Nervų augimo faktorius skatina virkštelės formavimąsi mezenchiminėse kamieninėse ląstelėse, skatindamas proliferaciją ir aktyvindamas pi3k / akt signalizacijos kelią | acta pharmaologica sinica

Nervų augimo faktorius skatina virkštelės formavimąsi mezenchiminėse kamieninėse ląstelėse, skatindamas proliferaciją ir aktyvindamas pi3k / akt signalizacijos kelią | acta pharmaologica sinica

Anonim

Anotacija

Tikslas:

Ištirti, ar nervų augimo faktorius (NGF) sąlygojo kaulų čiulpų mezenchiminių kamieninių ląstelių (MSK) angiogenezę ir pagrindinius mechanizmus.

Metodai:

Kaulų čiulpų MSCs buvo išskirti iš Sprague-Dawley žiurkės šlaunikaulio ar blauzdikaulio ir kultivuoti. Ląstelės buvo išgrynintos po 3–5 praėjimus, pasėtos ant „Matrigel“ dengtų 24 šulinėlių plokštelių ir apdorotos NGF. Vamzdžių formavimasis buvo pastebėtas po 24 valandų. Tropomiozino giminingos kinazės A (TrkA) ir p75NTR geno ekspresija buvo tiriama naudojant PGR analizę ir srauto citometriją. Augimo kreivės buvo nustatytos skaičiuojant ląsteles. VEGF ir pAkt / Akt raiška buvo analizuojama naudojant Western blot.

Rezultatai:

NGF (25, 50, 100 ir 200 μg / l) skatino vamzdelių susidarymą MSC. Vamzdelių ilgis pasiekė maksimalų 2, 24 karto padidėjimą, kai ląstelės buvo apdorotos NGF (50 μg / L). NGF (50 μg / L) žymiai padidino Akt fosforilinimą. Pirminis gydymas specifiniu PI3K inhibitoriumi LY294002 (10 μmol / L) blokavo NGF stimuliuojamą Akt fosforilinimą, vamzdelių formavimąsi ir angiogenezę. NGF (25–200 μg / L) nepadarė įtakos TrkA ir kraujagyslių endotelio augimo faktoriaus (VEGF) raiškai, tačiau reikšmingai slopino p75NTR raišką. NGF (50 μg / L) pastebimai padidino MSC plitimą.

Išvada:

NGF skatino MSC proliferaciją ir suaktyvino PI3K / Akt signalizacijos kelią, kuris gali būti atsakingas už MSF angiogenezės NGF indukciją.

Įvadas

Kamieninių ląstelių transplantacija yra vienas iš naujausių terapinių metodų, siūlomų pagerinti pacientų, sergančių širdies nepakankamumu ar infarktu, rezultatus 1, 2 . Mesenchiminės kamieninės ląstelės (MSC) yra klonogeninių ląstelių grupė, galinti diferencijuoti įvairias linijas ir savarankiškai daugintis. Jie gali diferencijuoti į mezodermos tipo ląsteles, tokias kaip osteoblastai, adipocitai ir chondrocitai. MSC yra suaugusiųjų audiniuose, ypač kaulų čiulpų stromoje 3, 4 . MSC transplantacija galėtų pagerinti pacientų, patyrusių miokardo infarktą, rezultatus. Šio metodo pagerėjimo priežastis vis dar nežinoma, tačiau autokrininio ir paracrininio augimo mechanizmai bei angiogenezė yra tikėtini kandidatai 5 .

Periferinėje ir centrinėje nervų sistemose NGF vaidina lemiamą vaidmenį reguliuojant 6 ir 7 neurocitų augimą, diferenciaciją ir išgyvenimą. Šį fiziologinį poveikį skatina dviejų tipų membraniniai receptoriai: tirozino kinazės receptoriaus A ( TrkA ), kuris turi aukštą afinitetą NGF, ir p75 neurotropinų receptoriaus ( p75NTR ), kuris turi žemą afinitetą NGF 8 . Ląstelinį NGF poveikį daugiausia skatina didelio afiniteto receptorius TrkA 9 .

