Mitochondrijų DNR mutacijos išskiria dvišales daugiažidinines inkstų onkocitomas nuo šeiminių gimdos gleivinės – hogg – dubé navikų | šiuolaikinė patologija

Mitochondrijų DNR mutacijos išskiria dvišales daugiažidinines inkstų onkocitomas nuo šeiminių gimdos gleivinės – hogg – dubé navikų | šiuolaikinė patologija

Anonim

Dalykai

  • Vėžio genetika
  • Diagnostiniai žymekliai

Anotacija

Onkocitomos dažniausiai yra gerybiniai navikai, pasižymintys trūkumų turinčių mitochondrijų kaupimu, o sporadiniais atvejais yra susiję su ardančiomis mitochondrijų DNR (mtDNR) mutacijomis. Tačiau mtDNR mutacijų vaidmuo pacientų, sergančių Birt – Hogg – Dubé (BHD), inkstų navikais ir kitomis inkstų onkocitomomis, turinčiomis akivaizdų genetinį komponentą, iki šiol nebuvo ištirtas. Čia apibūdiname įvairių inkstų navikų mitochondrijų genomą ir ištirsime galimybę panaudoti mtDNR sekos analizės biopsijos mėginius, kad būtų galima diferencijuoti onkocitomų diagnozę. Visas mitochondrijų genomas buvo padalintas iš 25 dvišalių ir multifokalinių (BMF) inkstų onkocitomų pavyzdžių, 30 BHD sergančių pacientų inkstų navikų ir 36 skirtingų histologijų neoncocitinių inkstų navikų pavyzdžių, taip pat inkstų navikų biopsijos pavyzdžių. mtDNR seka BMF onkocitomose atskleidė, kad visi navikai vykdo ardančias mutacijas, kurios pablogina NADH-ubikinono oksidoreduktazės surinkimą. Daugybė pacientų, kuriems diagnozuota BMF onkocitoma, navikai daugiausia turi tą pačią somatinę mutaciją, o šių pacientų inkstai difuziškai onkocitozė. Priešingai, pacientų, sergančių BHD sindromu, ir inkstų navikų, kurių histologija skiriasi, inkstų onkocitomos neparodo ardančių mtDNR mutacijų. Be to, mes parodome, kad yra įmanoma amplifikuoti ir sekti visą mtDNR biopsijos mėginiuose ir kad šios sekos atspindi naviko DNR. Šie rezultatai rodo, kad patogeninės mtDNR mutacijos, veikiančios kvėpavimo grandinės I kompleksą, yra stipriai koreliuojamos su onkotocitomos fenotipu nesusijusiuose su BHD inkstų navikuose ir kad mtDNR sekos iš biopsijų prognozuoja naviko genotipą. Šis darbas patvirtina mtDNR mutacijų, esančių kvėpavimo grandinės kompleksuose, vaidmenį kaip inkstų onkocitomų diagnostinius žymenis.

Pagrindinis

Pastaraisiais metais mitochondrijų genomui (mitochondrinei DNR (mtDNR)) buvo priskirtas svarbus vaidmuo daugelyje patologinių ligų, įskaitant vėžį. 1 Žmogaus mtDNR yra motiniškai paveldima apvali chromosoma, apytiksliai 30 mln. 16, 6 kb, kuris koduoja 37 genus, įskaitant tRNR, rRNR ir 13 baltymų, sujungtų į kvėpavimo takų grandinės kompleksus. Mitochondrijose yra kelios mtDNR kopijos, o kiekvienoje ląstelėje gali būti keli tūkstančiai mtDNR kopijų. 1, 2 Kelių mtDNR kopijų buvimas ląstelėje reiškia mutantų ir laukinio tipo alelių sambūvio galimybę vienoje ląstelėje ar audinyje - reiškinį, vadinamą heteroplazmija. Kai yra mtDNR mutacijos, fenotipinis poveikis nustatomas heteroplazmos lygiu. 1 mtDNR kopijų replikacija ir pasiskirstymas yra stochastiniai procesai, o jų paskirstymą įtakoja mitochondrijų dalijimasis ir susiliejimas. Tačiau mtDNR replikacija ir transkripcija yra griežtai kontroliuojama ir vykdoma branduoliu koduotų genų. Vienas iš pagrindinių mitochondrijų energijos apykaitos reguliatorių yra peroksisomų proliferatoriumi aktyvuotas gama koaktyvatorius 1 alfa (PGC1alfa), branduolinės transkripcijos koaktyvatorius, koordinuojantis mitochondrijų biogenezę su ląstelės ar audinio metaboliniais poreikiais. 3

Inkstų vėžys nėra atskiras darinys, tačiau jį sudaro daugybė navikų tipų, kuriuos sukelia skirtingų genų mutacijos ir kurių histologija bei klinikinė eiga skiriasi. Todėl klinikinį gydymą reikia optimizuoti kiekvienam inkstų naviko tipui. 4 Visų pirma, pacientų gerybinių navikų gydymas labai skirsis nuo agresyvių navikų gydymo, ir iki šiol vaizdavimo metodų ir biopsijos mėginių ne visada pakanka atskirti gerybinius ir piktybinius navikus. 5 Inkstų onkocitomos dažniausiai elgiasi geranoriškai, be pasikartojimo, metastazių ar mirštamumo. Neinvazinis tyrimas, siekiant atskirti onkocitomas nuo agresyvesnės inkstų ląstelių karcinomos (RCC), galėtų geriau palengvinti klinikinį valdymą. Oncocitomos yra epitelinės kilmės navikai, kuriems būdingas tankus defektų turinčių mitochondrijų kaupimasis, kuris suteikia granuliuotą eozinofilinę citoplazmą. Iki šiol nenustatyta, kad branduolinis genas būtų atsakingas už šiuos navikus, kurie dažnai turi stabilų kariotipą. 7, 8 Visų pirma, įrodyta, kad atsitiktinių onkocitomų iš skirtingų organų metu yra onkocitomos fenotipo koreliacija su žlugdančiomis mtDNR mutacijomis. 9, 10, 11 Visų pirma nustatyta, kad dėl mtDNR mutacijų sporadinės inkstų onkocitomos praranda elektronų pernešimo grandinės I kompleksą (NADH-ubikinono oksidoreduktazė, PI). 11, 12, 13, atitinkamai, inkstų onkocitomos metu I komplekso baltymai yra nepakankamai sureguliuoti, palyginti su chromofobų RCC, tuo tarpu baltymai, sujungti į kitus kvėpavimo grandinės kompleksus, yra sureguliuojami. 14 Ankstesnės išvados taip pat rodo, kad homoplazminių mtDNR mutacijų buvimas kompleksiniuose I genuose sąlygoja gerybinį šių navikų elgesį 15, tuo tarpu somatinių mtDNR nukleotidų pokyčiai buvo rasti kituose inkstų navikuose, tačiau dažniausiai turintys nedidelį poveikį kvėpavimo grandinės funkcijai. 16

