Comamonas testosteroni nustatymas kaip androgenų skaidytojas nuotekose | mokslinės ataskaitos

Comamonas testosteroni nustatymas kaip androgenų skaidytojas nuotekose | mokslinės ataskaitos

Anonim

Dalykai

  • Metagenomika
  • Vandens mikrobiologija

Anotacija

Daugybė tyrimų pranešė apie maskuojančią gėlųjų vandenų laukinę gamtą, paveiktą androgenų užterštose upėse. Mikrobų skaidymas yra esminis mechanizmas pašalinant steroidinius hormonus iš užterštų ekosistemų. Aerobinis testosterono skilimas buvo stebimas įvairiuose bakterijų izoliatuose. Vis dėlto androgenus ardančių mikroorganizmų ekofiziologinė reikšmė aplinkoje nėra aiški. Čia mes ištyrėme biocheminius androgenų skilimo aerobinėse nuotekose mechanizmus ir atitinkamus mikroorganizmus. Nuotekų mėginiai, surinkti iš Dihua nuotekų valymo įrenginių (Taipėjus, Taivanas), buvo aerobiškai inkubuojami su testosteronu (1 mM). Androgenų metabolitų analizė atskleidė, kad bakterijos pasirenka 9, 10- seko kelią, kad suardytų testosteroną. Metagenominė analizė parodė akivaizdų Comamonas spp. (daugiausia C. testosteroni ) ir Pseudomonas spp. nuotekose, inkubuotose su testosteronu. Šiam būtinam kataboliniam genui nuotekose sekti mes panaudojome išsigimusius pradmenis, gautus iš įvairių proteobakterijų metakombinacijos dioksigenazės geno ( tesB ). Suaktyvintos sekos parodė didžiausią C. testosteroni (87–96%) panašumą į tesB . Naudodamiesi kiekybine PGR, mes aptikome nepaprastą 16S rRNR ir katabolinių genų C. testosteroni padidėjimą testosteronu apdorotose nuotekose. Kartu mūsų duomenys rodo, kad C. testosteroni , pavyzdinis mikroorganizmas aerobiniam testosterono skilimui, vaidina androgenų biologinį skaidymą aerobinėse nuotekose.

Įvadas

Natūralios arba antropogeninės kilmės steroidai yra visur, tokiose vietose kaip mėšlas, biosolidos, dirvožemis, nuosėdos, požeminis vanduo ir paviršinis vanduo 1, 2 . Šie junginiai paprastai būna nedidelėse koncentracijose (nuo ng L −1 iki μg L −1 ) paviršiniame vandenyje 3, 4, 5, 6, 7, 8, 9 . Vis dėlto steroidiniai hormonai sulaukė vis didesnio dėmesio dėl savo sugebėjimo veikti kaip endokrininę sistemą ardantys ir tokiu būdu neigiamai veikiantys laukinės gamtos fiziologiją ir elgesį, net esant pikomolinėms koncentracijoms 10, 11 . Išsamiai aprašyta, kad vandens stuburiniai gyvūnai, paveikti androgenų, yra 12, 13, 14 . Pavyzdžiui, moteriškų žuvų defeminizacija buvo pastebėta, kai laukinės riebalų minos buvo paveiktos galvijų pašaro nuotekomis 15 .

Išsivysčiusiose šalyse nuotekų valymo įrenginiai yra nepaprastai svarbūs pašalinant steroidus, kuriuos gamina žmonės ir gyvuliai 9, 16 . Testosterono skilimas dėl mikrobų aktyvumo buvo pastebėtas keliose aplinkos matricose, tokiose kaip dirvožemis 17, nuotekų valymo įrenginių 18 biosolidai, mėšlu apdorotas dirvožemis 19 ir upelių nuosėdos 20 . Daugybė tyrimų pranešė apie esminį bakterijų skilimo vaidmenį pašalinant šiuos endokrininę sistemą ardančias medžiagas iš aplinkos 21, 22, 23 . Aktobakterijos ir proteobakterijos, galinčios suardyti androgenus, buvo išskirtos ir apibūdintos 24, 25, 26, 27 . Pavyzdžiui, įvairios aktinobakterijos, įskaitant Rhodococcus spp., Gali naudoti androgenus kaip vienintelį anglies ir energijos šaltinį 26, 27 . Betaproteobakterijai - Comamonas testosteroni - buvo skirtas ypatingas dėmesys, o jos androgenų kataboliniai tarpiniai produktai ir genai buvo išsamiai ištirti 25 . C. testosteroni dažnai būna užterštoje aplinkoje 28 . C. testosteroni padermėse kaip vieninteliai anglies šaltiniai gali būti naudojami įvairūs angliavandeniliai, įskaitant steroidus (pvz., Androgenus ir tulžies rūgštis), monoaromatinius junginius, acetatą ir laktatą, kurie pasižymi atsparumu sunkiesiems metalams ir antibiotikams 29, 30, 31, 32 .

Kaip parodyta 1 pav., Laikoma, kad aterobinis testosterono skilimas C. testosteroni yra pradėtas dehidrogenavus 17β-hidroksilo grupę į androst-4-en-3, 17-dioną (AD), kuris vėliau virsta į androsta-1, 4-dien-3, 17-dioną (ADD). Sterano struktūros skilimas prasideda įvedant hidroksilo grupę steroido substrato C-9 C-9. Gautas tarpinis produktas yra labai nestabilus ir tuo pačiu metu skaidomas B žiedas ir kartu aromatizuojamas A žiedas, gaunant sekosteroidą, 3-hidroksi-9, 10- seco -androsta-1, 3, 5, (10) -trieną. -9, 17-dionas (3-HSA). Tolesnis pagrindinio žiedo sistemos skilimas vyksta hidroksilinant C-4 33, o tada A žiedas suskaidomas per TesB tarpinamą metavalymą. TestB suardytas mutantas neauga ant testosterono, tai rodo, kad dioksigenazės TesB yra būtina aerobiniam testosterono skilimui 34 . TesB genas yra įterptas į C. testosteroni genų klasterį, kurį sudaro 18 androgenų katabolinių genų 35 . Genų sankaupos yra plačiai paplitusios androgenus ardančiose proteobakterijose, įskaitant Burkholderia , Comamonas , Cupriavidus , Glaciecola , Hydrocarboniphaga , Marinobacterium , Novosphingobium , Pseudoalteromonas , Pseudomonas , Shewanella ir Sphingomonas 25, 36 genčių rūšis . Be gerai ištirto 9, 10- seko kelio, bakterijose buvo stebimi ir alternatyvūs androgenų kataboliniai keliai. Pvz., Aerobiniu būdu auginami Sterolibacterium denitrificans pasirenka nuo oksigenazės nepriklausomą būdą skaidyti steroidinius substratus37.