Fiziologinis NGF poveikis neuronų išgyvenimui ir diferenciacijai buvo gerai aprašytas, ir dabar yra vis daugiau įrodymų, kad NGF gali sukelti angiogenezę fiziologinėmis ir patologinėmis sąlygomis 10, 11, 12, 13 . Vis dėlto neaišku, ar NGF galėtų pagerinti angiogenezę MSC.

Šiame tyrime mes ištyrėme NGF poveikį MSC angiogenezei. Mūsų išvados parodė, kad NGF gali skatinti MSC angiogenezę in vitro skatindamas proliferaciją ir aktyvuodamas PI3K / Akt signalizacijos kelią.

medžiagos ir metodai

MSC izoliacija ir išplėtimas

MSC buvo išskirti ir surinkti kaip aprašyta anksčiau 14 . Trumpai tariant, buvo paaukotos „Sprague-Dawley“ žiurkės (svoris: 80 g, 2–3 savaitės), o kaulų čiulpų mėginius surinkome praplaudami jų šlaunikaulio ir blauzdikaulio ertmes mažai gliukozės turinčia Dulbecco modifikuota „Eagle“ terpe (DMEM-LG). Mėginiai buvo perkelti į sterilius centrifugos mėgintuvėlius. Vamzdeliai buvo centrifuguojami 900 x g 5–8 minutes. Nuosėdos buvo pakartotinai suspenduotos DMEM-LG, turinčiame 10% galvijo vaisiaus serumo (FBS) (Sijiqing, Zhejiang, Kinija), penicilino (100 V / ml) ir streptomicino (100 g / L), po to pasėjamos į 25 cm 2 kolbas ( Falcon, Oxnard, CA, JAV) ir kultivuojami 37 ° C temperatūroje drėgname ore su 5% CO 2 . Po 24 valandų terpė buvo pakeista ir pašalintos nesusijusios hematopoetinės ląstelės. Veleno formos lipnios MSC buvo išplėstos ir išgrynintos 3–5 praėjimais po pirminio padengimo.

Srauto citometrijos analizė

Norint identifikuoti MSC paviršiaus žymenis ir ištirti p75 raišką, buvo atlikta srauto citometrijos analizė. MSC buvo pakeltos 0, 25% tripsino ir praplautos fosfatu buferiniu druskos tirpalu (PBS). Ląstelės buvo centrifuguotos 5 minutes 900 x g , pakartotinai suspenduotos 0, 5 ml PBS ir pridėtas pirminis antikūnas (CD34, CD45: Santa Cruz, CA. CD29-PE: eBioscience, USA. CD31-PE, CD90-FITC: BD, P75 : Abcam, Kembridžas, JK). Mėginiai buvo inkubuojami kambario temperatūroje 1 valandą. Po to, kai ląstelės buvo išplautos PBS, jos buvo inkubuotos su antriniu antikūnu 1 valandą ir analizuojamos srauto citometrijos metodu.

Diferenciacija

Adipogeninė diferenciacija

Passage p5 MSCs buvo pasėtos 5x104 ląstelėmis, auginamomis kultūros plokštelėse DMEM-LG. Kitą dieną terpė buvo pakeista adipogenine indukcine terpe, sudaryta iš aukštos gliukozės koncentracijos DMEM (DMEM-HG) su 1 μmol / L deksametazono (Sigma-Aldrich, Sent Luisas, MO, JAV), 0, 2 mmol / L indometacino (Sigma), ir 1 × skystos terpės papildas (ITS) (Sigma). Laikmenos buvo keičiamos kas tris dienas. Po 10 dienų indukcijos, tiriant adipogeninę diferenciaciją, buvo naudojamas dažymas raudonuoju O (Sigma). Ląstelės buvo stebimos ir fotografuojamos apverstu mikroskopu.

