Histono deacetilazės inhibitoriai ir hidroksiurėjos dariniai moduliuoja ląstelių ciklą ir kartu sukelia apoptozę onkogenas

Histono deacetilazės inhibitoriai ir hidroksiurėjos dariniai moduliuoja ląstelių ciklą ir kartu sukelia apoptozę onkogenas

Anonim

Anotacija

Atsparumas gydymui yra pagrindinė onkologijos ligų valdymo problema. Įrodyta, kad histono deacetilazės inhibitoriai (HDACi) moduliuoja ląstelių ciklą, sukelia apoptozę ir jautrina vėžio ląsteles kitiems chemoterapiniams vaistams. Mūsų tyrimas rodo, kad HDACi valproinės rūgšties (VPA) ir ribonukleotidų reduktazės inhibitoriaus hidroksiurėjos (HU) potencija stiprina vienas kito proapoptozinį poveikį kelioms vėžio ląstelių linijoms. Tai koreliuoja su nuo ciklino priklausomų kinazės inhibitorių (CDKI) p21 ir p27, kuriuos sukelia proteasoma arba kaspazė-3, HU sukeltu skilimu. Be to, mes nustatėme, kad VPA sukeltai apoptozei reikia aktyvuoti kaspazę-3. Pažymėtina, kad p21 ir p27 gali sukelti atsparumą VPA ir HU. Abu CDKI sąveikauja su kaspazės-3 ir konkuruoja su kitais kaspazės-3 substratais. Taigi p21 ir p27 gali prisidėti prie chemoterapijos, kaip apoptozės inhibitorių, atsparumo. Kadangi biologinis VPA ir HU poveikis gali būti pasiektas esant tokioms koncentracijoms, kurios naudojamos dabartiniuose gydymo protokoluose, kombinuotas šių junginių panaudojimas gali būti laikomas potencialia vėžio gydymo strategija.

Įvadas

Nors vėžio ligos valdymas labai pagerėjo, atsparumas terapijai, lemiantis naviko atsinaujinimą, vis dar trukdo gerinti ilgalaikį išgyvenamumą (La Porta, 2007). Todėl, norint sukurti naujas terapijos strategijas, labai svarbu suprasti atsparumo terapijai molekulinius pagrindus (Koon ir Atkins, 2007).

Vėžio ląstelėse ląstelių ciklą ir apoptozę reguliuojantys genai paprastai būna mutavę arba aberrantiškai išreiškiami (Hanahan ir Weinberg, 2000). Tokių genų ekspresiją lemia chromatino rekonstravimas ir histonų modifikacijos, tokios kaip acetilinimas. Fermentai, tarpusavyje kontroliuojantys histonų acetiliaciją, yra histonų acetiltransferazės ir histonų deacetilazės (HDAC; Kouzarides, 2000). Genus, sukeliančius diferenciaciją, ląstelių ciklo sustabdymą ir apoptozę, sukelia HDAC inhibitoriai (HDACi; Krämer ir kt., 2001), kurie šiuo metu yra tiriami klinikiniuose tyrimuose (Boyle ir kt., 2005; Bug ir kt., 2005; Kuendgen ir kt.). ., 2006).

Keliose ataskaitose aprašyta, kad HDACi sukelta apoptozės indukcija priklauso nuo panaikintų ląstelių ciklo kontrolės taškų (Finzer ir kt., 2001; Shin ir kt., 2003). Įdomu tai, kad nuo ciklino priklausomo kinazės inhibitoriaus (CDKI) p21 WAF / CIP1 (p21), sulaikančio ląsteles ląstelių ciklo G1 fazėje, sumažėjimas padidina HDACi sukeltą ląstelių mirtį (Rosato ir kt., 2003; Nguyen). et al., 2004). Tai galima paaiškinti tuo, kad p21 susilpnina kaspazę-3 (Suzuki ir kt., 1999, 2000), o tai ypač svarbu apoptozės indukcijai keliais chemoterapiniais vaistais. Su p21 susijęs CDKI p27 Kip1 (p27) taip pat reguliuoja ląstelių ciklą ir apoptozę (Blagosklonny, 2002), tačiau jo indėlis į HDACi suaktyvintus procesus vis dar nėra atskleistas (Klisovic et al., 2003; Maggio et al., 2004). ).

Be HDACi, daugybė kitų veiksnių sukelia ląstelių ciklo sustojimą. Pavyzdys yra ribonukleotidų reduktazės inhibitoriaus hidroksiurėjos (HU), kuris užstoja ląsteles S fazėje (Szekeres et al., 1997), sukelia apoptozę (Schrell ir kt., 1997a) ir padidina auglių jautrumą chemoterapiniams vaistams (Van den Berg ir Von Hoff, 1995). Kadangi HU yra stiprus proapopotinis priešvėžinis vaistas, mažai toksiškas in vivo , jis naudojamas kietų ir hematologinių navikų gydymui (Schrell ir kt., 1997b; Montefusco ir kt., 2001; Bug ir kt., 2005; Kuendgen ir kt.) al., 2006).