Image

Manoma, kad junginys skliausteliuose yra. Siūlomas parašo metabolitas yra pridėtas langelyje.

Visas dydis

Biocheminiai mechanizmai, kuriais grindžiamas aerobinis androgenų biologinis skaidymas, buvo tiriami grynose kultūrose 25, 33, 34, 38, 39 . Tačiau tyrimų dėl androgenų biologinio skilimo in situ katabolinių mechanizmų ir veiksnių nėra. Nežinoma, koks androgenų biologinio skaidymo kelias yra veiksmingas užterštose ekosistemose. Be to, dar reikia ištirti androgenus ardančių bakterijų pasiskirstymą ir gausą aplinkoje. Šiame tyrime mes ištyrėme mikrobų androgenų skilimą aerobinėse Dihua nuotekų valymo įrenginių (DHSTP) nuotekose, kurios valo buitines nuotekas, kurias gamina trys milijonai Taipei miesto Taivanyje. Mes panaudojome šiuos metodus: ( i ) androgenų metabolitų identifikavimas naudojant ultra-efektyvią skysčių chromatografiją - tandeminė masės spektrometrija (UPLC-MS / MS), ( ii ) androgenų skaidiklių filogenetinis identifikavimas naudojant „Illumina Miseq“ seką ir ( iii ) aptikimas. svarbiausio katabolinio geno tesB per PGR.

Rezultatai

UPLC-MS / MS nustatymas androgeninių metabolitų DHSTP nuotekose

Androgeniniai metabolitai buvo išgauti iš įvairių nuotekų valymo mėginių ir identifikuoti naudojant UPLC-atmosferos slėgio cheminę jonizaciją (APCI) -MS / MS (2 pav.). Originaliuose DHSTP nuotekose testosterono neaptikta (2A pav.). Be to, testosteronas nebuvo skaidomas inkubuojant su autoklavuotais nuotekomis (2 pav. B). Priešingai, per pirmąsias dvi aerobinio aktyviųjų nuotekų inkubavimo dienų testosteronas buvo paverstas 1-dehidrotestosteronu, AD ir ADD (2 pav. CCI). Po 72 valandų inkubacijos smarkiai sumažėjo androgenus atitinkančių smailių intensyvumas. Tada mes panaudojome ekstrahuotą jonų srovę, kai m / z 301, 18 (vyrauja 3-HSA jonų smailė), kad aptiktume 3-HSA, 9-ojo, 10- seko kelio metabolito, parašo metabolitą, aerobinėse nuotekose (2CIII pav.). Ekstrahuotojo jono UPLC sulaikymo laikas (5, 10 min .; 2CIII pav.) Ir MS / MS fragmentacijos spektras (2CIV pav.) Buvo panašūs į autentiško standarto.

Image

( A ) Bendros aktyviųjų nuotekų jonų chromatogramos, inkubuotos be testosterono. ( B ) Autoklavuotų nuotekų, inkubuotų su testosteronu, bendrosios jonų chromatogramos. ( C ) Aktyviosios nuotekos, inkubuotos su testosteronu. (CI) Bendros androgenų metabolitų jonų chromatogramos. (CII) Ekstrahuotos jonų chromatogramos, skirtos 2, 3-SAOA ( m / z = 305, 21; numatomas sulaikymo laikas 4, 87 min.) Testosteronu apdorotose nuotekose. (CIII) 3-HSA ( m / z = 301, 18) ekstrahuotos jonų chromatogramos testosteronu apdorotuose nuotekose. (CIV) MS / MS fragmentacijos spektrai autentiškame standarte (viršuje) ir 3-HSA, išgautuose iš testosteronu apdorotų nuotekų (apačioje). Santrumpos: ADD, androsta-1, 4-dien-3, 17-dionas; dT, 1-dehidrotestosteronas; 3-HSA, 3-hidroksi-9, 10- seco -androsta-1, 3, 5, (10) -trien-9, 17-diono; 2, 3-SAOA, 17-hidroksi-1-okso-2, 3- seco -androstan-3-obo rūgšties; T, testosteronas.

Visas dydis

Kai kuriose denitrifikuojančiose bakterijose 16, 38 buvo nustatytas alternatyvus būdas androgenų katabolizmui - steroidų 2, 3- seko kelias. Tarp jų buvo pranešta, kad bent jau Sterolibacterium denitrificans aerobiniu būdu skaido testosteroną per 2, 3- seko kelią 37 . Testosteronu apdorotuose denitrifikuojančiose nuotekose 16 buvo aptiktas žiediniu būdu suskaidytas tarpinis produktas - 17-hidroksi-1-okso-2, 3- seco -androstan-3-oiko rūgštis (2, 3-SAOA). Šiam junginiui aptikti mes panaudojome ekstrahuotą jonų srovę, kai m / z 305, 21 (vyrauja 2, 3-SAOA jonų smailė), o aerobinėse nuotekose, inkubuotose su testosteronu, atitinkamos smailės nebuvo (2CII pav.). Nuotekų valymai buvo atlikti dviem egzemplioriais. Abiejuose pakartojimuose buvo aptiktas 3-HSA, bet ne 2, 3-SAOA (2 pav. Ir S1).

Pradinių tarpinių junginių 9, 10- seko kelyje androgeninį aktyvumą nustatėme naudodamiesi lacZ pagrįstu mielių androgenų tyrimu. Rezultatai parodė, kad testosteronas, 1-dehidrotestosteronas, AD ir ADD pasižymi akivaizdžiu androgeniniu aktyvumu. Tačiau secosteroidas 3-HSA neturėjo aptinkamo androgeninio aktyvumo net esant 500 μM koncentracijai (3A pav.). Tada buvo nustatytas androgeninis etilo acetato ekstraktų iš nuotekų valymo mėginių aktyvumas (3B pav.). Nuotekų ekstraktų androgeninis aktyvumas laikui bėgant sumažėjo, o tai atitinka androgenų metabolitų analizės rezultatus.

Image

( A ) Mielių androgenų biologinių tyrimų rezultatai tarp atskirų tarpinių tarp 9, 10- seco kelio. Rezultatai gauti iš vieno atskirų trijų eksperimentų atstovo. ( B ) Androgeninės veiklos, susijusios su neigiama kontrole (testosteronu apdorotos autoklavuotos nuotekos), ir dviejų aerobinių DHSTP nuotekų gydymo laikas. Tirpiklio A 420 DMSO (1% v / v) buvo nustatytas į nulį. Duomenys parodomi kaip trijų eksperimentinių matavimų vidurkis ± SE.