Chondrocitų diferenciacija

Chondrocitų diferenciacija buvo atlikta naudojant ląstelių adhezinės kultūros metodus. MSC buvo kultivuojami DMEM-HG su 10 μg / l, transformuojančiu augimo faktorių β 3 (Santa Cruz), 100 μmol / L deksametazono ir 50 μmol / l askorbo rūgšties (Sigma). Laikmenos buvo keičiamos kas tris dienas. Po 14 dienų chondrocitų diferenciacijai ištirti buvo naudojamas mėlynasis toluidino dažymas.

Matrigelo tyrimas

Laido formavimas buvo suaktyvintas naudojant Matrigel (Sigma) 15 . MSC laido formavimosi tyrimui 200 μL Matrigel buvo išklijuota ant 24 šulinėlių plokštelės šulinio ir inkubuota 1 valandą 37 ° C temperatūroje. Tuomet MSC buvo tripsinuoti, suspenduoti ir susodinti į Matrigel (1 × 105 ląstelių / duobutėje). MSC buvo gydomi NGF (R&D Systems, Minneapolis, MN) skirtingomis koncentracijomis (0, 25, 50, 100 ir 200 μg / l) su specifiniu PI3K inhibitoriumi LY294002 arba be jo, LY294002 (10 μmol / L) (Sigma). Stebėtas MSC laido formavimo gebėjimas ir nufotografuotas naudojant apverstos fazės kontrasto mikroskopą po 24 val. Paveikslėliai buvo paimti iš trijų bandymų ir išmatuotas MSC vamzdžių ilgis naudojant „Image-Pro Plus“.

Imunocitochemija

MSC buvo auginami „Matrigel“ ant 24 duobučių plokštelių, švelniai nuplėšta terpė ir du kartus plaunama PBS. Ląstelės buvo fiksuotos 10% paraformaldehide (ištirpinta PBS) 30 minučių 37 ° C temperatūroje ir permeabilizuotos panardinant į 0, 5% TritonX-100 15 minučių. Po plovimo PBS, ląstelės buvo užblokuotos 5% FBS / PBS 1 val., Tada paženklintos atitinkamais pirminiais antikūnais (vWF: Santa Cruz, GAP43: Abcam). Po vienos nakties inkubacijos 4 ° C temperatūroje, ląstelės buvo praplaunamos ir inkubuojamos su TRITC konjuguotais antriniais antikūnais 1 h kambario temperatūroje, po to plaunamos ir inkubuojamos su Hoechst 33258 (Invitrogen, CA, JAV). Ląstelės buvo analizuojamos fluorescenciniu mikroskopu (Olympus, Tokijas, Japonija).

Atvirkštinės transkripcijos polimerazės grandininė reakcija (RT-PGR) ir realaus laiko PGR analizė

Bendra RNR buvo ekstrahuota naudojant Trizol reagentą (Invitrogen, JAV), norint analizuoti genų ekspresiją MSC. RNR buvo transkribuota atvirkščiai, kad gautų cDNR. P75 pradmenų PGR sekos buvo: 5 ′ TTGCTTGCTGTTGGAATGAG 3 ′ (pirmyn), 5 ′ AGCTCCTGGGGAGGAAAATA 3 ′ (atvirkštinė) (Sangonas, Šanchajus, Kinija). TrkA pradmenų sekos buvo 5 ′ GTCTGGTGGGTCAGGGACTA 3 ′ (pirmyn), 5 ′ GGGTTGCTTTCCATAGGTGA 3 ′ (atvirkštinė) (Sangonas). GAPDH pradmenų sekos buvo 5 ′ AGACAGCCGCATCTTCTTGT 3 ′ (pirmyn), 5 ′ CTTGCCGTGGGTAGAGTCAT 3 ′ (atvirkštinė) (Sangonas). P75 geno ekspresijos realiojo laiko PGR analizė buvo atlikta naudojant ABI PRISM 7000 sekos aptikimo sistemą, naudojant SYBR Green I realaus laiko PGR rinkinį (Bioer, Hangdžou, Kinija). Santykinis genų ekspresijos kiekybinis įvertinimas buvo atliktas naudojant 2 -ΔΔCt metodą. TrkA geno ekspresijos analizė buvo atlikta naudojant RT-PCR. Produktams analizuoti atlikta agarozės gelio elektroforezė (1, 7%).