Nors HDACi ir HU yra perspektyvūs priešvėžiniai vaistai, kiekvienai iš jų atsparios naviko ląstelės egzistuoja (Harris, 1985; Krämer ir kt., 2006). Mes ištyrėme, kaip HDACi valproinė rūgštis (VPA; Göttlicher et al., 2001) ir HU veikia įvairias vėžio ląstelių linijas ir pastebėjome padidėjusį jautrumą šių vaistų deriniui. Mūsų rezultatai rodo, kad CDKI p21 ir p27 bei kaspazė-3 kritiškai nustato apoptozės indukciją VPA ir HU.

Rezultatai

HDACi ir HU sinergiškai sukelia apoptozę melanomos ląstelėse

Pradiniuose eksperimentuose kaip pavyzdį naudojome VPA jautrią melanomos ląstelių liniją SK-Mel-37. Gydymas HDACi VPA ir trichostatinu A (TSA), taip pat HU, sumažino SK-Mel-37 ląstelių gyvybingumą, matuojant MTT testu (1a pav.). Įdomu tai, kad pastebėję reikšmingą sumažėjusį ląstelių gyvybingumą, kartu vartoję HDACi ir HU. Šis poveikis pastebėtas kliniškai pasiekiamose VPA ir HU koncentracijose (Bug ir kt., 2005; Kuendgen ir kt., 2006).

Image

Hidroksiurėja (HU) sustiprina histono deacetilazės inhibitoriaus (HDACi) sukeltą apoptozę. a ) SK-Mel-37 ląstelių gyvybingumas buvo nustatytas MTT testu po valproinės rūgšties (VPA; V, 1, 5 mM) arba trichostatino A (TSA; T, 10 nM) ir HU (1, 5 mM) poveikio. atskirai arba kartu 24–72 valandas (Ctl, neapdorotos ląstelės). * P <0, 05; dvipusis t- testas. b ) kaspazės-3 aktyvacijos įvertinimas naudojant Western blot analizę ir kaspazės-3 aktyvumo matavimas kolorimetriniu tyrimu. SK-Mel-37 ląstelės buvo gydomos 24 valandas (Ctl, neapdorotos; V, 1, 5 mM VPA; HU, 1, 5 mM HU; fl, viso ilgio; plg. Suskaidytos formos p12 / p17 / p19). Ac-DEVD-pNR kaspazė-3 skaidoma į pNR, kuri matuojama OD 405 nm bangoje po 16 h tyrimo inkubacijos laiko. c ) PARP skilimas buvo tiriamas atliekant MZ-Mel-19 ląstelių lizatų, apdorotų 1, 5 mM VPA (V) arba 100 nM TSA (T) 24–48 valandas arba sujungus su 1, 5 mM HU, lizatų Western blot analizę. HU) 24 valandas (Ctl, neapdorotas).

Visas dydis

Gydant vaistais pastebėtas sumažėjęs SK-Mel-37 ląstelių gyvybingumas atsirado dėl apoptozės. Iš tiesų, mes nustatėme padidintą kaspazės-3, -8 ir -9 skilimą ir padidintą kaspazės-3 aktyvumą ląstelių, apdorotų VPA ir HU, lizatuose, palyginti su kontrolinėmis ląstelėmis arba ląstelėmis, apdorotomis tik vienu junginiu (1b paveikslas ir 1 pav. duomenys neparodyti). Šie rezultatai buvo patvirtinti atliekant nepriklausomus apoptozės tyrimus, tokius kaip kaspazės-3 substrato PARP skilimo nustatymas (1c paveikslas), apoptozinių branduolių skaičiavimas po Hoechst dažymo ir kaspazės sukelta EGFP inaktyvacija (papildomi A ir B paveikslai).

Pažymėtina, kad kelios vėžinių ląstelių linijos, vaizduojančios įvairius naviko vienetus, yra jautrios kombinuotam VPA / HU gydymui (papildomas C paveikslas ir papildoma lentelė).

HDACi ir HU moduliuoja p21 ir p27 išraišką

Apoptozės indukcija HDACi apima nereguliuojamus ląstelių ciklo tikrinimo taškus. Todėl mes ištyrėme, ar gydymas VPA ir HU sukėlė ląstelių ciklo pakitimus. Fluorescenciniu būdu aktyvuotų ląstelių rūšiuotojo (FACS) analizė parodė, kad VPA sulaikė SK-Mel-37 ląsteles G1 ir sumažino S ir G 2 / M populiacijas (2a paveikslas). HU daugiausia panaikino G 0 / G 1 populiaciją ir padidino ląstelių skaičių S fazėje. Palyginti su neapdorotomis ląstelėmis, abiejų agentų derinys sumažino ląstelių skaičių G1 ir G2 / M ir galimai sukėlė apoptozinį DNR skilimą (sub-G1 frakcija). Pan-kaspazės inhibitorius Z-VAD-FMK blokavo DNR suskaidymą, o tai rodo, kad VPA kartu su HU sukėlė nuo kaspazės priklausomą apoptozę.