Visas dydis

Filogenetinis androgenus ardančių bakterijų identifikavimas aerobinėse nuotekose

Iš įvairių nuotekų valymo mėginių buvo išgauta DNR. Bakterijų 16S rRNR geno hipervariantinis V3-V4 regionas buvo amplifikuotas PGR metodu, o gautos amplikonos buvo sekamos naudojant „Illumina MiSeq“ sekventorių (Illumina; San Diego, CA, JAV). Sekos buvo analizuojamos naudojant „BaseSpace 16S Metagenomics App V1.01“ (Iliumina; San Diego, CA, JAV) (4 pav.). Nukleotidų sekų duomenų rinkinys buvo deponuotas Nacionaliniame biotechnologijų informacijos centre (NCBI) Sektų skaitymo archyve (prisijungimo numeris: SRP062202). Iš kiekvieno mėginio buvo gauta vidutiniškai 306 025 rodmenys. Atskirų nuotekų valymo mėginių dublikatai parodė didelį bakterijų bendruomenės struktūros panašumą (S2 pav.). Išskyrus neklasifikuotus ir kitus (atskiros genties, kurios santykinis procentas <1%) mikroorganizmų, DHSTP nuotekose buvo nustatytos 35 gentys, tarp kurių visuose nuotekų valymo mėginiuose buvo Lewinella , kurios santykinis kiekis nuo 4% iki 13%., nepriklausomai nuo inkubacijos sąlygų (4A pav.). Be to, mes nepastebėjome jokio akivaizdaus Lewinella spp. testosterono inkubuotose nuotekose.

Image

( A ) Lewinella dažniausiai buvo nustatoma atliekant bet kokius nuotekų valymus . ( B ) Pseudomonas buvo šiek tiek praturtintas testosteronu paveiktose aerobinėse nuotekose. ( C ) „ Comamonas“ buvo labai praturtintas testosteronu apdorotose aerobinėse nuotekose. Lentelių diagrama parodo santykinį atskirų Comamonas spp. (100%) nuotekose, inkubuotose su testosteronu 48 valandas. Norėdami gauti išsamesnės informacijos, žiūrėkite papildomą S2 pav.

Visas dydis

Pseudomonas genties nariai buvo šiek tiek praturtinti testosteronu apdorotomis aerobinėmis nuotekomis (4B pav.). Pakartotiniame tyrime santykinis Pseudomonas spp. po 96 valandų inkubacijos pasiekė 6%. Bakterijų bendruomenės analizė parodė, kad labiausiai praturtintos rūšys yra Pseudomonas entomophila ir P. panipatensis (S3 pav.). Pseudomonas spp. nebuvo praturtinti aerobinėmis nuotekomis, inkubuotomis be testosterono (4 pav. B), kas rodo, kad Pseudomonas spp. gali turėti įtakos aerobiniam androgenų skaidymui.

Comamonas spp. buvo praturtintos testosteronu apdorotomis aerobinėmis nuotekomis per pirmąsias dvi dienas, o jų santykinis gausumas sudarė apie 20% visos bakterijų bendruomenės (4 pav. C). Tolesnė filogenetinė analizė parodė, kad po 48 valandų inkubacijos su testosteronu, dauguma gautų sekų buvo susijusios su C. testosteroni (43% Comamonas gentyje) ir C. composti (23%) (4C pav.). Santykinis Comamonas spp. bakterijų bendruomenėje po to su laiku sumažėjo ir po 240 inkubacijos valandų jų nebuvo galima aptikti. Comamonas spp. nebuvo praturtinti aerobinėmis nuotekomis, inkubuotomis be testosterono (4 pav. C). Šie rezultatai leidžia manyti, kad Comamonas spp. yra aktyvūs testosterono valymo kanalizacijos kataboliniai žaidėjai. Comamonas spp. ir Pseudomonas spp. buvo stebimi eksperimentiniuose pakartojimuose (S4 pav.). Po 48 valandų aerobinio inkubavimo santykinė Comamonas spp. ir Pseudomonas spp. testosteronu valytose nuotekose pasiekė atitinkamai 29% ir 2%.

TestB tipo genų PGR amplifikacija aerobinėse nuotekose

Katabolinis genas ( tesB ), koduojantis C. testosteroni 3, 4, 4-dihidroksi-9, 10- seco -androsta-1, 3, 5 (10) -trien-9, 17-diono (3, 4-DHSA) dioksigenazę. TA441 buvo naudojamas kaip užklausa išnaikinti UniProtKB / TrEMBL, o BLASTp įvykių pasirinkimas iš duomenų bazės parodytas 1 lentelėje. Labiausiai panašios sekos priklausė betaproteobakterijoms ir gamaproteobakterijoms. Žinomose steroidus ardančiose proteobakterijose į tesB panašūs genai yra saugomi konservuotame testosterono skilimo genų klasteryje 25 . Filogenetinė analizė (S5 pav.) Atskleidė, kad proteobakterijų 3, 4-DHSA dioksigenazės yra linkusios kauptis ir, matyt, skiriasi nuo aktinobakterijų genčių Gordonia, Mycobacterium , Nocardia ir Rhodococcus , kurios gali skaidyti steroidus per 9, 10- seco. kelias 37, 40, 41 .

Pilno dydžio lentelė

Degeneravusių pradmenų specifiškumas buvo nustatytas naudojant genominę DNR, išskirtą iš kelių bakterijų kaip šablonus. PGR produktai (maždaug 700 bp) buvo amplifikuoti iš griežtai aerobinio C. testosteroni, bet ne iš denitrifikuojančio Sterolibacterium denitrificans (5 pav. A). Jokie PGR produktai negalėjo būti sustiprinti iš steroidus ardančių aktinobakterijų (5A pav.). Tai gali būti dėl mažo 3, 4-DHSA dioksigenazių sekos panašumo tarp aktinobakterijų ir proteobakterijų (S5 pav.).

Image

( A ) Agarozės gelio elektroforezė atskleidė, kad proteobakterijoms būdingas tesB geno zondas gali būti naudojamas atitinkamiems androgenus ardančių aerobų, tokių kaip C. testosteroni, genams amplifikuoti. ( B ) „ tesB“ tipo PGR produktų padaugėjo tik testosteronu apdorotuose aerobinėse nuotekose. Agarozės gelio vaizdai, parodyti 5A, B pav., Buvo apkarpyti, kad būtų rodomi tik atitinkami duomenys. Viso ilgio geliai yra S10 pav. ( C ) „ TestB“ genų, gautų iš aerobinių nuotekų, filogenetinis medis, inkubuotas su testosteronu 48 valandas. „ TesB“ sekų, sustiprintų iš aerobinių nuotekų, žr. S6 pav. Geno, koduojančio 3, 4-DHSA dioksigenazę iš M. tuberculosis ATCC 25618, seka tarnavo kaip pogrupio seka.