Western blot analizė

MSC buvo surinkti į Eppendorfo mėgintuvėlį, po to 30 minučių lizuojami RIPA lizės buferiu (Beyotime, Šanchajus, Kinija). Ląstelių ir branduolių lizatai buvo centrifuguoti 13 000 x g greičiu 25 minutes 4 ° C temperatūroje. Mėginiai, kurių sudėtyje yra vienodi baltymų kiekiai (60 μg), buvo paimti ant SDS-PAGE gelių ir perkelti į PVDF membranas. Membranos buvo užblokuotos 0, 1% Tween-20 TBS (TBS-T), turinčiomis 1% BSA, 1 val. Tada membrana buvo inkubuota praskiestuose pirminiuose antikūnuose (VEGF ir β-aktinas: Santa Cruz, JAV. Akt, pAkt: Cell Signaling Technology, Beverly, MA, JAV). Po plovimo 0, 1% TBS-T membranos buvo inkubuojamos 2 valandas su HRP konjuguotais antriniais antikūnais. Juostas vizualizavo ECL. Kiekis Kiekvienos juostos baltymų kiekiui pusiau kiekybiškai įvertinti buvo naudojama viena programinė įranga.

Ląstelių augimo kreivė

Vienodas skaičius (5 × 10 3 ) MSC su NGF arba be jo buvo dedami į 24 šulinėlių plokšteles. Ląstelių skaičius buvo nustatytas naudojant ląstelių skaičiavimo kamerą 0, 1, 2, 3, 4 ir 5 d. Po ląstelių įdėjimo. Kiekvienam laiko taškui buvo naudojami trys šulinėliai.

Statistinė analizė

Duomenys buvo išreikšti kaip vidurkis ± SD ir išanalizuoti naudojant SPSS 16.0 statistinę programinę įrangą (SPSS Inc, Chicago, IL). Statistinė analizė buvo atlikta naudojant vienpusę ANOVA, o P vertė <0, 05 buvo laikoma statistiškai reikšminga.

Rezultatai

MSC apibūdinimas

Norėdami parodyti, kad ląstelės, išskirtos iš žiurkių kaulų čiulpų, iš tikrųjų buvo MSC, mes ištyrėme jų diferenciacijos gebą ir fenotipinius žymenis. MSC pasirodė verpstės formos ir prilipo prie kolbos dugno (1A pav.). Po adipogeninės indukcijos 10 dienų, MSC buvo gausus vakuolių kiekis, o „Oil Red O“ dažymas parodė, kad šiose vakuolėse yra neutralių lipidų (1B paveikslas). Po chondrogeninės indukcijos MSC parodė mechromaziją po gydymo toluidino mėlyna (1C pav.). Šie rezultatai rodo, kad MSC diferencijuojasi į adipocitus ir chondrocitus. Srauto citometrija parodė, kad MSC yra neigiami kraujodaros žymekliams CD31, CD34 ir CD45, tačiau teigiami MSC žymekliams CD29 ir CD90 (1D pav.).

Image

Mezenchiminių kamieninių ląstelių (MSC) apibūdinimas. (A) MSC reprezentacinis morfologinis vaizdas. Didinimas × 100. (B) Aliejinis raudonasis O, dažantis adipogeninę MSC indukciją. Didinimas × 200. (C) Chondrogeninės indukcinės terpės sukeltų MSC dažymas mėlyna spalva toluidinu. Didinimas × 200. (D) Ląstelių paviršiaus žymenų išraiška auginamuose MSC. Srauto citometrijos analizė parodė, kad pasirinktų žymeklių teigiamumas buvo toks: CD29 99, 6%, CD90 99, 3%, CD31 2, 4%, CD34 1, 5%, CD45 3, 2%.