Image

Hidroksiurėjos (HU) ir histono deacetilazės inhibitoriai (HDACi) keičia ląstelių ciklą ir mažina nuo ciklino priklausomą kinazės inhibitoriaus (CDKI) raišką. a ) Apoptozinis chromatino susiskaidymas ir ląstelių ciklo pokyčiai, kuriuos sukelia valproinė rūgštis (VPA; V, 1, 5 mM) ir HU (1, 5 mM), pridedami atskirai arba sujungti 24 valandas, buvo aptikti propidium jodido – FACS analize (Ctl, neapdorotas). . Jei nurodyta, buvo pridėta Z-VAD-FMK (Z-VAD, 20 μM ). ( b ) p21, p27 ir kaspazės-3 (plg. suskaidytos formos) raiškos buvo tiriamos atliekant SK-Mel-37 lizatų Western blot analizę. Ląstelės nebuvo apdorotos (Ctl) arba inkubuotos su 1, 5 mM VPA (V), 100 nM trichostatino A (TSA; T) ir (arba) 1, 5 mM HU 24 valandas. ( c ) 1, 5 mM VPA (V) ir (arba) 1, 5 mM HU, pridėtų 24 val., poveikis p21 ir p27 mRNR lygiams SK-Mel-37 ląstelėse buvo analizuotas atvirkštinės transkripcijos (RT) –PCR pagalba. ( d ) CDKI ekspresija SK-Mel-37 ir NW-Mel-450 melanomos ląstelėse buvo ištirta Western blot metodu (Ctl, neapdorotas; V, 1, 5 m M VPA; T, 100 n M TSA; 24 val.). ( e ) VPA (V, 1, 5 mM) ir HU (1, 5 mM) poveikis p21 ir p27 ekspresijai NW-Mel-450 ląstelėse buvo analizuojami atliekant Western blot analizę (apdorojimas 24 val .; Ctl, neapdorotas). ( f ) Proteasomos įtaka HU sukeltam p21 ir p27 sumažėjimui buvo analizuota Western blot metodu. NW-Mel-450 ląstelės buvo inkubuojamos 24 valandas su HU (1, 5 mM), MG-132 (1 μM ) arba paliktos neapdorotos (Ctl). ( g ) Z-VAD-FMK poveikis HU sukeltam p27 sumažėjimui buvo analizuotas Western blot metodu. NW-Mel-450 ląstelės buvo inkubuojamos 24 valandas vien su HU (1, 5 mM) arba su Z-VAD-FMK (Z-VAD, 20 μM ; Ctl, neapdorotos).

Visas dydis

Kadangi CDKI yra kritiniai ląstelių ciklo reguliatoriai, mes išbandėme, ar gydymas VPA / HU daro įtaką p21 ir p27 ekspresijai. Imunobloto analizė parodė, kad HDACi indukuoja abiejų baltymų kaupimąsi, tuo tarpu HU sumažina jų ekspresiją (2b paveikslas). Norėdami atskirti transkripcijos ir post-transkripcijos poveikį, pirmiausia ištyrėme p21 ir p27 mRNR lygius atvirkštinės transkripcijos (RT) –PCR (2c pav.). Nors p21 mRNR lygis buvo sukeltas naudojant VPA arba VPA / HU, vien HU neturėjo įtakos. Priešingai, pPA mRNR ekspresijai VPA neturėjo įtakos, tačiau ją sukėlė VPA / HU.

Šie duomenys rodo post-transkripcijos mechanizmus, neutralizuojančius padidėjusio p21 / p27 mRNR lygio virsmą padidinta baltymo ekspresija. Norėdami dar labiau išskaidyti šį mechanizmą, mes panaudojome NW-Mel-450 melanomos ląsteles, kurios išreiškia aukštą endogeninį abiejų CDKI lygį (2d pav.). Tai leido mums išanalizuoti HU poveikį to paties naviko tipo ląstelių linijose su skirtingais endogeniniais p21 ir p27 lygiais. Panašiai kaip SK-Mel-37 ląstelėse, P21 ir p27 baltymų kiekį NW-Mel-450 ląstelėse sumažino HU (2e pav.), Tai gali atsirasti dėl skaidymo kaspazėse arba proteasomos. Įdomu tai, kad proteasominis inhibitorius MG-132 užkirto kelią HU sukeltam p21 skilimui, tuo tarpu šis junginys sumažino p27 lygį ir padidino apoptozę (2f paveikslas ir duomenys nepateikti). Priešingai, Z-VAD-FMK neutralizavo HU sukeltą p27 skilimą (2g paveikslas) ir padidino p27 indukciją TSA (papildomas D paveikslas). Šie radiniai sutinka su aprašytu p27 suskaidymu kaspazės-3 būdu (Levkau ir kt., 1998), kuris skiriasi nuo proteasominio p27 skilimo G1 – S perėjimo metu (Pagano ir kt., 1995).