Visas dydis

Kai kaip šablonas buvo panaudota iš testosterono valytų nuotekų išskirta DNR, tesB sekų kiekio pokyčiai (5 pav. B) atitiko laikinus Comamonas gausos aerobinėse nuotekose pokyčius (4 pav. C). Iš DNR, išskirto iš nuotekų, inkubuotų be testosterono, nebuvo galima amplifikuoti jokių PGR produktų. PGR produktai, amplifikuoti iš aerobinių nuotekų (48 valandos inkubacijos su testosteronu), buvo klonuoti Escherichia coli ir 20 klonų buvo atrinkti atsitiktine tvarka sekvenavimui. Visi gauti DNR fragmentai (S6 pav., Nukleotidų sekos) parodė didžiausią panašumą (87–96%) su C. testosteroni tesB genu (5 pav. C ). Patobulintos „tesB“ sekos, gautos iš kito testosteronu apdoroto nuotekų pakartojimo, taip pat buvo labai panašios į C. testosteroni (S7 pav.; Atskirų „ tesB“ sekų žr. S8 pav.).

Kiekybinis PGR patvirtino pastebimą 16S rRNR ir katabolinių genų C. testosteroni padidėjimą testosteronu apdorotose nuotekose

Metagenominė analizė (4 pav.) Ir PGR pagrįstas funkcinis tyrimas (5 pav.) Negalėjo patikimai patvirtinti C. testosteroni populiacijos padidėjimo testosteronu apdorotuose nuotekose. Todėl mes atlikome kiekybinį PGR tyrimą, norėdami ištirti laikinus C. testosteroni 16S rRNR ir tesB genų pokyčius skirtinguose nuotekų valymo įrenginiuose. C. testosteroni genų gausa kiekviename mėginyje buvo normalizuota pagal bendrą eubakterijų 16S rRNR geną. Atskirų nuotekų valymo mėginių kopijos buvo labai panašios, o akivaizdus C. testosteroni genų padidėjimas buvo pastebėtas tik testosteronu valytose nuotekose (6 pav.). Realaus laiko kiekybiniai PGR rezultatai atitiko įprastų PGR tyrimų rezultatus. Santykinis C. testosteroni 16S rRNR ir tesB genų gausumas padidėjo po 48 valandų inkubacijos ir po to sumažėjo. Po 48 valandų aerobinio inkubavimo, 16S rRNR (6A pav.) Ir tesB genų (6B pav.) Gausumas dublikatus pasiekė atitinkamai 18, 3–23, 5% ir 0, 9–1, 0 %.

Image

Realaus laiko kiekybinis PGR parodė C. testosteroni 16S rRNR ( A ) ir tesB ( B ) genų kopijų laikinius pokyčius testosteronu apdorotose nuotekose. Santykinis atskirų C. testosteroni genų kiekis buvo apskaičiuotas kaip viso bakterinio 16S rRNR geno kopijų skaičiaus santykis. Nuotekų valymas buvo atliekamas dviem egzemplioriais, o pilkos (1 pakartojimas) ir juodos (2 pakartojimas) linijos žymi skirtingas kopijas. Duomenys parodomi kaip trijų eksperimentinių matavimų vidurkis ± SE. Pradinių porų CteA2, TesBq ir Eub buvo naudojamos atitinkamai amplifikuoti C. testosteroni 16S rRNR ir tesB genus, taip pat bendrą eubakterijų populiaciją. Realaus laiko kiekybinės PGR standartinės kreivės, gautos naudojant tris pradmenų poras, parodytos S11 pav.

Visas dydis

Diskusija

Daugelyje išsivysčiusių šalių miestų nuotekoms valyti naudojami aktyvuoto dumblo procesai. Pagrindinis aktyvaus dumblo procesas apima mikrobų bendruomenės naudojimą organiniams angliavandeniliams mineralizuoti ir amoniakui oksiduoti (nitrifikuojant) aerobinėmis sąlygomis. Mikrobų bendruomenės vaidina lemiamą vaidmenį atliekant bioprocesus, tokius kaip nuotekų valymas ir dirvožemio valymas 42, 43 . Tačiau norint išnaudoti mikrobų išteklius reikia suprasti ne tik jų filogeniją, bet ir metabolines funkcijas bei ekologinius vaidmenis. Steroidiniai hormonai buvo pripažinti pagrindine endokrininę sistemą ardančių cheminių medžiagų grupe, o nuotekų valymo įrenginiai vaidina lemiamą vaidmenį pašalinant šiuos labai bioaktyvius junginius 9, 16 . Šiame tyrime, norėdami ištirti pagrindinius biocheminius mechanizmus ir mikroorganizmus, susijusius su androgenų skaidymu aerobinėse nuotekose, taikėme įvairius nuo izotopų nepriklausomus metodus, įskaitant UPLC-MS / MS pagrįstą parazito metabolitų aptikimą, bendruomenės struktūros analizę ir PGR. pagrįsti funkciniai tyrimai.

9, 10- seko kelias buvo įrodytas proteobakterijose 25 ir aktinobakterijose 27, 36 . Mes priskyrėme 3-HSA kaip šio aerobinio skilimo kelio metabolitą, nes ( i ) 3-HSA neturi sterano struktūros ir pasižymi ypač silpnu androgenų aktyvumu. Taigi 3-HSA aptikimas rodo androgenų biologinį skaidymą tiriamose ekosistemose. ( ii ) Palyginti su kitais sekosteroidais šiame aerobiniame kelyje, 3-HSA dažnai kaupiasi androgenus ardančiose bakterijų kultūrose 33, 38, 44 ir gali būti aptinkama naudojant UPLC-MS / MS. Skirtingai nuo sterano turinčių androgenų (pvz., Testosterono, 1-dehidrotestosterono, AD ir ADD), androgenų metabolitas 3-HSA negali būti lengvai jonizuotas per APCI. Todėl šiam secosteroidui aptikti mes naudojome ekstrahuotų jonų srovės metodą. Testosteronu apdorotose aerobinėse nuotekose androgeno aktyvumas laikui bėgant pastebimai sumažėjo. Tačiau autoklavizuotose nuotekose androgenų aktyvumas nesumažėjo, tai rodo, kad testosterono skilimas nuotekose vyksta vien dėl mikrobų aktyvumo. Per pirmąsias dvi dienas mes nustatėme įprastus androgenų metabolitus, įskaitant 1-dehidrotestosteroną, AD ir ADD. Apie testosterono biotransformaciją į šiuos androgenus buvo plačiai pranešta natūraliose ir inžinerinėse ekosistemose, tokiose kaip dirvožemiai 17, 19, nuotekų valymo įrenginiai 18 ir upių nuosėdos 20 . Be to, mikroorganizmuose, įskaitant bakterijas 45, mieles ir grybelius 46, buvo nustatyti atitinkami redokso fermentai. Nors aptiktus androgenų metabolitus, būtent 1-dehidrotestosteroną, AD ir ADD, daugiausia gali gaminti bakterijos, mūsų duomenys neatmeta eukariotinių mikroorganizmų vaidmens redokso biotransformacijos reakcijose.