MtDNR sekos analizė buvo atlikta inkstų navikams 17, 18 ir keliems kitiems navikams (pvz., He et al 19 (storosios žarnos vėžys); McMahon ir kt. 20 (krūties vėžys), Larman ir kt. 21 ) ir heteroplazminėms mutacijoms. dažnai buvo rasta neoplastiniuose audiniuose. Tačiau patogeninis šių mutacijų potencialas nebuvo retai įvertinamas, nors buvo pasiūlytas mtDNR mutacijų vaidmuo onkogenezėje. 22

Inkstų onkocitomos gali būti randamos kaip pavieniai sporadiniai navikai arba gali atsirasti kaip dvišaliai ir daugiažidininiai (BMF) navikai. Pirmą kartą apibūdinta kaip „oncocitomatozė“ 23. Daugybė onkocitinių mazgelių, išsisklaidžiusių per inkstų parenchimą, dabar žinomi kaip inkstų oncocitozė 24 ir dažniausiai sukelia sumažėjusią inkstų funkciją paveiktiems pacientams. Jis buvo aprašytas sporadiniais atvejais ir šeimos atvejais, susijusiais su Birto-Hoggo – Dubé (BHD) sindromu. 25, 26, 27 Dažniausiai nustatomos BHD sindromo histologijos yra hibridiniai onkocitiniai navikai, turintys onkocitomos ir chromofobų RCC požymių, taip pat gryna chromofobų ar onkocitinė inkstų masė. 25 Tais atvejais, kai inkstų oncocitozė pasireiškia ne BHD aplinkoje be FLCN mutacijų, atsakingasis genas išlieka nežinomas. 25 Kita vertus, pacientams, kuriems yra BHD sindromas, paprastai būna odos pažeidimų ir plaučių cistos, be to, padidėja onkotocitinių požymių turinčių daugiažidininių inkstų navikų rizika. Nors sporadinėms inkstų onkocitomoms būdingos disfunkcinės mitochondrijos, nustatyta, kad navikai, turintys FLCN trūkumą, turi funkcinę mitochondriją. 28

Šiame darbe tiriame mtDNR mutacijų įtaką inkstų navikams su onkocitine histologija. Parodome, kad BMF onkocitomos, panašios į sporadines onkocitomas, vykdo ardančias mtDNR mutacijas, veikiančias kvėpavimo grandinės komplekso I genus, tuo tarpu su BHD susiję inkstų navikai dažniausiai turi nepažeistas mtDNR, panašias į neoncocitinius RCC. Mes taip pat pateikiame įrodymų, kad inkstų oncocitozė yra susijusi su ardančiomis mtDNR mutacijomis paveiktose ląstelėse. Taigi šis darbas parodo mtDNR mutacijų vaidmenį inkstų onkocitomų vystyme su laukinio tipo FLCN .

medžiagos ir metodai

Pavyzdžiai

Iš viso šiam tyrimui buvo atrinkti 25 mėginiai iš 7 pacientų, sergančių sporadine BMF inkstų onkocitoma. Iš vieno inksto buvo išvestos penkios paciento BMF2 onkocitomos, o iš priešingo inksto - dar šeši mėginiai. Pacientai neturėjo šeimos inkstų navikų anamnezės ir neturėjo jokio genetinio sindromo, įskaitant BHD. Išsami informacija apie pacientus, sergančius BMF ir navikais, pateikiama papildomoje S1 lentelėje. Į analizę buvo įtraukti trisdešimt inkstų navikų mėginių iš 13 skirtingų pacientų, paveiktų BHD sindromu. Septyniuose iš šių navikų nustatyta onkocitinė histologija, 4 mėginiuose buvo chromofobų histologija, 18 navikų buvo hibridiniai onkocitiniai navikai, turintys tiek chromofobų RCC, tiek onkocitomos požymius, tuo tarpu vienas navikas buvo silpnai diferencijuotas. Kaip kontrolė buvo panaudota 36 neoncocitinių RCC, turinčių skirtingą histologiją ir genetinį pagrindą, grupė. Sporodiniai skaidrių ląstelių RCC (ccRCC; n = 6), BMF ccRCC ( n = 4) ir su VHL susiję ccRCC ( n = 5), taip pat sporadiniai papiliariniai 1 tipo RCC ( n = 5) ir FH mutavę RCC ( n = 5). HLRCC; n = 4; 3 ląstelių linijos ir 1 navikas). Chromofobų RCC buvo atrinkti iš pacientų, kuriems nėra buvę inkstų navikų ar su BHD susijusių apraiškų ir be FLCN mutacijų ( n = 12).

Iš kiekvieno paciento buvo paimta kraujo DNR, kad būtų galima įvertinti somatinių ir lytinių takų mutacijų būklę. Visų navikų histologiją apžvelgė vienas patologas (MJM). Remiantis Nacionalinio sveikatos instituto apžvalgos taryba, prieš operaciją buvo gautas informuotas visų pacientų sutikimas.

mtDNA sekvenavimas

Iš užšaldyto naviko audinio ir kraujo DNR buvo išgauta naudojant „Maxwell 16“ audinių ir kraujo DNR gryninimo rinkinius (Promega, Madisonas, WI, JAV). Naviko ir normalaus audinio mikrodalelė buvo atlikta rankiniu būdu ant formalinu fiksuotų ir parafinu įterptų audinių plokštelių ir DNR buvo ekstrahuota „Maxwell 16 FFPE Tissue LEV“ DNR gryninimo rinkiniu (Promega) po 16 valandų inkubacijos su proteinaze K 65 ° C temperatūroje.