Mūsų duomenys rodo, kad HU neutralizuoja p21 ir p27 indukciją HDACi. Tai koreliuoja su padidėjusia apoptozė, rodančia, kad p21 ir p27 lygiai gali būti kritiški VPA / HU sukeltai apoptozei.

HU gali jautriai reaguoti į HDACi atsparias melanomos ląsteles į HDACi sukeltą apoptozę

Mūsų pastebėjimas, kad HU padidina HDACi jautrių SK-Mel-37 jautrumą VPA, paskatino mus gydyti HDACi atsparias NW-Mel-450 ląsteles (Krämer et al., 2006) VPA ir HU deriniu. FACS analizė parodė, kad gydymas nuo VPA / HU priklausomai nuo dozės sukėlė šių ląstelių apoptozę (3a pav.). Z-VAD-FMK sumažino apoptozinį DNR skaidymą ir PARP skilimą (3b pav.), Nurodydamas, kad tai yra kaspazės tarpininkaujantys procesai VPA / HU apdorotose NW-Mel-450 ląstelėse. Taigi HU jautrina HDACi atsparias ląsteles apoptozei ir tai koreliuoja su sumažėjusiais p21 ir p27 lygiais (2e paveikslas).

Image

Hidroksiurėja (HU) padidina histonų deacetilazės inhibitoriaus (HDACi) atsparias ląstelių linijas valproinės rūgšties (VPA) sukeltai apoptozei ir sumažina ciklino priklausomos kinazės inhibitoriaus (CDKI) ekspresiją. ( a ) NW-Mel-450 ląstelių, apdorotų VPA (V, 0, 75–1, 5 m M) ir HU (0, 5–1, 5 m M) 24 valandas, jautrumas buvo nustatytas propidium jodide – FACS analize. Parodyta apoptozinės sub-G1 frakcijos atsiradimas (Ctl, neapdorotas). ( b ) Z-VAD-FMK (Z, 20 μM ) blokuoja apoptozę, kuri buvo išmatuota kaip a punkte, ir Western blot metodu prieš PARP. NW-Mel-450 ląstelės 24 valandas buvo apdorotos VPA (1, 5 mM) ir HU (1, 5 mM) (Ctl, neapdorotos). ( c ) NW-Mel-450 ląstelės buvo apdorotos 24 valandas 1, 5 mM VPA ir (arba) 1, 5 mM HU (Ctl, neapdorotos). TRADD, kaspazė-8 (fl, viso ilgio; plg. Suskaidyta forma), HDAC2 ir tetraacetilinis histonas H4 (AcH4) buvo aptikti Western blot būdu.

Visas dydis

Be to, proapoptotinis baltymas TRADD, kuris skatina kaspazės-8 aktyvaciją, padidėjo VPA ir HU (3c paveikslas), o HDAC2 - faktorius, kuris buvo per daug ekspresuotas navikinėse ląstelėse (Krämer ir kt., 2003; Zhu ir kt., 2004). ), buvo sumažintas. Šis poveikis nepriklausė nuo histono hiperacetiliacijos, nes HU netgi sumažino histono acetiliacijos lygį (3c paveikslas).

Darome išvadą, kad HU dozė priklausomai nuo HDACi atsparių ląstelių jautrina VPA ir kad šis procesas apima keletą proapopotinių būdų.

p21 ir p27 gali surišti ir slopinti kaspazę-3

Ankstesnės ataskaitos ir mūsų duomenys rodo, kad p21 ir p27 gali suskaidyti kaspazė-3 ir kad p21 slopina prokaspazės-3 aktyvaciją (Levkau ir kt., 1998; Suzuki ir kt., 1999, 2000). Tokie procesai reikalauja fizinės šių baltymų sąveikos. NW-Mel-450 ląstelių lizatų frakcija superose-6 parodė, kad kaspazė-3 iš dalies kompromituoja su p21 ir p27 (4a paveikslas). Kolorektalinės RKO ląstelės, turinčios indukuojamą p21 arba p27 ekspresijos sistemą (RKO p21i arba RKO p27i ; Schmidt ir kt., 2000), leidžia analizuoti baltymų sąveiką esant skirtingiems p21 ar p27 kiekiams. Imuninio nusodinimo eksperimentai parodė stiprų CDKI – kaspazės-3 ryšio padidėjimą indukuojant p21 / p27, greičiausiai dėl padidėjusio CDKI lygio (4b paveikslas). P21 / p27 sąveika su kaspaze-3 taip pat buvo aptinkama NW-Mel-450 ląstelėse (duomenys nepateikti). Toliau mes ištyrėme p21, p27 ir kaspazės-3 lokalizaciją NW-Mel-450 ląstelėse netiesioginės imunofluorescencijos būdu, naudodami konfokalinę mikroskopiją. Sutikdami su mūsų biocheminiais duomenimis, mes pastebėjome reikšmingą p21 ir p27 kolokales su kaspaze-3 (papildomas paveikslas E).

