklaidą augaluose, kuriuose trūksta Pi, dėl to sumažėja epidermio ląstelių ilgis ir sumažėja epidermio modelio tvirtumas. Dabartiniai duomenys rodo, kad HDA19 moduliuoja šį signalą, sukeldamas priešingą langelio ilgį numuštoje ir 35S: HDA19 linijose. HDA19 gali arba paveikti padėties signalo generavimą, jo suvokimą, arba reguliuoti signalinius mazgus, kurie perduoda žievės pakreipimą link pasroviui taikomų genų. Silpnesnis signalas apibūdina ne tokį griežtą modelį, kai didesnė epidermio ląstelių patekimo į (numatytąjį) plaukų likimą tikimybė, todėl pastebimas negimdinių šaknų plaukų augimas 35S: HDA19 linijose, auginant žemoje Pi terpėje. Šį scenarijų patvirtina pastebėjimas, kad pažeidus padėties signalą, atskiriant epidermio ląstelių sluoksnį nuo žievės Brassicaceae, visos epidermio ląstelės pateko į plaukų ląstelių likimą 32 .

Etilenas yra svarbus šaknų plaukų morfogenezės ir ląstelių pailgėjimo moduliatorius 33, 34 . Etilenas daro įtaką plaukų šaknies inicijavimui paskui RHD6 ir netrukdo ankstyviesiems transkripcijos reguliatoriams, kurie diktuoja ląstelių likimą . 34, 35, 36 . HDA19 jau anksčiau buvo susijęs su etileno signalizavimu 37, ir galima manyti, kad HDA19 veikia etileno gamybą ar signalizaciją, o tai savo ruožtu keičia šaknų plaukų fenotipą linijose su pakitusia HDA19 išraiška. Nors mes negalime atmesti galimybės, kad HDA19 daro įtaką etileno signalizacijos būdu, mūsų rezultatai labiau atitinka pakitusį žievės signalo stiprumą. Etilenas sukelia ilgus šaknies plaukus, o tai nebuvo pastebėta 35S: HDA19 linijoje. Taip pat etilenas skatina negimdinių šaknų plaukelių susidarymą, kuris buvo stebimas tik tada, kai augalai buvo auginami žemoje Pi terpėje. Be to, su etilenu susiję genai, kurie, kaip anksčiau buvo nustatyta, buvo labiau sureguliuoti 35S lapuose: HDA19 linijų, tokių kaip ERF1 37, raiška nesiskyrė tarp 35S: HDA19 ir HDA19-RNAi šaknų, dar labiau ginčydamos prielaidą, kad HDA19 daugiausia veikia per etileno signalą ant šaknies fenotipo. Kartu duomenis lengviau paaiškinti keičiant stiprumą arba padėties signalo suvokimą transgeninėse linijose su pakitusia HDA19 išraiška.

Histonų modifikacijos gali sąveikauti, norėdamos reguliuoti atsakus į Pi badą

Anksčiau mes nustatėme, kad PHD piršto baltymas ALF6 priekiniame genetiniame ekrane yra kritinė priemonė šaknies plaukų pailgėjimui Pi trūkumo sąlygomis 18 . ALF6 yra bona fide histono skaitytuvas, prisijungiantis prie H3K4me3 38 . Be pažeisto šaknies plaukų pailgėjimo, „ alf6“ mutantai parodė pleiotropinį fenotipą, apimantį sumažėjusį antocianinų kaupimąsi ir pakitusią šaknies struktūrą, reaguojant į mažą Pi, o tai rodo, kad ALF6 yra aukščiau esantis kelių su Pi susijusių procesų reguliatorius. Įdomu tai, kad panašiai, kaip pastebėta augaluose su pakitusiu HDA19 gausumu, įvairūs genai, dalyvaujantys membranų lipidų atstatyme, buvo tarp numanomų ALF6 taikinių, rodančių glaudų ryšį tarp membranų lipidų atstatymo ir šaknų plaukų diferenciacijos. Tiek HDA19 , tiek ALF6 transkripcija nereaguoja į Pi badą, tai rodo, kad kai kurie pagrindiniai žaidėjai išvengia aptikimo transkripcijos ar proteomikos tyrimuose. Abu tyrimai taip pat rodo, kad esminis ląstelių Pi homeostazės reguliavimas vyksta histono lygiu. Pagunda spėlioti, kad histonų acetilinimas ir metilinimas sąveikauja, kad būtų galima kontroliuoti genų, turinčių įtakos fenotipiniam rodmeniui, transkripciją ir (arba) po transkripcijos apdorojimą. Visų pirma, buvo pranešta, kad H3K4 trimetilinimo HDA6 mutanto ašyje1-5 nebuvo, tai rodo, kad H3K4 metilinant 39 reikalingas HDA aktyvumas, ir tai patvirtina tokį scenarijų.