Visas mitochondrijų genomas buvo išskaidytas su „MitoAll“ rinkiniu („Applied Biosystems“, Foster City, CA, JAV). 10 PGR reakcijų buvo atliktos 10 μl tirpalu su KAPA2G Fast Readymix 10 ng DNR. PGR amplikonai buvo išgryninti, pridedant 1U FastAP termiškai jautrios šarminės fosfatazės ir 0, 5 U egzonukleazės I į kiekvieną PGR reakciją ir inkubuojant 37 ° C temperatūroje 30 min., Po to - šilumos inaktyvavimą 15 min. 80 ° C temperatūroje. Sekavimas buvo atliktas naudojant BigDye v1.1 (Applied Biosystems) pagal gamintojo instrukcijas. Reakcijos buvo išvalytos „Performa DTR Plates“ („Edge Bio“) ir paleistos „ABI 3730 Genetic Analyzer“ automatiniame sekos nustatymo aparate (Applied Biosystems). Elektrofermos buvo patikrintos ir suderintos su žmogaus mitochondrijų atskaitos seka (NC_012920), naudojant Sequencher 4.10.4 (Genecodes, Ann Arbor, MI, JAV). Visos sekos buvo pateiktos į NCBI duomenų bazę (KJ801401 – KJ801483).

Mutacijų analizė

MtDNR nukleotidų pokyčių polimorfinė būklė buvo patikrinta paskiriant kintamumo balus pagal Žmogaus mitochondrijų duomenų bazę (hmtdb; www.hmtdb.uniba.it; 29 ), taip pat apžiūrint nukleotidų pokyčius MITOMAP, žmogaus mitochondrijų genomo duomenų bazėje ( mitomap.org; 30 ). Patogeninis naujų mtDNR mutacijų potencialas buvo įvertintas naudojant PolyPhen-2. 31

Heteroplazmos įvertinimas

Indel mutacijų heteroplazma buvo įvertinta fluorescencine PGR, kaip aprašyta anksčiau. M.G4036A mutacijos 32 heteroplazmos lygiai buvo įvertinti naudojant pasirinktinį castPCR (Applied Biosystems), naudojant laukinio tipo ir mutanto testą. Amplifikuojamos DNR (mtDNR) kiekis buvo pakoreguotas realaus laiko PGR, atliktas su „Maxima SYBR Green / ROX qPCR Master Mix“ (Fermentas, Waltham, MA, JAV) 20 μl reakcijose, naudojant pradmenis, specifinius MT-CYB ir pradedant nuo 1 ng DNR kiekvienoje reakcijoje (FW pradmuo: TCCCACCCTCACACGATTCTTTACC, RV pradmuo: GTGCAAGAATAGGAGGTGGAGTGCT). CastPCR ΔCt ribinės vertės buvo aptiktos atlikus castPCR tyrimą plazmidės DNR, turinčioje klonuotų laukinio tipo arba mutantinių alelių (Topo-TA klonavimo rinkinys, Invitrogen, Carlsbad, CA, JAV). „CastPCR“ tyrimai buvo atlikti 10 μl reakcijomis su „TaqMan Universal PCR Master Mix“ („Applied Biosystems“) „Viia7“ realaus laiko PGR aparatu („Applied Biosystems“) pagal gamintojo pateiktas instrukcijas. Duomenų analizė atlikta naudojant mutacijų detektoriaus programinę įrangą (Applied Biosystems).

Kompleksinis I veiklos tyrimas

Komplekso I aktyvumo tyrimas buvo atliktas su naviko ir normalaus inksto audinio baltymų lizatais, naudojant komplekso I fermento aktyvumo mikrotinklelio tyrimo rinkinį (MitoSciences, Eugene, OR, JAV) pagal gamintojo instrukcijas.

Imunofluorescencija

Imunofluorescencinis dažymas buvo atliktas ant 5 μm šaldytų audinių dalių, pritvirtintų ant teigiamai įkrautų plokštelių, kaip aprašyta anksčiau. 33 Dažymas I kompleksu (NDUFB8; 1: 200, Invitrogen), II kompleksu (SDHA; 1: 200, Abcam; Kembridžas, JK) ir IV kompleksu (COXIV; 1: 400, ląstelių signalizacijos technologija; Beverly, MA, JAV). kvėpavimo grandinės dalis buvo inkubuojama su pirminiu antikūnu 4 ° C temperatūroje per naktį, po to 1 valandą inkubuojant kambario temperatūroje su antriniais antikūnais Alexa Fluor 488 ožkų anti-triušio IgG (1: 400) ir (arba) Alexa Fluor 594 ožkomis. pelės IgG (1: 400) (Invitrogen). Objektyvai buvo priešakiniai ir sumontuoti naudojant montavimo terpę su DAPI (Vector Laboratories, Burlingame, CA, JAV) ir analizuojami fluorescenciniu mikroskopu (Leica DM RXA).

Naviko biopsijų analizė

Iš dviejų skirtingų naviko mėginių buvo gautos trys biopsijos šerdys iškart po jų chirurginio pašalinimo 18G ± 6 cm biopsijos sistemomis (Temno, San Diegas, CA, JAV) ir laikomos steriliame PBS tol, kol buvo perdirbtos. DNR ekstrahavimas iš vienos biopsijos šerdies ir mtDNR sekos buvo atliktos, kaip aprašyta aukščiau.

Rezultatai

mtDNA sekos nustatymas BMF inkstų onkocitomomis nustato kompleksines I mutacijas

Patogeninės mtDNR mutacijos yra sporadinių onkocitomų požymiai. 34 Norėdami ištirti, ar mtDNR mutacijos taip pat turi reikšmės daugiafunkcinėms inkstų onkocitomoms, mes subsegavome visą mitochondrijų genomą 15 inkstų onkocitomų, atrinktų 8 operacijų metu iš 7 skirtingų pacientų, kuriems buvo diagnozuota BMF inkstų onkocitoma. mtDNR sekos analizė parodė, kad visi šie mėginiai turėjo patogenines mutacijas mitochondrijų genome. Visi pacientų BMF2 ir BMF4 navikai, nustatyti iš pradžių, turėjo skirtingą mutaciją (atitinkamai 11038delA ir 3571 C). Todėl buvo ištirti penki papildomi navikai iš kiekvieno iš šių dviejų pacientų, siekiant nustatyti jų mutacijos būklę. Iš viso mes ištyrėme 25 mėginius ir nustatėme, kad visi mėginiai, išskyrus vieną (paciento BMF7), turėjo gendančius baltymus, koduojančius baltymus, surinktus į kvėpavimo sistemos grandinės I kompleksą ( MT) ( MT-ND1 , MT-ND4 ), ardančias (kadrų poslinkį ar nesąmonę)., MT-ND5; 1 lentelė). Navikas (paciento BMF7), kuris neatliko mutacijos CI gene, turėjo heteroplazminę mutaciją tRNR (m.C7483T), paveikdamas MT-TS1 antikodoną ir pakeisdamas antikodono tripletą iš UCA, koduojančio Seriną, į UUA., antikodonas, kurį paprastai rodo tRNR leucinui.