Image

Kaspazės 3 ir ciklino priklausomi kinazės inhibitoriai (CDKI) sąveikauja fiziškai ir funkciškai. a ) „Superose-6“ kolonų frakcijų (7–24, 7: tuštumos) Western blot analizė, siekiant ištirti kompleksus, turinčius endogeninės kaspazės-3, p21 ir p27, neapdorotose NW-Mel-450 ląstelėse. Nurodomi frakcijų skaičiai (#) ir atitinkami molekuliniai svoriai (MW; kDa). ( b ) RKO ląstelės, turinčios muristerono A indukuojamų p21 ar p27 ekspresijos konstruktų, nebuvo apdorotos arba inkubuotos su muristeronu A (3 μM ) 24 valandas. Endogeninė kaspazė-3 buvo imunoprecipifuota su triušio polikloniniu antikūnu ir atliktas Western blot tyrimas, siekiant aptikti p21 ir p27 naudojant pelių monokloninius antikūnus. Reprodukcija patvirtino vienodą kaspazės-3 kritulį (prieš normalų triušio prieš imuninį serumą; įvestis: 12% medžiagos, panaudotos imunoprecipitacijai). ( c ) Buvo išanalizuotas rekombinantinio kaspazės-3 (p17-p12) 2 aktyvumas Ac-DEVD-pNR, esant in vitro išverstiems p21, p27, Gal arba Z-VAD-FMK (Z-VAD, 50 μM ). kolorimetriniu tyrimu nurodytais laiko momentais (8/12/24 val .; Gal baltymas, neigiama kontrolė; Z-VAD-FMK (Z-VAD, 50 μM ), teigiama kaspazės-3 slopinimo kontrolė). ( d ) Rekombinantinio p21 ir p27 (TNT) in vitro pašalinimas kaspazės-3 (p17-p12) 2 po 24 valandų buvo įvertintas Western blot metodu.

Visas dydis

Vėliau mes išanalizavome, ar CDKI taip pat veikia kaspazės-3 fermentinį aktyvumą. Esant in vitro išverstiems p21 arba p27, pastebėjome, kad rekombinantinė kaspazė-3 sumažina substrato Ac-DEVD-pNR skaidymą (4c paveikslas). Šis slopinimas galėtų būti įveiktas užsitęsus inkubacijai, tikriausiai dėl kasplazės-3 sukelto p21 ir p27 skaidymo (4d paveikslas).

Taigi p21 ir p27 ne tik sugeba surišti kaspazę-3 in vitro ir in vivo, bet vienodai slopina jos aktyvumą trans .

Kaspazės-3, p21 ir p27 vaidmenys VPA ir HU sąveikoje

Mes panaudojome RKO p21i ir RKO p27i ląsteles, kad išanalizuotume p21 ir p27 įtaką VPA / HU tarpininkaujamai apoptozei. RKO kontrolinėse ląstelėse VPA nesuaktyvino apoptozės (5a pav.), Bet sukėlė augimo sustojimą (duomenys nepateikti). FACS analizė atskleidė, kad, kaip ir NW-Mel-450 ląstelės, RKO, RKO p21i ir RKO p27i ląstelių gydymas HU padidino apoptozinę sub-G1 frakciją, kurią dar padidino VPA. Priešingai, apoptozė buvo dramatiškai sumažinta indukuojant p21 arba p27, pabrėžiant jų funkcinę reikšmę VPA / HU reguliuojant užprogramuotą ląstelių žūtį (5a pav.). In vitro kaspazės-3 tyrimai patvirtino, kad endogeninė kaspazė-3 buvo aktyvuota RKO, bet ne indukuotose RKO p21i / RKO p27i ląstelėse (5b paveikslas).