Visas dydis

NGF skatino MSC laidų formavimąsi Matrigelyje

3D matrigel rūsio modeliai iš arti imituoja neovaskuliarizacijos mikroaplinkos struktūrą, sudėtį, fizines savybes ir funkcines savybes. Norint įvertinti NGF poveikį angiogenezei MSC, atlikti Matrigel tyrimai. Po 24 valandų inkubacijos MSC suformavo mėgintuvėlius ir tinklus Matrigel rūsio modeliuose in vitro (2A pav.). Po 24 val. Auginimo NGF, MSC gebėjimas formuoti mėgintuvėlius padidėjo. Kaip parodyta 2B – 2E pav., Mėgintuvėlių skaičius ir vamzdžių ilgis buvo padidintas NGF apdorotų MSC grupėse, palyginti su kontrolinėmis grupėmis. NGF 50 ir 100 μg / L sustiprino laidų susidarymą MSC ( P <0, 05) (2F paveikslas). Vamzdinis 50 μg / l NGF apdorotų MSC vamzdžių ilgis buvo 2, 24 karto didesnis nei kontrolinių. Šie eksperimentai buvo atlikti naudojant 50 μg / l NGF.

Image

NGF skatino virvelių susidarymą mezenchiminėse kamieninėse ląstelėse (MSC), aptiktas Matrigel tyrimu. (A) „Matrigel“ vamzdelio susidarymo MSC, kultivuojamuose be NGF, foto mikrografija po 24 val. (B) MSC, kultivuojami NGF 25 μg / L ant matrigelo. (C) MSC, kultivuojami NGF 50 μg / L ant matrigelo. (D) MSC, kultivuojami NGF 100 μg / L ant matrigelio. (E) MSC, kultivuoti su NGF 200 μg / L ant matrigelo. Didinimas buvo × 200. (F) NGF padidino MSC vamzdelių susidarymą priklausomai nuo dozės, o poveikis pasiekė piką esant 50 ng / ml. Duomenys pateikiami kaip vamzdelio ilgis, palyginti su kontrole. Kiekvienoje grupėje pateikiami bent trijų nepriklausomų eksperimentų rezultatai trimis egzemplioriais. Rezultatai išreiškiami kaip vidurkis ± SD. b P <0, 05, palyginti su kontroline grupe.

Visas dydis

Matrigelyje išaugintos MSC gali diferencijuotis į endotelio ląsteles

Matrigel buvo plačiai naudojamas ląstelių kultūroje, o Matrigel tyrimas yra plačiai žinomas kaip angiogenezės modelis in vitro . Von Willebrand faktorius (vWF) yra paviršiaus žymeklis, naudojamas endotelio ląstelėms identifikuoti. MSC, sudarančios vamzdelius Matrigelyje, išreiškė vWF, kuris buvo naudojamas kaip specifinis endotelio ląstelių žymeklis (3B paveikslas). Tačiau MSC, kurie nesudarė mėgintuvėlių, buvo neigiami vWF. Šis rezultatas parodė, kad Matrigelyje susiformavę vamzdeliai gali diferencijuotis į endotelio ląsteles. Kadangi Matrigel taip pat gali palaikyti neuronų pirmtakų ląstelių 16 neuronų diferenciaciją, mes ištyrėme, ar MSC diferencijuojasi į neurocitus. MSC teigiamai išreiškė ankstyvuosius neuronų žymenis ir kai kuriuos subrendusius neuronų žymenis. Imunofluorescencinė analizė parodė, kad MSC buvo neigiami GAP43 tiek prieš auginimą, tiek po jo auginimo Matrigelyje (3C pav.). RT-PGR analizė parodė, kad išankstinis gydymas tik NGF neturėjo įtakos β3 tubulino, nestino, neurofilamentų (NF) ar neuronams būdingų enolių (NSE) raiškai (3D paveikslas).