Pilno dydžio lentelė

Be šių aiškiai patogeninių mutacijų, 10 mėginių turėjo papildomų somatinių bazių pokyčių, įskaitant žinomus polimorfizmus (m.309insC (BMF2-1 / 3, BMF4-1 / 1, BMF7), m.C16188T (BMF1-1 / 1) ir m.524insAC (BMF7, BMF5-1 / 2)) kintamojo D-kilpos srityje, neaiškaus patogeniškumo potencialo tRNR mutacijos (m.G15961A - MT-TP (BMF2-2 / 1); m.G1664A MT-TV ( BMF5-1 / 1)), rėmelio poslinkio mutacija ir nesąmonė mutacija esant žemam heteroplazminiam lygiui (m.5761insC - MT-ND2 (BMF4-1 / 1); m.G12923A - MT-ND5 (BMF6)).

BMT mtDNR mutacijos Oncocitomos yra somatinės ir homoplazminės

Norėdami nustatyti naviko mėginių mutacijos apkrovą ir patikrinti, ar mutacijos yra somatinės ir išskirtinės auglio audinyje, mes išanalizavome heteroplazminį mutacijų lygį, rastą BMF onkocitomose, ir įvertinome mutacijų somatinę būklę analizuodami kraują. DNR ir normalus inkstų audinys. Mes įvertinome rėmelio poslinkio mutacijų heteroplazmos lygį per fluorescencinę PGR (F-PGR) ir duomenys apibendrinti 1 lentelėje. Paciento BMF1 1 navikas turėjo m.12425delA mutaciją esant 71% heteroplazmos lygiui (71% mutanto alelio), tuo tarpu navikas. 2 iš to paties paciento mutacija buvo ta pati 27% heteroplazmijos lygiu, tačiau atlikta papildoma mutacija (m.3571insC) esant aukštam heteroplazmijos lygiui (88% mutantinio alelio). Nei viena iš šių mutacijų nebuvo nustatyta šio paciento kraujo DNR.

F-PGR analizė atlikta m.11038delA mutacijoje, kuri buvo atlikta dviejuose naviko mėginiuose iš skirtingų paciento BMF2 operacijų ir priešingų inkstų. Mutacijų apkrova buvo 99 ir 98, 5%, tuo tarpu to paties paciento kraujo DNR mutacijų nebuvo aptikta. Mes taip pat išanalizavome visus septynis paciento BMF4 mėginius, norėdami nustatyti m.3571insC mutaciją. Mėginiai, kurių mutacijų apkrova buvo 88% ar didesnė, buvo labai gryni (1 lentelė), tuo tarpu trys mėginiai, kurių mutacija buvo mažesnė, histologiškai įvertinti, kad atitinkamas normalus audinių užterštumas. Vėlgi, kraujo DNR analizė patvirtino šios mutacijos somatinę būklę.

Mutacija m.G4036A (paciento BMF5) buvo analizuojama realaus laiko PGR. Abu navikai turėjo didelę mutacijų apkrovą (> 98%), o mutacijos nebuvo galima aptikti atitinkamo paciento kraujo DNR (1 lentelė).

Norėdami ištirti, ar auglyje rastos mutacijos, kurių nėra kraujo DNR, buvo normalioje inksto parenchimoje, dviejų pacientų (BMF1 ir BMF4) mikrodiskretuotame inksto audinyje, esančiame greta navikų, ir paties naviko audinio. Buvo tiriami audiniai, esantys šalia naviko 1/1 paciento BMF1 naviko (1 lentelė), siekiant nustatyti m.12425insA ir m.3571delC mutacijas, tačiau mutacijų nepavyko aptikti. Nors paciento BMF4 mikrodiskrecinis navikas turėjo didelę mutacijų apkrovą (> 94%), mutacijos nebuvo galima aptikti atitinkamuose normaliai audiniuose, kuriuose yra mikrodalelių (1d pav.). Šie duomenys patvirtina, kad BMT onkocitomose aptiktos mtDNR mutacijos yra somatinės ir yra tik naviko audinyje.

Image

BMF onkocitomoms trūksta komplekso I. Reprezentatyvi audinių sekcijų, kuriose yra normalus (N) ir oncocitinis audinys (T), imunohistochemiškumas I kvėpavimo grandinės komplekso (NDUFB8; a ) ir IV komplekso (COXIV ; b ) subvienetams. c ) a ir b punktų sutapimas. Didinimas: × 50. d ) Eilės elektroferograma, rodanti kadrų poslinkio mutaciją m.3571insC BMF4 pavyzdyje.

Visas dydis

BMF onkocitomų IHC atskleidžia, kad I kvėpavimo grandinės komplekso nėra

Manoma, kad sutrikdytos mitochondrijų užkoduotos PI subvienetų mutacijos gali pakenkti tinkamam fermentų komplekso surinkimui. Norėdami patikrinti šią prielaidą, mes nudažėme užšaldytų BMF onkocitomų audinių dalis su antikūnais skirtingiems kvėpavimo grandinės kompleksų subvienetams (CI, CII ir CIV) ir nustatėme, kad visi navikai davė stiprų dažymą CIV (COXIV; 1b ir c pav.) Ir CII. (SDHA; 2c pav.) Baltymai, kurie sutinka su dideliu mitochondrijų kiekiu, yra onkocitomų požymis. Atvirkščiai, branduolio užkoduotas PI subvienetas (NDUFB8) nedažė BMF onkocitomų, nors jo aiškiai buvo gretimame normaliame inkstų audinyje (1a ir c pav.). Šis dažymo modelis buvo nuoseklus visų mėginių, turinčių mutaciją CI genuose, atveju, taip pat heteroplazminės mutacijos tRNR MT-TS1 atveju (paciento BMF7, mutacija m.C7483T; 2a, c ir e paveikslai). Be to, tyrimas in vitro patvirtino, kad BMF onkocitomose CI aktyvumas buvo labai sutrikęs (2g paveikslas).