Image

P21 ir p27 ekspresija atvirkščiai koreliuoja su histono dezacetilazės inhibitoriaus (HDCAi) / hidroksiurėjos (HU) sukelta apoptozės ir kaspazės-3 indukcija. ( a ) Apoptozės indukcija RKO, RKO p21- ir RKO p27 indukuojamose ląstelėse (RKO; p21i; p27i) dėl valproinės rūgšties (VPA) ir HU gydymo 48 valandas (Ctl, neapdorotas; V, 1, 5 m M VPA; HU), 0, 5 mM) buvo analizuota propidium jodide –FACS analize. Jei nurodyta, muristeronas A (3 μM ) buvo suleistas iškart po VPA / HU. Muristerone A buvo pridėtas prie RKO ląstelių, siekiant kontroliuoti nespecifinį poveikį. ( b ) Kaspazės-3 aktyvumo analizė atlikus Ac-DEVD-pNR proteolizę po 16 val. buvo atlikta lizatais iš ląstelių, apdorotų kaip aprašyta a punkte. ( c ) Ciklinu priklausomų kinazės inhibitorių (CDKI) ekspresija ląstelėse, apdorotose taip, kaip aprašyta a punkte, buvo ištirta Western blot būdu (p27i / p21i, muristerono A sukelta p27 / p21 ekspresija). ( d ) MCF-7 ląstelės, stabiliai transfekuotos tuščiu vektoriu (MCF-7 pc3.1 ) arba viso ilgio kaspaze-3 (MCF-7 Casp3 ), buvo apdorotos 1, 5 mM VPA, 1, 5 mM HU arba abiem medžiagomis. 48 val. Apoptozės indukcija buvo tiriama atliekant propidium jodido fluorescenciniu būdu aktyvuotų ląstelių rūšiatorių (PI – FACS) analizę (sub-G1, apoptozinės ląstelės; Ctl, neapdorotos). ( e ) MCF-7 ląstelės buvo transfekuotos p21-EGFP. Ląstelės 24 valandas buvo apdorotos 1, 5 mM VPA, 1, 5 mM HU arba abiem. Pažymėti ir endogeniniai p21, p27 ir acetiliuoti histonai H3 / H4 (acetiliuotas histonas H3 (AcH3) / acetiliuotas histonas H4 (AcH4)) buvo aptikti Western blot (Ctl, neapdoroti) metodu. ( f ) MCF-7 pc3.1 arba MCF-7 Casp3 48 valandas buvo apdoroti 1, 5 mM VPA (Ctl, neapdoroti). Western blot buvo naudojamas aptikti p21, p27, kaspazės-3 (fl, viso ilgio; cf, suskaidyta forma) ir AcH4. ( g ) MCF-7 Casp3 ląstelės buvo transfekuotos mažomis trukdančiomis RNR (siRNR) prieš abi, p21 ir p27 (40 pmol) 2 dienas iš eilės. Po 48 valandų ląstelės 48 valandas veikiamos 1, 5 mM VPA. Western blot buvo naudojamas aptikti p21, p27, kaspazės-3 ir PARP (fl, viso ilgio; plg. Suskaidytą formą). h ) Baltymų, paveiktų VPA ir HU, schema.

Visas dydis

Kadangi HU sumažina p21 ir p27 (2b – g paveikslai), mes ištyrėme jų lygį VPA / HU gydomose, indukuotose RKO p21i ir RKO p27i ląstelėse. Priešingai nei endogeniniam p21 / p27, HU ir VPA nepaveikė abiejų baltymų, tikriausiai atspindėdami proteasomų ir kaspazių sistemos perkrovą ir slopinimą (5c paveikslas).

Norėdami tiesiogiai ištirti kaspazės-3 funkcinį įsitraukimą į VPA / HU tarpininkaujamą apoptozę, mes panaudojome kaspazės-3 neigiamas MCF-7 krūties vėžio ląsteles (MCF-7 pc3.1 ) (Jänicke et al., 1998) ir MCF- 7 ląstelės, ištirpintos kaspaze -3 (MCF-7 Casp3 ). Tuo tarpu MCF-7 pc3.1 ląstelės, diferencijuotos reaguodamos į VPA (duomenys nepateikti), ląstelių žūtį sukėlė MCF-7 Casp3 ląstelėse, apdorotose VPA arba VPA / HU (5d pav.). Šie rezultatai rodo, kad proapoptotiniam VPA poveikiui reikia kaspazės-3, ir iliustruoja HDACi tarpininkaujamą ląstelių jautrinimą HU.

Remiantis 2b – g paveikslais, endogeninis p21 ir ektopetiškai išreikštas p21-EGFP (kontroliuojamas HDACi jautraus CMV promotoriaus) buvo sukeltas VPA, ir to buvo išvengta sutapimo su HU (5e pav.). Priešingai, p27 tokiomis gydymo sąlygomis išliko stabilus, nebent kaspazė-3 vėl buvo įvesta (5f pav.). Šis rezultatas pabrėžia svarbiausią kaspazės-3 vaidmenį skaidydamasis p27.

Norint įvertinti, ar p21 ir p27 yra pagrindiniai VPA ir HU apoptozinės sąveikos taikiniai, abu CDKI RNAi buvo numušti MCF-7 Casp3 ląstelėse. Šis požiūris parodė, kad p21 ir p27 sumažėjimas skatino apoptozę reaguojant į VPA, kaip rodo padidėjęs kaspazės-3 ir PARP skilimas (5g paveikslas), padidėjęs kaspazės-3 aktyvumas in vitro ir sumažėjęs ląstelių gyvybingumas (papildomas F paveikslas).