Nustatyto metabolito UPLC sulaikymo laikas ir MS / MS suskaidymo spektras yra panašūs į autentiško standarto spektrą, o tai rodo, kad 3-HSA susidaro aerobinėse nuotekose, inkubuotose su testosteronu tris dienas. Aplinkosaugos mėginiuose retai aptinkama 3-HSA, pagrindinio tarpinio 9, 10- seko kelio 25, 47 . Yang ir kt . 24 pranešta apie šio secosteroido aptikimą bakterijų kultūrose, praturtintose kiaulių mėšlu. Aerobiniu būdu išaugintame Sterolibacterium denitrificans 37 yra pasirinktas alternatyvus steroidų katabolinis būdas - 2, 3- seko kelias, o pradiniai metabolitai šiame alternatyviame darinyje yra ir 1-dehidrotestosteronas, AD, ADD. Tačiau aerobinio nuotekų valymo mėginiuose mes neaptikome reprezentatyvaus androgeno metabolito 2, 3-SAOA. Rezultatai rodo, kad 9, 10- seko kelias veikia aerobiniame androgenų biologiniame skaidyme nuotekose.

9, 10- seko kelias aprašytas tik bakterijose 25, 36 . Taigi mes ištyrėme bakterijų bendruomenės pokyčius įvairiuose aerobinio nuotekų valymo mėginiuose. Testosteronu valytose nuotekose 3-HSA atsiradimas ir androgeninio aktyvumo sumažėjimas buvo kartu su baltymų praturtėjimu bakterijų bendruomenėje. Nors įvairioms bakterijoms, įskaitant 25 proteobakterijas ir aktinobakterijas 37, 48, paprastai nustatomas nuo 3, 4-DHSA dioksigenazės priklausomas 9, 10- seko kelias, mūsų „Illumina MiSeq“ duomenys rodo, kad proteobakterijos, įskaitant Comamonas ir Pseudomonas , yra androgenų skaidytojai. aerobinėse DHSTP nuotekose. Nė viename iš aktinobakterijų genų pradiniuose aerobinių nuotekų mėginiuose, surinktuose iš DHSTP, nebuvo santykinai daugiau kaip 1%. Be to, mes nepastebėjome, kad testosteronu valytose nuotekose būtų praturtintas aktinobakterijomis. Neseniai atliktame tyrime, kuriame buvo analizuotos 13 Danijos nuotekų valymo įrenginių mikrobų bendruomenės, taip pat buvo nustatyta, kad vyrauja betaproteobakterijos, o aktinobakterijų narių santykinis gausumas yra labai mažas 49 . Aerobinėse DHSTP nuotekose daugiausia bakterijų, priklausančių Saprospiraceae (daugiausia Lewinella spp.); tačiau jų gausa, matyt, nepadidėjo testosteronu valytų nuotekų. Mūsų žiniomis, Lewinella spp. nebuvo identifikuoti kaip steroidų skaidytojai. Nepaisant to, remiantis dabartiniais duomenimis negalima atmesti galimybės, kad Lewinella spp. ir aktinobakterijų rūšys tiesiogiai ar netiesiogiai vaidina androgenų skilimą aerobinėse nuotekose. Taip yra todėl, kad ( i ) androgenų katabolizmas nebūtinai reiškia, kad praturtėja skilėjų populiacijos, ypač trumpalaikis inkubavimas; ir ( ii ) aerobinėse nuotekose degradatorių populiacijos padidėjimą galėtų neutralizuoti pašalinimo procesai, tokie kaip grobis ir virusų lizė.

„Illumina Miseq“ atlikta 16S rRNR genų, praturtintų testosteronu apdorotuose nuotekose, analizė parodė, kad Pseudomonas spp. (greičiausiai P. entomophila ir P. panipatensis ) vaidina svarbų vaidmenį aerobiniame androgenų skilime . Šios dvi Pseudomonas rūšys nebuvo apibūdintos kaip testosteroną naudojančios bakterijos. Be to, dauguma steroidų katabolinių genų, įskaitant tesB geną, nebuvo rasti šių dviejų Pseudomonas rūšių 36, 50, genomuose . Mūsų tesB geno zondas buvo gautas iš kelių steroidus ardančių proteobakterijų, įskaitant P. putida . Tačiau 40 sekos surinktų tesB fragmentų neturėjo didelio panašumo su jokiomis Pseudomonas rūšimis. Verta paminėti, kad tesB sekos buvo amplifikuotos iš nuotekų, inkubuotų dvi dienas, kuriose bakterijų bendruomenėje vyravo Comamonas spp., Bet ne Pseudomonas spp. Atitinkamai, Pseudomonas spp. gali būti dėl netiesioginio dalyvavimo bioprocese (pvz., maitinimasis metabolitais, kuriuos išskiria androgenų skaidytojai). Nepaisant to, būtina ištirti aerobinėmis nuotekomis praturtintų Pseudomonas rūšių androgenų skilimo galimybes.

Iliumina Miseq analizė atskleidė akivaizdų Comamonas spp. (greičiausiai C. testosteroni ir C. composti ) nuotekose, kuriose yra testosterono. Tai atitinka pastebėtą C. testosteroni tesB geno gausos padidėjimą po 48 valandų inkubacijos su testosteronu. Tačiau kiekybinio PGR rezultatas atskleidė daug mažesnį tesB geno santykinį gausumą, palyginti su C. testosteroni 16S rRNR genu. Mažesnis C. testosteroni tesB geno kiekis testosteronu apdorotuose nuotekose gali būti dėl ( i ) daugybinių 16S rRNR geno kopijų bakterijų chromosomoje ir ( ii ) didesnės į tesB panašios sekos įvairovės ( 87 ~ 96%), palyginti su 16S rRNR geno (> 98%).