Image

TRNR mutacija sutrikdo kvėpavimo grandinės I kompleksą inkstų oncocitomos metu, tuo tarpu BHD onkocitomos turi nepažeistas mitochondrijas. I komplekso (NDUFB8; a ir b ), II komplekso (SHDA; c ir d ) ir IV komplekso (COXIV; e ir f ) imunohistochemija inkstų onkocitomos mėginyje, kuriame yra heteroplazminės tRNR mutacijos, palyginti su BHD onkocitoma, rodo, kad CI nėra dažytas. onkocitoma su tRNR mutacija ( a ), bet CI dažymas BHD onkocitoma ( b ). CII ir CIV dažytos abiejuose navikuose (padidinimas: 100). ( g ), kompleksinis I aktyvumo tyrimas patvirtina labai mažą BMF onkocitomų aktyvumą, palyginti su normaliu inkstų audinio aktyvumu, tačiau panašus PI aktyvumas tarp BHD navikų ir normalaus inkstų audinio.

Visas dydis

BMF onkocitoma sergantys pacientai gali nustatyti inkstų onkotocitozę

Buvo aprašyta, kad BMF onkocitomos atsiranda inkstų onkocitozės kontekste, ir ši diagnozė rodo daugybės onkocitomų dažnį abiejuose inkstuose. Pavyzdžiui, paciento BMF4 buvo operuoti abu inkstai ir iš viso pašalinta 10 navikų. Šiam pacientui audinių, esančių greta pašalintų navikų, analizė leido ištirti onkocitozės buvimą „normalioje“ inksto parenchimoje. Fotografavimas hematoksilinu ir eozinu iš tikrųjų parodė daugybę ląstelių ir ląstelių židinių, turinčių onkocitinę išvaizdą (3a pav.). Imunohistochemijos (IHC) dažymas kvėpavimo grandinės kompleksų subvienetams parodė, kad visos oncocitinės ląstelės turi tą patį dažymo modelį, kokį matė onkocitoma: didelis CIV (COXIV) baltymų gausumas (3d ir e paveikslai) ir CI subvienetų nebuvimas (NDUFB8; pav.) 3c ir e). Sutikus su šiuo radiniu, atlikta onkocitozės būdu surinktų audinių genetinė analizė patvirtino, kad onkocitinėse ląstelėse įvyko ardanti mtDNR mutacija (šiuo atveju m.3571insC), o nepažeistose ląstelėse buvo pateiktas laukinio tipo mitochondrijų genomas (3b paveikslas).

Image

Paciento BMF4 inkstų mėginių, rodančių onkocitozę, dažymas hematoksilinu ir eozinu (H&E), imunohistochemija (IHC) ir fluorescencinė PGR (F-PGR). a ) „normalaus“ inkstų audinio dažymas H&E, kuriame yra daugybė onkocitinių mazgelių visame inkstų audinyje (rodyklių galvutės; padidinimas: 100). ( b ) F-PGR analizė m.3571insC ( MT-ND1 ) mutacijai parodo laukinio tipo ir mutantinių alelių smailes DNR, išgautose iš audinių, sergančių onkocitozė. Normaliai mikrodiskreciniame audinyje mutacijų neaptinkama (0% mutacija), tuo tarpu laukinio tipo alelio pikas yra pastebimas tik labai mažame mikrodiskrecinio naviko audinyje (93% mutacija). IHC kvėpavimo grandinės komplekso I subvienetui (NDUFB8) ( c ) ir komplekso IV subvienetui (COXIV) ( d, persidengimas parodytas e punkte) rodo koreliaciją tarp mitochondrijų gausos, kurią rodo CIV dažymas, ir CI nebuvimo visuose mazgeliuose visame audinys (pažymėtas baltomis rodyklėmis). Normalus inkstų audinys ekspresuoja tiek CI, tiek CIV baltymus (centrinė vaizdų dalis; padidinimas: 200).

Visas dydis

mtDNA mutacijos, konkrečiai vykstančios onkocitomose

Norėdami patikrinti, ar mtDNR mutacijos būdingos onkocitomoms pacientams, sergantiems BMF inkstų vėžiu, mes visą sekančią mtDNR nustatėme sekdami onkocitomą ir ccRCC, kurie išsivystė tam pačiam pacientui ir buvo ištirti atliekant dvi operacijas iš eilės (BMF6) (papildomas paveikslas S1). CcRCC mtDNR seka pateikė 41 polimorfinio nukleotido pokytį, palyginti su mtDNR pamatiniu seka, ir tris somatines heteroplazmines missense mutacijas (m.G4244A, MT-ND1 , p.S313N, Polyphen2 balas (PSIC): 0, 000; m.A11672G). ( MT-ND4 , p.T305A, PSIC: 0, 994; m.G12997A, MT-ND5 , p.A221T, PSIC: 0, 906). Kita vertus, inkstų onkocitomos seka patvirtino visų polimorfizmų buvimą, tačiau ccRCC rastų missense mutacijų laukinio tipo. Vietoj to, šiame pavyzdyje buvo atlikta homoplazminė rėmelio poslinkio mutacija MT-ND4 (m.10952insC, p.L65Pfs * 45), taip pat heteroplazminė nesąmonių mutacija MT-ND5 (m.G12923A, p.W196X), kurių nebuvo. ccRCC ir paciento kraujo DNR (papildomas paveikslas S1). Šie rezultatai pabrėžia tvirtą ryšį tarp žlugdančių mtDNR mutacijų ir onkocitomos naviko tipo.

mtDNR sekos nustatymas ne oncocitiniuose navikuose

Chromofobinis RCC gali dalintis histologiniais panašumais su onkocitoma. Chromofobų RCC eozinofilinis variantas labai primena inkstų onkocitomą. 35 Todėl mes taip pat sekvenavome visą mitochondrijų genomą iš viso 12 sporadinių chromofobų RCC (2 klasikinio tipo, 5 eozinofiliniai, 4 aiškūs ir eozinofiliniai ir 1 neklasifikuoti), kad patikrintume, ar mtDNR mutacijos yra šio inksto naviko fenotipe. Šeši iš šių mėginių pasirodė laukinio tipo, dviejuose mėginiuose buvo atlikti baziniai pokyčiai, kurie, kaip žinoma, yra polimorfiniai, trijuose mėginiuose buvo atlikti bazės pokyčiai kintamojo D-kilpos srityje arba tRNR, tuo tarpu vienas mėginys įgavo heteroplazminę missense mutaciją (50). % mutantinio alelio) su numatomu dideliu patogeniškumu (m.G15045A - MT-CYB p.R100Q - Polyphen2 PSIC: 1.000), o kitame mėginyje buvo pateiktas naujas heteroplazminės bazės pokytis (25% mutanto alelis) MT-RNR2 gene (papildomas S2 lentelė). Visos šios mutacijos buvo somatinės. Apskritai, sporadinis chromofobinis RCC tik retai įgijo patogeninių mtDNR mutacijų.