Padarome išvadą, kad p21 ir p27 yra pagrindiniai apoptozės kelių reguliatoriai. Šių CDKI lygiai lemia, ar ląstelėmis, apdorotomis VPA ir HU, pasireiškia apoptozė.

Diskusija

Vėžys atsiranda dėl daugybės pagrindinių valdymo elementų, reguliuojančių ląstelių dauginimąsi ir apoptozę, defektų. Taigi vaistų, veikiančių skirtingus ląstelių taikinius, derinys buvo pripažintas kaip perspektyvi terapinė strategija. Mes išanalizavome VPA ir HU sąveiką ir čia pirmą kartą parodėme, kad jų kombinuotas taikymas adityviai arba sinergiškai sukėlė apoptozę įvairiose vėžio ląstelėse. Įdomu tai, kad ląstelės, atsparios vienam junginiui, netgi tapo jautrios pridedant kitą. Kitos analizės taip pat parodė padidėjusį HDACi ir S fazės toksinų derinį kartu (St Croix et al., 1996; Maggio et al., 2004). Šie duomenys patvirtina mūsų rezultatus ir rodo skirtingus šių vaistų veikimo būdus ir skirtingus tikslus.

Mes nustatėme, kad HDACi ir HU labai sutrikdė ląstelių ciklą ir ląstelių ciklo bei apoptozės reguliatorių išraišką (5h pav.). Tai, kad HU sumažino p21 ir p27 lygį, gali paaiškinti, kodėl ląstelių linijos, stipriai besikeičiančios šių CDKI bazinėje ekspresijoje, panašiai patyrė S fazės sustabdymą ir apoptozę inkubuodamos su HU. Be to, HDACi sukelta p21 ir p27 ekspresija buvo aiškiai per maža, kad būtų išvengta apoptozės (2a – d ir 3 paveikslai). Tik masinis p21 / p27 ekspresija užkirto kelią kaspazės-3 aktyvacijai ir apoptozės indukcijai VPA / HU (5a – c pav.). Tai gali būti dėl ląstelių ciklo arešto. Tačiau CDKI gali apsaugoti ląsteles nuo įvairių proapopotinių dirgiklių, pavyzdžiui, paklitakselio (Schmidt ir kt., 2000), etopozido (Eymin et al., 1999) ir proteasomų inhibitorių (Drexler ir Pebler, 2003). Taigi, anti-apoptotinis CDKI poveikis neapsiriboja vaistais, nukreiptais į S fazę. Panašiai ir skirtingai nuo HDACi jautrių MCF-7 Casp3 ląstelių, vien tik CDKI sumažinimas negalėjo paversti HDACi atsparių NW-Mel-450 ląstelių jautriu VPA (5g paveikslas, papildomas F paveikslas ir duomenys nepateikti). Tai rodo, kad norint sukelti apoptozę NW-Mel-450 ląstelėse, reikalingas papildomas HU poveikis, pavyzdžiui, kaspazės kaskados inicijavimas (3c paveikslas).

CDKI p21 ir p27 yra dinamiški baltymai, atliekantys skirtingas biologines funkcijas branduolyje ir citoplazmoje (Blagosklonny, 2002). Homeostazėje subalansuotas CDKI lygis riboja ląstelių augimą ir gali užkirsti kelią nepageidaujamam apoptozės programos vykdymui. Tačiau CDKI lygis vienodai koreliuoja su navikų cheminiu atsparumu ir bloga ligos prognoze (Pantazis ir kt., 1999; Mouriaux ir kt., 2000; Klisovic ir kt., 2003). Todėl kyla klausimas, kodėl p21 ir p27 silpnina proapoptozinius stimulus. Mes išanalizavome VPA ir HU sukeltų ląstelių žūties mechanizmą perdėtai ekspresuodami CDKI, mažų trukdančių RNR (siRNR) metodus, sąveikos tyrimus ir funkcinius tyrimus. Remdamiesi šiais duomenimis, siūlome p21 ir p27 susieti su kaspaze-3 priklausomai nuo dozės ir sumažinti apoptozės vykdymą. Savo ruožtu, sumažėjęs p21 ir p27 reguliavimas atpalaiduoja kaspazę-3 nuo šių CDKI slopinimo, o tai lemia sustiprintą apoptozės indukciją. Be to, p21 ir p27 gali gerai išjungti apoptozę alternatyviais būdais, pavyzdžiui, veikdami kaip kaspazės-3 substratai ir tokiu būdu nukreipdami kaspazę-3 nuo kitų „mirties substratų“ (4 ir 5 pav.).