Comamonas spp. buvo taip pat praturtintas testosterono pakeistu kiaulių mėšlu 24 . Taigi Comamonas rūšys gali atlikti svarbų vaidmenį aerobiniame androgenų skaidymeisi aplinkoje, pavyzdžiui, nuotekų ir žemės ūkio dirvožemiuose, apdorotuose mėšlu. „Comamonas“ genties nariai priklauso betaproteobakterijoms, pasižyminčioms įvairialypėmis medžiagų apykaitos galimybėmis ir turinčiomis platų substrato panaudojimo spektrą. Iki šiol Comamonas gentis apima 11 patvirtintų rūšių: C. aquatica , C. badia , C. composti , C. denitrificans , C. kerstersii , C. koreensis , C. nitrativorans , C. odontotermitis , C. terrigena , C. testosteroni ir C. tiooxidans 51, 52 . Šios rūšys pasižymi labai skirtingomis fiziologinėmis ir metabolinėmis galimybėmis. Pavyzdžiui, C. thiooxidans gali augti anoksinėmis sąlygomis, o kitos rūšys yra griežtai aerobai 51 . Tarp jų tik C. testosteroni, kaip vienintelis anglies šaltinis, vartojo steroidus 53 . Lyginamoji genomo analizė taip pat parodė, kad steroidų kataboliniai genai yra tik C. testosteroni padermėse, bet ne kitose Comamonas rūšyse 36 . Šiame tyrime, nors aerobinio inkubavimo su testosteronu metu C. composti buvo priskirtas kaip praturtinta rūšis, mūsų metabolitų analizė parodė, kad šios rūšys negali skaidyti androgenų (S9 pav.). Be to, neradome į tesB panašaus geno C. composti juodraščio genome (prisijungimas: NZ_AUCQ00000000). Liu ir kt . 52 buvo palyginti 14 C. testosteroni padermių genomai, o steroidų kataboliniai genai buvo rasti visuose genomuose. Atsižvelgiant į tai, kad androgenai natūralioje aplinkoje paprastai būna mažoje koncentracijoje (ng L −1 – μg L − 1 ), neprotinga, kad C. testosteroni padermės turi neįprastą metabolinį sugebėjimą naudoti retus ir struktūriškai sudėtingus anglies šaltinius, tokius kaip testosteronas. . Ši bakterija taip pat gali augti dėl tulžies rūgščių 32, kurių aplinkoje dažnai būna daug. Taigi galima manyti, kad tulžies rūgštys gali būti naudojami kaip C. testosteroni steroidų katabolinių fermentų taikiniai.

C. testosteroni yra plačiausiai ištirtas mikroorganizmas aerobiniam androgenų skaidymui25. Čia pirmą kartą pateikiame tvirtų įrodymų, patvirtinančių, kad C. testosteroni vaidina tam tikrą vaidmenį pašalinant androgenus iš aplinkos. Atsižvelgiant į tai, kad steroidinių hormonų skaidymasis anaerobinėje aplinkoje paprastai vyksta lėtai 54, aeracija ir aerobinių skilėjų įvedimas galėtų būti veiksmingos biologinio valymo galimybės. Nors C. testosteroni nėra dominuojanti rūšis (santykinis pradinio nuotekų bakterijų skaičiaus santykinis gausa 0, 4%) DHSTP nuotekose, kuriose androgeno koncentracija paprastai yra maždaug 35 nM 16, šios bakterijos gali veiksmingai reaguoti į androgenų įėjimo pokyčius (1 mM). šiame tyrime), teigdamas, kad C. testosteroni galėtų būti naudojamas biologiškai reabilituoti steroidais užterštas ekosistemas.

Didelio pralaidumo 16S rRNR geno seka leido giliau suprasti bakterijų įvairovę sudėtiniuose aplinkos mėginiuose; tačiau šis metodas taip pat sukelia dviprasmiškumą dėl ribotų trumpųjų tekstų taksonominių galimybių (šiame tyrime 450 bp). Be to, taksonominės užduotys yra nevienodos skirtingiems klasifikavimo metodams 55 . Testosteronu valytose nuotekose nustatėme keletą „ Comamonas“ rūšių. Tačiau C. composti neparodė androgenų skilimo galimybių. Neseniai atliktas genominis tyrimas taip pat parodė, kad steroidų skilimo keliai pasiskirsto tarp proteobakterijų taksonų paprastai nevienodai ir atrodo, kad tik keli genomai iš kiekvienos proteobakterijų genties užkoduoja steroidų katabolinius genus 36 . Taigi, mūsų rezultatai rodo, kad vien taksonominis bakterijų priskyrimas, pagrįstas vien 16S rRNR genų didelio pralaidumo seka, yra nepakankamas biologinio skilimo įvykiams apibūdinti. Šiame tyrime pasiūlyta 16S rDNR pagrįsta filogenetinė analizė, parašo metabolitų zondavimas ir PGR pagrįstas funkcinis nustatymas gali suteikti informacijos tiek apie biocheminius mechanizmus, tiek apie aktyvius bakterijų skilimo dalyvius. Būsimi tyrimai turėtų apimti C. testosteroni panaudoto substrato kinetinę analizę ir bakterinių ląstelių imobilizavimą, siekiant pagerinti androgenų pašalinimo nuotekų valymo įrenginiuose efektyvumą. Be to, sistemų biologijos metodai, tokie kaip metatranskriptika ar metaproteomika kartu su metagenomika, gali išaiškinti androgenus ardančių mikrobų ekofiziologinę svarbą. Tai taip pat turėtų palengvinti mikrobiologinių konsorciumų kūrimą arba inžineriją, siekiant veiksmingai pašalinti steroidus iš užterštų ekosistemų.

Išvados

Integruoto metodo, apimančio keletą nuo kultūros nepriklausomų priemonių, taikymas atrodo naudingas tiriant aplinkai svarbių procesų, tokių kaip steroidų biologinis skaidymas, mikrobiologiją ir biochemiją. Mūsų eksperimentinėmis sąlygomis aerobinis androgenų biologinis skaidymas testosteronu apdorotuose nuotekose vyksta nustatytu 9, 10- seko keliu. Tačiau UPLC-MS / MS analizė negali padėti nustatyti metabolitų iš neaprašytų skilimo būdų. Taigi mūsų duomenys neatmeta galimybės, kad aerobinės nuotekos, veikiamos testosteronu, yra kitokios skilimo būdų. Metegenominė analizė, PGR pagrįstas funkcinis tyrimas ir kiekybinis PGR patvirtino katabolinį C. testosteroni vaidmenį testosterono valomose nuotekose. Tačiau mūsų duomenys nenurodė lemiamo C. testosteroni vaidmens aerobiniam androgenų skaidymui veikiančiuose nuotekų valymo įrenginiuose, kur androgenų yra daug mažesnėje koncentracijoje.