Be šių sporadinių navikų, pacientui, kuriam mūsų institutas buvo pateiktas su BMF chromofobų RCC, buvo galima analizuoti šešis rezektuotus navikus. Visų šių pacientų navikai, turintys somatinių mtDNR pokyčių. Trijuose navikuose buvo atlikti homoplazminiai rėmelio poslinkio intarpai (m.3571insC - MT-ND1 , m.14623insC - MT-ND6 ), vienas auglys turėjo heteroplazminį rėmo poslinkio deleciją (m.4611delA - MT-ND2 ), o du navikai parodė mutacijas MT-CO1 (m.G6955A) arba D-kilpos sritis (m.549delC, m.T531C; papildoma S2 lentelė). Histologinė analizė patvirtino šių mėginių eozinofilinį chromofobų fenotipą, todėl tai yra mtDNR mutacijų ir onkocitomos fenotipo koreliacijos išimtis.

Be to, mes sekame visą mtDNR 24 papildomuose neoncocitiniuose navikuose, turinčiuose skirtingą histologiją (apibendrinta 4 paveiksle ir papildomoje S3 lentelėje). Vienuolikoje iš šių inkstų navikų mėginių buvo parodytas laukinio tipo mitochondrijų genomas, o likusiuose mėginiuose buvo somatinės bazės pokyčiai. Šiuose 13 navikų mes nustatėme iš viso 23 bazinius pokyčius, kuriuos sudarė 5 homoplazminės ir 18 heteroplazminės mutacijos (papildoma S3 lentelė). Dviejų iš homoplazminių mutacijų patogeninis potencialas buvo tiksliai numatytas, kaip išanalizavo PolyPhen-2 (m.G3916A - PSIC = 0.99; m.G14607A - PSIC = 1.000), o dvi missense mutacijos turėjo nedidelį poveikį baltymų funkcijai. (m.G9387A - PSIC = 0, 665; m.G12895A - PSIC = 0, 0290) arba tRNR antrinė struktūra (m.A12242C - MT-TS2 ). Dviejuose mėginiuose buvo atliktos heteroplazminės rėmelio poslinkio mutacijos, turinčios įtakos MT-ND1 (m.3571insC) ir MT-ND4 (m.11038delA), kurių navikų mėginiuose buvo atitinkamai 85 ir 50% (papildoma S3 lentelė).

Image

Fenotipų ( a ir c ) apibendrinimas ir mtDNR bazės pokyčių ( b ir d ) klasifikacija ne oncocitiniuose inkstų navikuose ( a ir b ) ir BHD navikuose ( c ir d ) rodo, kad šiuose mėginiuose retos patogeninio mtDNR mutacijos yra retos . het, heteroplazminis; hom, homoplazminis.

Visas dydis

Apskritai, net jei buvo rasta mtDNR mutacijų, neoncocitiniai navikai dažniausiai pernešė laukinio tipo mtDNR arba pateikė somatines, dažniausiai heteroplazmines, mutacijas, kurių patogeninis potencialas yra mažas arba vidutinis. Šie duomenys kartu su sekos nustatymo duomenimis apie BMF onkocitomas vėl lemia tvirtą koreliaciją tarp onkocitomos fenotipo ir patogeninių mtDNR mutacijų ( P = 0, 0005; Fišerio Tikslus testas).

mtDNA sekvenavimas BHD navikuose

Norėdami ištirti, ar sindrominiai onkocitiniai navikai veikia pagal tą patį molekulinį mechanizmą, kaip ir vienišas, ir BMF onkocitomos, mes nustatėme visą mtDNR septyniuose mikrodiskolituotuose onkocitiniuose navikuose, išsivysčiusiuose trims BHD sergantiems pacientams. Penkiuose iš šių mėginių nebuvo mtDNR mutacijų, tuo tarpu kituose dviejuose mėginiuose buvo heteroplazminės missense arba rėmelio poslinkio mutacijos (m.G5400A, m.3571insC) heteroplazmijos lygiuose, kurie gali būti laikomi žemiau fenotipinio efekto slenksčio (50%, apskaičiuota pagal elektroferogramą). ir 30% atitinkamai pagal F-PGR; papildoma S4 lentelė).

Šiuose mėginiuose genetinė FLCN analizė buvo atlikta anksčiau 36, o trijuose iš šių navikų nustatyta somatinė „antrojo smūgio“ mutacija FLCN . Heteroplazminių somatinių mtDNR mutacijų buvimas nebuvo reikšmingai susijęs su somatinių „antrojo paspaudimo“ mutacijų nebuvimu FLCN ( P = 0, 147), atmesdamos galimybę, kad mtDNR mutacijos gali būti „antrojo paspaudimo“ įvykis ląstelėje, heterozigotinėje FLCN išraiška.

Be BHD onkocitomų, mes ištyrėme 23 navikus, neklasifikuojamus kaip onkocitomos iš 11 BHD pacientų, įskaitant 4 chromofobus ir 18 hibridinių onkocitinių navikų, taip pat vieną blogai diferencijuotą papiliarinio tipo RCC (4 paveikslas). Keturiolikoje iš šių navikų nebuvo jokių somatinių nukleotidų pokyčių mtDNR, tuo tarpu 5 navikuose buvo heteroplazminių pokyčių, žinomų kaip polimorfiniai, 3 navikuose įvyko naujos heteroplazminės somatinės mutacijos, o viename auglyje atsirado heteroplazminė ir homoplazminė somatinė missenso mutacija, kaip prognozuojama. tikriausiai žalingas (apibendrinta 4 paveiksle ir papildomoje S4 lentelėje).

Šių mėginių FLCN genetinė analizė buvo atlikta anksčiau ir šioje ataskaitoje 36 (papildoma S4 lentelė). Apibendrinant galima pasakyti , kad 19 iš 23 navikų buvo nustatyta somatinė „antrojo smūgio“ FLCN mutacija. Vėlgi, somatinių mtDNR nukleotidų pokyčiai navike nebuvo susiję su FLCN mutacijos būkle ( P = 0, 412).