Klinikiniai tyrimai jau pranešė, kad VPA iš dalies palengvino vėžio progresavimą ir pasiūlė didesnį veiksmingumą kartu su HU, palyginti su vienkartiniu vartojimu (Bug ir kt., 2005; Kuendgen ir kt., 2006). Nors vaistų derinimas klinikinėje aplinkoje reikalauja atsargumo ir kruopštaus stebėjimo, bendras VPA ir HU vartojimas gali turėti terapinę vertę, todėl jį reikėtų ištirti toliau.

medžiagos ir metodai

Ląstelių linijos ir transfekcijos

Ląstelės buvo auginamos, kaip aprašyta (Krämer ir kt., 2006). SiRNR prieš žmogaus p21 ir p27 buvo gauti iš „Santa Cruz Biotechnology“ (Heidelbergas, Vokietija) ir buvo pernešti lipofektaminu (Invitrogen, Karlsruhe, Vokietija) arba „FuGene“ (Roche, Manheimas, Vokietija), atsižvelgiant į dvi dienas iš eilės.

Western blot ir imunofluorescenciniai vaizdai

Surinktos plūduriuojančios ir prilipusios ląstelės. Lizatų preparatai, „Superose-6“ frakcionavimas, koimunoprecipitacijos ir Western blot buvo atlikti kaip Krämer ir kt. (2006). Antikūnai buvo iš „Santa Cruz Biotechnology“: kaspazė-3, „Tradd“, p21, p27, HDAC2 ir normalus triušio serumas (pre); Sigma (Miunchenas, Vokietija): aktinas; NEB (Frankfurtas, Vokietija): kaspazė-8 ir -9; Pharmingen (Heidelbergas, Vokietija): PARP; DAKO (Glostrup, Danija): pan-citokeratinas, acetilinis histonas H3 (AcH3) ir acetiliuotas histonas H4 (AcH4) (Göttlicher et al., 2001). Aktinas yra visų Vakarų dėmių krovos kontrolė. Imunofluorescencija, kiekybinis nustatymas, vaizdo analizė ir pateikimas buvo atlikti taip, kaip aprašyta Knauer ir kt. (2006). DNR buvo vizualizuota naudojant Hoechst 33258 arba TO-PRO-3 (Invitrogen).

Apoptozės, ląstelių ciklo ir gyvybingumo matavimas

MTT, propidium jodide (PI) -FACS analizės ir kaspazės-3 tyrimai buvo atlikti taip, kaip aprašyta Krämer ir kt. (2006). Kaspazės-3 aktyvumas buvo matuojamas kolorimetriniu tyrimu (Ac-DEVD-pNR kaspase-3 skaidoma į pNR, kuris buvo matuojamas esant OD 405 nm ) ir p21 ir p27 skaidymu in vitro . Reakcijos buvo atliktos iš viso 20 μl tūrio kaspazės-3 skilimo buferiu. Kai buvo nurodyta, į rekombinantinius kaspazės-3 subvienetus (p17-p12) 2, pagamintus E. coli (pateikė B. Dälken), 5 μl kviečių gemalų lizato, turinčio TNT išverstą p21 / p27 / Gal (Promega, Manheimas, Vokietija). ir W Wels (Frankfurtas, Vokietija)).

Plazmidės ir RT – PGR

NW-Mel-450 arba SK-Mel-37 cDNR tarnavo kaip šablonai. Pradmenys: p21-pirmyn: ATGTATCCATATGATGTTCCAGATTATGCTATGTCAGAACCGGCTGGGG; p21-atvirkštinis: CCCAAGCTTGGGCTTCCTCTTGGAGAAG; p27-pirmyn: ATGTATCCATATGATGTTCCAGATTATGCTATGTCAAACGTGCGAGTGTC; p27-atvirkštinis: CCCAAGCTTCGTTTGACGTCTTCTGAGGCC. PGR produktai buvo klonuoti į pc3.1-TOPO ir seka T7- / BGH pradmenimis (Invitrogen). Sekavimas patvirtino, kad p21 ir p27 buvo laukinio tipo NW-Mel-450 ir SK-Mel-37 ląstelėse. RNR buvo išskirtas su RNeasy (Qiagen, Hilden, Vokietija). cDNR buvo pagaminta pagal Amersham rekomendacijas (Miunchenas, Vokietija). RT – PGR buvo atlikti su Taq polimerazės rinkiniu (Qiagen). RT – PGR tiesiškumas buvo kontroliuojamas naudojant β- aktiną: pirmyn: ATGATATCGCCGCGCTCGTCGTC; atvirkščiai: TTCTCGCGGTTGGCCTTGGGGTTCAG ir buvo optimalus 20–25 ciklų metu.

Papildoma informacija

Vaizdo failai

  1. 1.

    Papildomas paveikslas

    Papildoma informacija pridedama prie dokumento „Oncogene“ svetainėje (//www.nature.com/onc).