Image

Matrigelyje užauginti MSC buvo teigiami dėl vWF ir neigiami GAP43, nustatyti imunofluorescencinės analizės būdu. (A) MSC buvo neigiami vWF prieš kultivuojant matrigele. Didinimas × 400. (B) Po kultivavimo matrigele 24 valandas, MSC suformavo mėgintuvėlius ir buvo teigiami vWF. Didinimas × 200. (C) GAP43 raiškos imunofluoresenso vaizdas MSC, auginamuose matrigele. Didinimas × 400. Branduoliai buvo dažyti Hoechst 33258. (D) Neuroninių žymenų (β3 tubulinas, nestinas, NF sunkieji, NSE) raiškos MSC buvo tiriamos realaus laiko PGR. MSC 24 valandas buvo gydomi NGF arba be jo. P > 0, 05, palyginti su kontroline grupe.

Visas dydis

Įtaka TrkA ir p75 receptorių ekspresijai

TrkA geno ekspresija buvo tiriama naudojant RT-PGR. Bendra RNR buvo ekstrahuota po to, kai MSC nebuvo apdoroti arba apdoroti NGF 24 valandas. Kaip parodyta 4A paveiksle, TrkA mRNR ekspresija buvo vos aptinkama ir NGF neturėjo jokios įtakos jokiai koncentracijai. Tačiau realiojo laiko PGR parodė, kad gydymas NGF sumažino p75 mRNR raišką (4B paveikslas). Tai sukėlė genų ekspresijos sumažėjimą 0, 27 - 0, 55 karto NGF apdorotoje MSC grupėje, palyginti su kontrolinėmis grupėmis, o NGF koncentracija 50 μg / L parodė stipriausią slopinantį poveikį. Be to, srauto citometrija dar labiau patvirtino p75 geno ekspresijos slopinimą NGF (4C pav.).

Image

TrkA ir p75 ekspresijos PGR ir FACS analizė. (A) Visa RNR buvo išskirta iš MSC, apdorotų ar neapdorotų NGF. TrkA ir namų tvarkymo genas (GAPDH) buvo analizuojami RT-PCR metodu. (B) Duomenys buvo išreikšti kaip TrkA kartų pokytis, palyginti su kontrole. (C) MSC P75NTR ir GAPDH genų ekspresijos skirtingomis koncentracijomis buvo tiriamos realaus laiko PGR. Duomenys buvo pateikti su trijų pakartojimų vidurkiu ± SD. b P <0, 05, palyginti su kontroline grupe. (D) Įvairių NGF koncentracijų poveikis P75NTR baltymų MSC kiekiui buvo ištirtas FCS. Teigiamų ląstelių procentas buvo nurodytas skliausteliuose.

Visas dydis

PI3K / Akt signalizacijos kelio suaktyvinimas MSC

Western blot eksperimentai buvo naudojami nustatyti signalizacijos kelią pasroviui, dalyvaujantį NGF sukeltos virvelės formavime MSC. Rezultatai atskleidė, kad fosforilinta Akt forma, kuri yra PI3K pasroviui pasklidusi dalis, padidėjo NGF apdorotuose MSC per 1 valandą po gydymo (5A pav.). LY294002 buvo naudojamas slopinti PI3K aktyvaciją, kuri slopino pAkt raišką, suaktyvintą NGF (5B pav.). LY294002 (10 μmol / L) pridėjimas prie kultūrų, turinčių 50 μg / l NGF, beveik visiškai susilpnino NGF sukeltą kapiliarų struktūrą (5C – 5G paveikslas).