Apskritai navikai, kuriuos sukūrė pacientai, kuriems diagnozuotas BHD, dažnai turi onkocitinius požymius. Tačiau, priešingai nei BMF onkocitomos, šios neoplazmos daugiausia turi laukinio tipo mitochondrijų genomą. Potencialiai patogeniškos mtDNR mutacijos yra žymiai didesnės BMF onkocitomose nei navikuose su bet kuriomis FLCN mutacijomis ( P <0, 0001). Atitinkamai, IHC dažymas CI (NDUFB8), CII (SDHA) ir CIV (COXIV) aiškiai rodo, kad šie kvėpavimo grandinės kompleksai yra BHD naviko audiniuose (2b, d ir f paveikslai), be to, PI aktyvumo tyrimai rodo, kad NADH-ubikinono oksidoreduktazės aktyvumas reikšmingai nesumažėja sergant BHD navikais (2g paveikslas).

mtDNR biopsijų sekos prognozuoja naviko mtDNR seką

Patikima ikioperacinė oncocitomos diagnozė pasitelkiant vaizdo gavimo metodus ir histologinę biopsijos mėginių analizę dažnai nėra aiški. 5 Kadangi čia randame labai tvirtą koreliaciją tarp patogeninių mtDNR mutacijų ir gerybinio onkocitomos fenotipo nesindrominiuose inkstų navikuose, norėjome ištirti, ar įmanoma mtDNR genetinė analizė biopsijos mėginiuose ir prognozuoti naviko genotipą.

Todėl iš karto po chirurginio pašalinimo (pacientų BMF6 ir BMF8) atlikome mėginių biopsijas dviem naviko mėginiams, paėmėme atitinkamai 2 ir 3 biopsijas iš skirtingų naviko sričių ir iš kiekvieno mėginio ištraukėme DNR. PGR amplifikacija buvo atlikta su neskiesta DNR. Mes gavome PGR amplikonus su visais pradmenimis, apimančiais visą mtDNR ir tokiu būdu sugebėdami surinkti visą mitochondrijų genomą biopsijose ir palyginti jį su atitinkamu naviko audiniu. Paciento BMF6 navikas turėjo 41 polimorfizmą ir 3 heteroplazmines missense mutacijas, tačiau nebuvo aiškių patogeninių mutacijų ir vėliau buvo diagnozuotas kaip ccRCC. Paciento BMF8 navikas, diagnozuotas kaip chromofobinis RCC, turėjo 38 polimorfizmus ir heteroplazminį intarpą kintamos D-kilpos srityje. Biopsijose aptikome visus navikų nukleotidinius pokyčius mtDNR sekose, įskaitant heteroplazminius pokyčius (papildomas S2 paveikslas). Šie duomenys patvirtina, kad visą mtDNR galima sekti ribotoje medžiagoje, pavyzdžiui, biopsijos pavyzdžiuose, ir kad gautos sekos reprezentuoja naviko DNR seką.

Diskusija

Inkstų navikai turi daugybę skirtingų histologijų, juos sukelia skirtingų genų mutacijos ir jie vyksta skirtingais klinikiniais būdais. Todėl, norint tinkamai gydyti pacientą, svarbu nustatyti patikimus diagnostinius kriterijus, leidžiančius atskirti gerybinius ir piktybinius navikus. Mitochondrijų genomas buvo analizuojamas įvairių navikų srityje, tačiau vis dar daug diskutuojama apie mtDNR mutacijų įtaką navikogenezei ir formuojant naviko fenotipą (pvz., Davis ir kt. , 18 Gasparre ir kt. , 34 He ir kt., 19 ). Tačiau onkocitomos skirtinguose organuose, ypač inkstų onkocitomos, buvo susijusios su mtDNR mutacijomis. 10, 11, 13 Čia parodyta, kad BMF onkocitomos taip pat vykdo somatines patogenines mtDNR mutacijas. Mūsų išvados parodo ryšį tarp onkocitomos fenotipo ir mtDNR mutacijų, kurias įrodė vienas pacientas, sukūręs ccRCC, kuris turėjo tik keletą heteroplazminių missense mutacijų, ir onkocitoma, kuriai būdinga homoplazminė ir heteroplazminė rėmelio poslinkio mutacija. Remiantis anksčiau aprašytais mtDNR koduojamų genų 'onkojauso' funkcija, visos suardomos mutacijos, aptiktos BMF onkocitomos mėginiuose, paveikė kvėpavimo grandinės CI ir buvo homoplazminės arba buvo heteroplazmos lygiuose, kurie laikomi virš fenotipinio efekto slenksčio. 15 Kita vertus, vienas įdomus inkstų onkocitomos mėginys pateikė heteroplazminę tRNR mutaciją MT-TS1 , paveikusią tRNR antikodoną. Kadangi šis pakeitimas gali sukelti netinkamą aminorūgščių įsiskverbimą į visus mitochondrijų koduojamus baltymus, manoma, kad mutacija turės dominuojantį neigiamą poveikį. Taigi, sutikdami su ankstesniais tyrimais 11, 13, mes nustatėme, kad visoms BMF onkocitomoms trūksta tinkamai surinktos NADH-ubikinono oksidoreduktazės, turinčios dramatiškai sumažintą PI fermento aktyvumą.

Inkstų onkocitozės patogenezė, kuriai būdingi daugybė mažų inkstų onkocitinių pažeidimų, nėra tiksliai nustatyta. 26 Pažymėtina, kad šiame tyrime aprašytiems pacientams išsivysčiusiose BMF onkocitomose buvo tokia pati ardančioji mtDNR mutacija, kai daugybiniai onkocitomai buvo iš abiejų inkstų. Tačiau šių pacientų kraujyje ir normaliose inkstų DNR mutacijos nebuvo. MtDNR mutacijų heteroplazmijos lygio matavimui naudojama metodika leido tiksliai išmatuoti mutacijų procentą ir buvo pakankamai jautri, kad būtų galima nustatyti 1% (F-PCR 32 ) ar net 0, 1% (heteroplazmos) lygį (castPCR - gamintojo instrukcijos ir duomenys). nerodyta). Mutacijų iš nepažeisto audinio nebuvimas ir tos pačios mutacijos buvimas priešinguose inkstuose palaiko mtDNR mutacijos įgijimą ankstyvojo embrioninio inksto vystymosi metu ir reiškia, kad ši liga greičiausiai nebuvo paveldėta. Pavienės ląstelės ir ląstelių grupės, išsklaidytos per inksto parenchimą, primenančios onkocitinę histologiją, ty oncocitozę, vykdo mtDNR mutacijas. Šios ląstelės greičiausiai sukelia onkocitomas, o tai leidžia manyti, kad mtDNR mutacija gali būti pagrindinis šių navikų įvykis ir ilgainiui lems gerybinio naviko fenotipą. Remiantis Warburgo efektu, 15 mtDNR mutacijų gali suteikti ląstelei pradinį augimo pranašumą 34, tačiau tikimasi, kad norint suaktyvinti naviko augimą, pradedantį šias ląsteles, reikia papildomų hitai, paveikiančių navikų slopintuvus ar onkogenus.