Medžiagos ir metodai

Chemikalai ir bakterijų štamai

Cheminės medžiagos buvo analitinio lygio ir buvo įsigytos iš „Fluka“, „Mallinckrodt Baker“, „Merck“ ir „Sigma-Aldrich“. C. testosteroni ATCC 11996 buvo gautas iš Amerikos tipo kultūros kolekcijos (Manassas, VA, JAV). Gordonia cholesterolivorans DSMZ 45229, Mycobacterium smegmatis DSMZ 43277 ir S. denitrificans DSMZ 13999 buvo įsigyti iš Deutsche Sammlung für Mikroorganismen und Zellkulturen (Braunšveigas, Vokietija). S. denitrificans buvo auginamas anaerobiniu būdu ant 56 testosterono. Kitos aerobinės bakterijos buvo aerobiniu būdu auginamos Luria-Bertani terpėje.

Nuotekų mėginių rinkimas

DHSTP yra didžiausia komunalinių nuotekų valymo įmonė (500 000 m 3 per dieną –1 ) Taipėjuje. Kartu su buitiniu vandeniu, DHSTP gauna pramonines, medicinines ir gyvulines nuotekas, taip pat požeminius vandenis 57 . DHSTP dizainas apima anoksinį / oksinį anglies ir azoto pašalinimo procesą, o hidraulinis sulaikymo laikas yra maždaug 10 valandų 57, 58 . Nuotekų mėginiai (10 L) buvo surinkti iš DHSTP aerobinio rezervuaro 2014 m. Birželio mėn. Aerobinės nuotekos buvo supilamos į sterilizuotą 20 litrų stiklinį butelį ir per 30 minučių pristatomos į laboratoriją.

Aerobinių nuotekų inkubacija su testosteronu

DHSTP aerobinių nuotekų mėginiai (0, 5 L nuotekų 2 L stikliniuose buteliuose) buvo inkubuojami tokiomis sąlygomis: autoklavuotos nuotekos su testosteronu (1 mM), aktyviosios nuotekos be testosterono ir aktyviosios nuotekos su testosteronu. Nuotekų valymas buvo atliekamas dviem egzemplioriais, o buteliai buvo inkubuojami 25 ° C temperatūroje maišant 160 aps / min dvi savaites. Mėginiai (10 ml) buvo išimami iš butelių kas 12 valandų ir prieš naudojimą buvo laikomi –80 ° C temperatūroje. Androgeninis aktyvumas ir androgenų metabolitai nuotekų mėginiuose buvo aptikti atitinkamai naudojant mielių androgenų analizę ir UPLC-APCI-MS / MS. Bakterijų 16S rRNR ir funkciniai tesB genai nuotekų mėginiuose buvo analizuojami atitinkamai naudojant Illumina MiSeq sekos nustatymą ir PGR pagrįstus funkcinius tyrimus.

UPLC-MS / MS nustato androgeninius metabolitus nuotekose

Aerobiniai nuotekų mėginiai (1 ml) buvo ekstrahuojami tris kartus tuo pačiu tūriu etilo acetato. Ekstraktai buvo sujungti, tirpiklis išgarintas, o liekanos ištirpintos 100 µL metanolio. Etilacetato ekstrahuojami mėginiai buvo analizuojami naudojant UPLC-APCI-MS / MS, kaip aprašė Wang et al . 38 .

„lacZ“ pagrindu pagamintų mielių androgenų biologinis tyrimas

Nuotekų mėginiai (0, 5 ml) buvo ekstrahuojami tris kartus, naudojant vienodą tūrį etilo acetato. Ištirpinus tirpiklį, ekstraktai buvo ištirpinti tame pačiame dimetilsulfoksido (DMSO) tūryje, o androgeninis aktyvumas nuotekų mėginiuose buvo nustatytas naudojant lacZ pagrįstą mielių androgeno tyrimą. Mielių androgenų biologinis tyrimas buvo atliktas taip, kaip aprašė Fox et al . 59 su nedidelėmis modifikacijomis. Trumpai tariant, individualūs steroidų standartai arba nuotekų ekstraktai buvo ištirpinti DMSO, o galutinė DMSO koncentracija tyrimuose (200 μL) buvo 1% (tūrio / tūrio). Gauti DMSO tirpalai (2 μL) buvo dedami į mielių kultūras (198 μL, pradinis OD 600nm = 0, 5), esančius 96 šulinėlių mikrotitravimo plokštelėje. Β-galaktozidazės aktyvumas buvo nustatytas po 18 valandų inkubacijos 30 ° C temperatūroje. Mielių suspensija (25 μL) buvo pridėta prie Z buferio (225 μL), kuriame yra o -nitrofenolio-β-D-galaktopiranozido (2 mM), ir reakcijos mišiniai inkubuojami 37 ° C temperatūroje 30 min. Reakcijos buvo sustabdytos pridedant 100 μl 1 M natrio karbonato, ir geltonos spalvos nitrofenolio produkto kiekis spektrofotometriniu būdu buvo nustatytas 420 nm bangos diapazone, naudojant plokštelinį spektrofotometrą (SpectraMax M2e, Molecular Devices).