Geležies ir fosfato sąveika gali paveikti tarpląstelinį ryšį

Keletas įrodymų pagrindė geležies vaidmenį mažinant šaknų plaukų pailgėjimą, reaguojant į Pi badą. Paprastai augalai, turintys Pi trūkumą, kaupia geležies perteklių, nepaisant stipriai žemai reguliuojamų geležies įgijimo genų 13, 15 . Visų pirma, ribotas pirminių šaknų pailgėjimas, kai trūksta Pi trūkumo, neįvyksta, kai nėra geležies, ir tai leido manyti, kad šis atsakas pirmiausia neatspindi aklimatizuotis Pi trūkumui, o greičiau sukelia geležies toksiškumą 40 . Neseniai šį požiūrį nuginčijo pastebėjimas, kad numanoma feroksidazė LPR1 ir P5 tipo ATPazė PDR2 yra būtina, kad būtų galima atlikti meristemui būdingą geležies ir kalcio nusėdimą, kuris savo ruožtu reguliuoja simpatinę komunikaciją RAM ir pailgėjimo zonoje Pi metu. badavimas 41 . Keletas į geležį reaguojančių genų yra skirtingai reguliuojami tarp HDA19 numušimo ir perreguliavimo linijų, didesne išraiška HDA19-RNRi linijoje. Darant prielaidą, kad norint sureguliuoti signalus iš ląstelių į ląsteles augaluose, kuriuose trūksta ląstelių, reikalinga sudėtinga geležies pasisavinimo ir pernešimo kontrolė, atrodo tikėtina, kad pozicionalaus signalo, kontroliuojančio epidermio ląstelių likimą ir išilginį ląstelių ilgį, stiprumas augaluose keičiamas pakitęs HDA19 gausumas dėl subtilių geležies pasiskirstymo pokyčių. Augimas žemoje Pi terpėje gali dar labiau sumažinti signalą, taip padidindamas plaukų formavimo tikimybę N padėtyje.

Apibendrinant, mūsų duomenys išryškina naują nereaguojantį PSR moduliatorių, kuris kontroliuoja ląstelių ilgį ir, atitinkamai, šaknų plaukų tankį. Be to, HDA19 numušimo linijose sumažėja Pi trūkumo sukelta pagrindinių reguliavimo veiksnių, tokių kaip SPX srities turinčių transkripcijos faktorių SPX3 ir SPX1 , išraiška . Tikėtina, kad tokius pokyčius lemia histono PTM ir Pi reaguojančių veiksnių sąveika. Jie jungiasi su histonų rašytojais ir histonų skaitytojais, kurie kontroliuoja transkripciją ir tikslina ląstelių ilgį bei genų ekspresiją pagal Pi prieinamumą.

Metodai

Augalų augimo sąlygos

Arabidopsis thaliana (L.) Heynh. augalai buvo auginami auginimo kameroje kietintoje terpėje, kaip aprašė Estelle ir Somerville 42 . Prisijungimo Wassilewskija (Ws-2) ir Columbia (Col-0), HDA6-RNAi (CS24038), HDA9-RNAi (CS30879), turėjo 17 (SALK_090088) ir hda18 (SALK_006938) augalų sėklos buvo gautos iš Arabidopsis biologinio išteklių centro. (Ohajo valstijos universitetas). Augalai, kurie per daug ekspresuoja HDA19 , kontroliuojami 35S promotoriaus (35S: HDA19), HDA19 RNR augalų, hda19 mutantų ( hda19-1 ) ir HDA6-RNR augalų, buvo aprašyti anksčiau, 37, 43, 44 . Sėklos paviršiaus sterilizuojamos panardinant jas į 5% (v / v) NaOCl 5 min. Ir 70% etanolį 7 min., Po to keturis kartus nuplaunant steriliame vandenyje. Sėklos buvo dedamos į „Petri“ lėkšteles ir 1 dieną laikomos 4 ° C temperatūroje tamsoje, prieš tai plokštelės buvo perkeltos į auginimo kamerą ir auginamos 21 ° C temperatūroje nuolat apšviečiant (50 μmol m −2 s −1 ; Phillips TL lempos). ). Terpė buvo sukietinta naudojant 0, 4% gryno geltelio (Kelco), pH buvo sureguliuotas iki 5, 5. Žemos Pi sąlygos buvo gautos auginant augalus terpėse, turinčiose 2, 5 μM KH 2 PO 4, o kontrolinės terpės Pi koncentracija buvo 2, 5 mM KH 2 PO 4 . Mažesnė kalio koncentracija dėl sumažėjusios KH 2PO 4 koncentracijos buvo kompensuota pridedant KCl.

Mikro matricų analizė

Mikro matricų analizei buvo naudojamas Affymetrix geno lustas Arabidopsis ATH1 Genome Array. Bendras RNR mėginys buvo paruoštas, kaip aprašyta aukščiau. Visi RNR mėginiai buvo įvertinti naudojant Agilent Bioanalyzer 2100 (Agilent, Santa Clara, JAV). Papildoma RNR sintezė buvo atlikta naudojant „GeneChip“ vieno ciklo taikinių ženklinimo rinkinį (Affymetrix, Santa Clara, JAV). Hibridizacijos, plovimo, dažymo ir skenavimo procedūros buvo atliktos, kaip aprašyta „Affymetrix“ techniniame vadove.