BMF inkstų navikai buvo dažnai aprašomi esant BHD sindromui, kurį sukėlė lytinių ląstelių mutacijos FLCN . 37 Šie navikai dažniausiai būna chromofobiniai ir hibridiniai onkocitiniai navikai, tačiau onkocitomos būna nedažnos. Įrodyta, kad 38 BHD navikai turi molekulinius požymius, kurie skiriasi nuo sporadinių onkocitomų ir chromofobinio RCC. 39 Čia parodome, kad BHD sergančių pacientų navikai neturi patogeninių mtDNR mutacijų, o tai iš esmės prieštarauja ardančioms mutacijoms visose analizuotose sporadinėse ir BMF inkstų onkocitomose. Nepaisant to, šie duomenys atitinka anksčiau paskelbtą ataskaitą, apibūdinančią BHD sindromu sergančiam pacientui išsivysčiusį parotidinę onkocitomą, kurioje mtDNR mutacijų nerasta. 40 Manoma, kad dėl atsitiktinių onkocitomų mtDNR mutacijos sukelia kvėpavimo nepakankamumą, kuris sukelia kompensacinį poveikį, sukeliantį mitochondrijų biogenezę (apžvalgą žr. Gasparre ir kt., 41 ). Tačiau neatmetama galimybė, kad mitochondrijų apykaitos takų defektas gali lemti mitokondrijų trūkumų kaupimąsi onkocitomose. Kita vertus, BLC navikų FLCN mutacijos gali lemti padidėjusią mitochondriją ir dėl to fenokopijos sporadines onkocitomas, tačiau be patogeninių mtDNR mutacijų. Mitochondrijų ir su OXPHOS susiję genai yra labai ekspresuojami BHD navikuose 39 ir neseniai įrodytas FLCN vaidmuo reguliuojant mitochondrijų biogenezę per PGC1a, nepažeidžiant mitochondrijų funkcijos. Dėl šios priežasties, jei mtDNR mutacijos turėtų būti laikomos daugiažidininių onkocitomų diagnostiniais žymenimis, svarbu atmesti galimybę, kad pacientą paveikė BHD sindromas.

Keletas ankstesnių tyrimų parodė, kad daugelis navikų, 21 ir ypač inkstų navikai, sukelia somatinius mitochondrijų genomo pakitimus, kurie dažniausiai buvo heteroplazminiai ir neturėjo arba tik mažai turėjo patogeninį poveikį. 17, 18 Todėl chromosofobų, papiliarinių ir ccRCC serijose parodome, kad daugelyje šių navikų dažniausiai būna heteroplazminės somatinės mtDNR mutacijos. Tik vieno paciento, turinčio BMF eozinofilinį chromofobų RCC, naviko mėginiai aiškiai sukėlė patogenines mutacijas. Tačiau šis pacientas turi neįprastą šeimos istoriją, kuri gali parodyti paveldimą komponentą ir turi būti toliau tiriama. Neseniai atlikta išsami chromofobų RCC genominė analizė atskleidė reikšmingą mtDNR mutacijų buvimą chromofobų RCC eozinofiliniame potipyje. Įrodyta, kad inkstų onkocitomos išreiškia žemą CI genų lygį, bet aukštą CIV genų kiekį, palyginti su chromofobų RCC. 14 Mūsų rezultatai tvirtai rodo, kad šį molekulinį fenotipą lemia mtDNR mutacijų buvimas onkocitomose ir tokių mutacijų nebuvimas neeozinofiliniame chromofobų RCC. Tačiau ryšį tarp mtDNR mutacijų ir eozinofilinio chromofobinio RCC reikia toliau tirti.

Inkstų masės diagnozei nustatyti ir pacientų gydymui dažnai atliekamos įvairios vaizdavimo metodikos, taip pat perkutaninė biopsija. 5 Tačiau onkocitomas dažnai sunku atskirti nuo kitų inkstų navikų tipų vaizduojant ir atliekant biopsijas. 5 Genetiniai tyrimai galėtų pagerinti onkocitomos diagnozę, kai histologinės analizės nėra aiškios. Įrodyta, kad įmanoma atlikti genetinius biopsijų tyrimus. 42, 43 Čia parodyta, kad įmanoma sekti visą mitochondrijų genomą ant DNR, išgautos iš naviko biopsijų, ir kad mitochondrijų biopsijų sekos atitinka naviko seką. Kadangi žinoma, kad navikai yra nevienalytiški jų molekuliniame kraštovaizdyje, skirtingose ​​biopsijose gali būti nustatyta 19 skirtingų heteroplazminių somatinių mtDNR mutacijų lygių. Tačiau onkocitomos dažniausiai yra homoplazminės dėl patogeninių mtDNR mutacijų, todėl mutaciją turėtų pateikti kiekvienas biopsijos pavyzdys. Dėl šios priežasties biopsijos mėginio sekos nustatymas, galbūt be histologinės analizės, galėtų padėti patikimai diagnozuoti inkstų onkocitomas ir numatyti gerybinį naviko fenotipą. 15

Apibendrinant, čia parodome, kad panašiai kaip anksčiau pranešta apie sporadines onkocitomas, 11, 13 ardančios mtDNR mutacijos, veikiančios kvėpavimo grandinės I kompleksą, yra BMF inkstų onkocitomų požymiai. Tie navikai gali atsirasti dėl inkstų onkocitozės, kai visos oncocitinės ląstelės ir židiniai turi mtDNR mutaciją. Kita vertus, su BHD susiję inkstų navikai vyksta skirtingais patogeniniais procesais ir dažniausiai neturi mtDNR mutacijų. Tas pats pasakytina apie neoncocitinius inkstų navikus, turinčius skirtingą histologiją. Taigi mes pademonstruojame mtDNR mutacijų vaidmenį kuriant inkstų onkocitomas su laukinio tipo FLCN ir siūlome, kad mtDNR sekos nustatymas, įmanomas atliekant biopsijos mėginius, ar kvėpavimo grandinės kompleksų analizė, turėtų būti toliau tiriami kaip patikimi inkstų diagnostiniai žymenys. onkocitomos.

Papildoma informacija

„Word“ dokumentai

  1. 1.

    Papildoma informacija

    Papildoma informacija pridedama prie dokumento Šiuolaikinės patologijos svetainėje (//www.nature.com/modpathol)