Image

PI3K / Akt signalizacijos kelio, skatinančio laidų formavimąsi, poveikis. (A) pAkt ir Akt Western blot analizė nurodytais laiko momentais po apdorojimo NGF (50 μg / L). (B) NGF apdorotų MSC pAkt ir Akt Western blot analizė. Ląstelės buvo iš anksto apdorotos LY294002 (10 μmol / L) arba be jo 1 valandą, o po to 1 valandą stimuliuojamos su NGF arba be jo (50 μg / L). b P <0, 05, palyginti su kontroline grupe. e P <0, 05, palyginti su NGF, gydytais MSC. (C) Fotomikrografas rodo, kad matricos vamzdelyje susidaro MSC, kultivuojami be NGF. (D) MSC, kultivuojami NGF (50 μg / L) ant matrigelo 24 valandas. (E) MSC 1 valandą iš anksto apdoroti LY294002 (10 μmol / L) ir 24 valandas kultivuoti NGF (50 μg / L) matrigeliu. Didinimas × 200. (F) MSC, kultivuojami DMSO (1 μmol / L) 24 valandas matrigele. (Kadangi LY294002 buvo ištirpintas DMSO, todėl įvertinome DMSO poveikį MSC virvelių formavimuisi.) (G) LY294002 susilpnino angiogeninį NGF poveikį. Duomenys atspindėjo trijų nepriklausomų eksperimentų duomenis. Rezultatai išreiškiami kaip vidurkis ± SD. b P <0, 05, palyginti su kontroline grupe. e P <0, 05, palyginti su NGF, gydytais MSC.

Visas dydis

MSC platinimo stiprinimas

Padidėjęs MSC angiogenezės potencialas po NGF paruošimo paskatino mus ištirti, ar jis nėra susijęs su padidėjusiu MSC proliferacija. 6 paveiksle pavaizduotos neapdorotų MSC ir 50 μg / l NGF apdorotų MSC augimo kreivės. Po 1 dienos apdorojimo NGF ląstelių augimas pastebimai padidėjo, o laikui bėgant augimo tendencija padidėjo.

Image

MSC augimo kreivės su NGF arba be jos. Ląstelių skaičiavimo metodas buvo taikomas tiriant MSC proliferacijos galimybes. Duomenys atspindėjo trijų nepriklausomų eksperimentų duomenis.

Visas dydis

NGF neturėjo įtakos VEGF raiškai

Norėdami nustatyti, ar NGF skatinamas MSC virvelių susidarymas buvo susijęs su VEGF ekspresija, nustatėme VEGF ekspresijos lygį gydomuose ir negydytuose MSC. 7 paveikslas rodo, kad gydymas NGF neturėjo reikšmingo poveikio VEGF ekspresijos lygiui MSC.

Image

Gydymas NGF neturėjo įtakos VEGF raiškos lygiui MSC. Buvo atliktas Western blot tyrimas, siekiant įvertinti VEGF raišką MSC po apdorojimo NGF arba be jo (50 ir 100 μg / l). Β-aktinas normalizavo Western blot vaizdą ir VEGF kiekį. P > 0, 05 palyginti su kontroline grupe.

Visas dydis

Diskusija

Pagrindinės šio tyrimo išvados buvo šios: (1) NGF gali sukelti MSC virkštelės susidarymą Matrigel in vitro . (2) NGF neturėjo įtakos TrkA mRNR ekspresijai, tačiau galėjo slopinti p75 ekspresiją MSC. (3) NGF skatinamos MSC angiogenezės poveikį gali lemti PI3K / Akt signalizacijos kelias. Tai taip pat gali būti siejama su MSC proliferacijos skatinimu ir neturi jokio ryšio su VEGF raiška MSC.