Genų ekspresijos duomenys buvo importuoti tiesiai į „GeneSpring“ (11.5 versija, Agilent, Santa Clara, JAV). Programinė įranga buvo naudojama norint normalizuoti duomenis apie lustą iki 50 -osios procentilės, o kiekvieno geno - į kontrolinius mėginius. Genai, kurie buvo pažymėti kaip neturintys dviejų pakartojimų, nebuvo analizuojami. Benjamini ir Hochberg metodo P vertės (klaidingų atradimų dažnis; FDR) buvo apskaičiuotos „GeneSpring“. Transkriptai buvo apibrėžti kaip diferencijuotai išreikšti, kurie parodė delta signalo pokyčius, didesnius už viso duomenų rinkinio vidutinę išraiškos vertę, arba 2 kartus, kai P <0, 05.

Realaus laiko RT-PGR

Atliekant qRT-PGR, visa RNR buvo pašalinta iš šaknų, naudojant „RNeasy Plant Mini Kit“ („Qiagen“) ir DNazę, apdorotą „Turbo DNR-free Kit“ (Ambion), vadovaujantis gamintojo instrukcijomis. cDNR buvo susintetinta naudojant SuperScript III atvirkštinės transkripcijos rinkinius (Invitrogen), vadovaujantis gamintojo instrukcijomis. Realiojo laiko PGR buvo atlikta naudojant „Power SYBR Green PCR Master Mix“ („Applied Biosystems“) „Applied Biosystems 7500“ greito realaus laiko PGR sistemoje su gamintojo rekomenduojamomis programomis. Samples were normalized first to an endogenous reference ( AtTUA ) and then the relative target gene was determined by performing a comparative ΔΔCt. The following primers were used: TUA (At5g19770) fwd: GTGCTGAAGGTGGAGACGAT, rev: AACACGAAGACCGAACGAAT; SPX1 fwd: GAAGAGCACAATCGCTGCCTT, rev: TGGCTTCTTGCTCCAACAATG; SPX3 fwd: GCGCCGGTGGAATCTATTTT, rev: GCAACTCCTTGTGGTGGATGA; pri-miR399 fwd: TTACTGGGCGAATACTCCTATGG, rev: ATTTTACTTGCATATCTAGCCAATGC.

Measurement of root hair length and density

Confocal images with a scale bar of 100 μm at 10 X resolution were used for measuring the root hair length. A ZEISS DISCOVERY V.12 microscope equipped with an ocular scale bar was used for measuring root hair density at 2 to 6 mm from the tip of the primary root. Statistical significant deviations from the wild type were determined by Student's t -test. Micrographs were taken between 0 to 8 mm from the tips of primary roots.

For cross-sections, root samples were fixed, dehydrated and then embedded in Technovit 7100 (Heraeus Kulzer, Wehrheim) resin in gelatin capsules. Transverse sections (30 μm) were cut using a RM 2255 Leica microtome (Leica, Nussloch, Germany). Sections were dried and stained with toluidine blue (0.05%) on glass slides and examined using bright-field on an Imager Z1 microscope (Zeiss, Jena, Germany).

Confocal microscopy and cell length measurements

Plants were placed in 10 mg/ml propidium iodide solution (PI) for one minute and gently rinsed with water for two minutes. The root was removed and mounted in fresh water. The roots where then observed using a confocal laser scanning microscope (Zeiss LSM510 Meta). The peak excitation λ and emission λ for PI was 536 nm and 620 nm, respectively.

The cell length of trichoblasts and atrichoblasts was measured using ImageJ (//rsb.info.nih.gov/ij/). The position of each cell was calculated from the cumulative length of all cells between the cell and the quiescent center. The data sets were then smoothed and interpolated into 25-mm-spaced data points using a kernel-smoothing routine 45, which was performed using a Microsoft Excel macro that enable the average calculation between replicate roots.

Northern blot analizė

Total RNA was extracted from roots with TRIzol® Reagent (Invitrogen) and 10 μg of total RNA were loaded in each lane of a denaturing 17% polyacrylamide gel, size-separated by electrophoresis, and transferred to a nylon membrane. The following hybridizations were performed as described in Sunkar and Zhu 46 using 32 P-labeled probes complementary to miR399d.

ICP-OES analysis

Mineral nutrient analysis was determined by inductively coupled plasma optical emission spectrometry (ICP-OES) as described in Rodríguez-Celma et al. 29 Five plants were harvested per treatment and genotype.

Papildoma informacija

How to cite this article : Chen, C.-Y. et al. The histone deacetylase HDA19 controls root cell elongation and modulates a subset of phosphate starvation responses in Arabidopsis . Mokslas. Rep. 5, 15708; doi: 10.1038/srep15708 (2015).

Papildoma informacija

„Excel“ failai

  1. 1.

    Papildoma informacija

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.