„Illumina MiSeq“ bakterinių 16S rRNR amplikonų sekos nustatymas

Iš užšaldytų nuotekų mėginių DNR buvo išgauta naudojant „Powersoil“ DNR išskyrimo rinkinį (MO BIO Laboratories). 16S amplicon biblioteka buvo parengta pagal „Illumina 16S Metagenomic Sequencing Library Preparation Guide“ (/mentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf) su nedidelėmis modifikacijomis. Genominės sekcijos, apimančios bakterinio 16S rRNR geno V3-V4 sritis, buvo amplifikuotos iš 24 nuotekų valymo mėginių naudojant HiFi HotStart ReadyMix (KAPA Biosystems) per PGR (95 ° C 3 minutes; 25 ciklai: 95 ° C 30 s, 55 ° C 30 s, 72 ° C 30 s ir 72 ° C 5 min.). Gruntų pora, apklijuota „Illumina Nextera“ linkerio seka (priekinis gruntas: 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3 ′ ir atvirkštinis gruntas: 5′-GTCTCGTGGCCTCGGATATGTGTATAAGTAGAGATGTAGTACTAG Pirmiausia PGR produktai buvo atskirti agarozės gelyje, o tie, kurių laukiamas dydis (maždaug 445 bp), buvo pašalinti iš gelio ir išgryninti naudojant „GenepHlow Gel / PCR“ rinkinį („Geneaid“). Tada „ampulionų“ galus per PGR buvo integruoti „Illumina Nextera XT Index“ („Illumina“) sekos adapteriai (95 ° C 3 minutes; 8 ciklai: 95 ° C 30 s, 55 ° C 30 s, 72 ° C). 30 s ir 72 ° C 5 minutes). Galutinės bibliotekos buvo išgrynintos naudojant AMPure XP granules (Beckman Coulter) ir kiekybiškai įvertintos naudojant „Qubit dsDNA HS Assay Kit“ (Life Technologies). Bibliotekos profiliai buvo atsitiktinai analizuojami naudojant „Agilent“ didelio jautrumo DNR rinkinį „BioAnalyzer“. Norint užtikrinti nuoseklumą kaupiant visas 24 bibliotekas, buvo atliktas kiekybinis PGR normalizavimas, naudojant KAPA bibliotekos kiekybinius rinkinius, kad būtų galima nustatyti molinę koncentraciją, o galutinis bibliotekos mišinys buvo patikrintas kiekybine PGR. Bibliotekos fondas buvo sekamas naudojant „Illumina MiSeq V2“ sekvestorių, naudojant „MiSeq Reagent Kit V3“, suporuotą (2 × 300 bp). Išanalizavome sekos duomenis „Illumina BaseSpace“ debesies tarnyboje naudodami „BaseSpace 16S Metagenomics App“ (Illumina) (//support.illumina.com/content/dam/illumina-support/documents/documentation/software_documentation/basespace/16s-metagenomics- vartotojo vadovas-15055860-a.pdf). Skaitymai buvo suskirstyti į iliuminuotą 2013 m. Gegužės mėn. Greengenes taksonomijos duomenų bazės versiją naudojant Ribosomal Database Project (RDP) naivų Bajeso algoritmą (//rdp.cme.msu.edu/classifier/).

PGR naudojant „tesB“ geno zondą

Atliekant aštuonis testosteroną ardančių proteobakterijų 25 testB, panašių genų derinimą buvo atlikta naudojant „Align / Assemble“ („Genious 8.1.4“). Iš konservuotų regionų buvo išskaičiuota išsigimusi pradmenų pora [priekinis gruntas ( tesB- f1): 5′ – TAYYYSGCMTCBGGHTGGGA – 3 ′ ir atvirkštinis gruntas ( tesB – r1 ): 5′ – WRAARTCRTGBCCCCA – 3 ′. Be to, tesB fragmentai buvo amplifikuoti per PGR (94 ° C 2 minutes; 30 ciklų: 94 ° C 30 s, 48 ​​° C 30 s, 72 ° C 60 s; ir 72 ° C 10 minučių). Dalinės tesB sekos (maždaug 700 bp), amplifikuotos iš aerobinių nuotekų, buvo klonuojamos E. coli (One Shot TOP10; Invitrogen), naudojant pGEM-T Easy Vector Systems (Promega). „ TesB“ genai buvo surikiuoti pagal ABI 3730xI DNR analizatorių (Applied Biosystems; Carlsbad, CA, JAV) naudojant „BigDye“ terminatoriaus chemiją pagal gamintojo instrukcijas.

Image

( A ) „TesB“ sekų, gautų iš androgenus ardančių proteobakterijų, palyginimas (Horinouchi ir kt ., 25 ): „ Comamonas“ ( Com . Testosteroni TA 441), „ Pseudomonas putida DOC21“, „ Shewanella“ ( She .) Pealeana ATCC 700345, She . halifaxensis HAW-EB4, Pseudoalteromonas ( Pseudoalter .) haloplanktis TAC 125, Burkholderia ( Bur .) cenocepacia J2315, Ralstonia ( Ral .) eutropha H16, ir Cupriavidus ( Cup .) taiwanensis LMG 19424. ( B ) Konservuotos nukleotidų sekos išsaugotos. tesB genai. ( C ) Išvestos pradmenų poros, skirtos aptikti tesB genus. M = A + C, R = A + G, S = G + C, Y = C + T, W = A + T, B = T + G + C ir H = A + T + C. Atvirkštinis tipas ( balta ant juodos spalvos) rodo neatitinkančius išsigimusius pradmenis.

Visas dydis

Realaus laiko kiekybinė PGR

Specifinė grunto pora CteA2 60 [priekinis gruntas (CteA2-for): 5′ – TTGACATGGCAGGAACTTACC – 3 ′ ir atvirkštinis gruntas (CteA2-rev): 5′ – TCCCATTAGAGTGCTCAACTG – 3 ′ ir bendroji grunto pora Eub 61 [pirmyn gruntas (341F). : 5′ – CCTACGGAGGCAGCAG – 3 ′ ir atvirkštinis pradmuo (534R): 5′ – ATTACCGCGGCTGCTGGC – 3 ′] buvo naudojami atitinkamai C. testosteroni 16S rRNR geno ir visos eubakterijų populiacijos amplifikavimui. „ TesB“ - specifinė pradmenų „ TesBq“ pora („TesBq-f1“): 5′ – GCAAAAGAGCCAGGTCAAGCT – 3 ′ ir atvirkštinis gruntas (TesBq – r1): 5′ – GCCGCCATAGCCGAACT – 3 ′] buvo gauta iš konservuotų regionų 40 tesB fragmentų. (S6 ir S8 pav.). Trys realaus laiko kiekybinių PGR eksperimentų pakartojimai buvo atlikti naudojant „ABI 7300 Sequence Detection System“ („Applied Biosystems“). PGR mišinyje (20 μL) buvo 10 μL „Power SYBR Green PCR“ pagrindinio mišinio (Applied Biosystems), 0, 1 μM kiekvienam pradmeniui ir 30 ng aplinkos DNR. Šiluminio ciklo sąlygos susideda iš pradinio denatūravimo 95 ° C 10 min. Žingsnio, po kurio sekė 40 ciklų 95 ° C 15 s ir 60 ° C 60 s.

Papildoma informacija

Kaip pacituoti šį straipsnį : Chen, Y.-L. et al . „ Comamonas testosteroni“ kaip androgenų skilimo kanalizacijoje nustatymas. Mokslas. Rep. 6, 35386; „doi“: 10.1038 / srep35386 (2016).

Papildoma informacija

PDF failai

  1. 1.

    Papildoma informacija

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.