Buvo pranešta, kad MSC transplantacija pagerina miokardo funkciją po miokardo infarkto, tačiau pagrindiniai mechanizmai dar turi būti išsiaiškinti 4 . Naujausi įrodymai rodo, kad kaulų čiulpų MSC implantavimas į miokardą sukėlė revaskuliarizaciją ir šios MSC gali išsiskirti į endotelio ląsteles po miokardo infarkto 5, 17 . MSC angiogenezės gerinimas gali būti naudingas gerinant miokardo funkciją, ir daugelis tyrimų buvo skirti šiam tikslui pasiekti. Pavyzdžiui, Annabi ir kt. Nustatė, kad hipoksinės kultūros sąlygos gali greitai sukelti MSC migraciją ir trijų matmenų kapiliarų struktūros susidarymą Matrigelyje per parakrino ir autokrininius reguliavimo mechanizmus 18 . Wu ir kt. Nustatė, kad kalcis buvo teigiamas CXCR4 ekspresijos reguliatorius, kuris sustiprino kaulų čiulpų kamieninių ląstelių proangiogenezės terapiją 19 . Šiame tyrime mes sutelkėme dėmesį į NGF reguliavimą MSC vamzdžių formavime ir ištyrėme galimą mechanizmą, kuris už jo slypi.

Įrodyta, kad NGF tiesiogiai ir netiesiogiai sukelia angiogenezę. NGF gali sukelti specifinių baltymų, įskaitant VEGF ir MMP-2, ekspresiją ir gali prisidėti prie endotelio ląstelių 10, 11, 12, 13, 20, 21 palaikymo, išgyvenimo ir funkcijos. Mes nustatėme, kad NGF skatino MSC virvelių formavimąsi auginant Matrigel, tai patvirtina 2, 24 karto padidėjęs vamzdelių ilgis, kai auginama 50 μg / l NGF koncentracija.

„Matrigel“ tyrimas paprastai laikomas eksperimentiniu metodu, kuriuo išmatuojamas ląstelių gebėjimas skatinti angiogenezę in vitro 15, taip pat naudojamas palaikyti neuronų pirmtakų ląstelių diferenciaciją į neuronų ląsteles 16 . NGF yra bendras neurotrofinis faktorius, todėl mums reikėjo atmesti galimybę, kad MSC paprastai turi galimybę diferencijuotis į neuronų ląsteles. Imunofluorescencinės analizės parodė, kad MSC sudaryti vamzdeliai galėjo diferencijuotis į endotelio ląsteles. MSC buvo neigiami GAP43 prieš ir po kultūros Matrigelyje. Dėl teigiamų ankstyvųjų neuronų žymenų ir kelių subrendusių žymenų išraiškos sunku naudoti imunofluorescenciją, kad būtų galima įvertinti, ar ląstelės turi tendenciją diferencijuotis į neurocitus. Realiojo laiko PGR parodė, kad išankstinis gydymas NGF neturėjo įtakos neuronų žymenų raiškai. Todėl manome, kad ląstelės nebuvo diferencijuojamos į neuronus.

Rezultatai parodė, kad vamzdiniai ilgiai reaguoja į didėjančias NGF koncentracijas panašiai kaip Gauso pasiskirstymas. Nežinoma, ar tokį pasiskirstymą lėmė NGF receptorių reguliavimas. TrkA yra specifinis NGF receptorius ir dalyvauja angiogenezėje 22 . Myung-Jin Park ir kt. Įrodė, kad TrkA aktyvacija sukelia endotelio ląstelių invaziją ir virkštelės formavimąsi 20 . Tačiau mūsų rezultatai parodė, kad TrkA mRNR buvo sunkiai aptinkama MSC, o gydymas NGF neturėjo reikšmingos įtakos TrkA ekspresijos lygiams. Western blot analizė dar patvirtino, kad MSCs turėjo žemą TrkA baltymo ekspresijos lygį (duomenys nepateikti). P75NTR yra žemo afiniškumo NGF receptoriai. Mūsų nuostabai, tiek realaus laiko PGR, tiek srauto citometrijos analizės parodė, kad NGF galėjo slopinti p75 receptorių ekspresiją MSC, o p75 pozityvios ląstelės sudarė tik 6, 4% populiacijos. Ankstesni tyrimai rodo, kad p75NTR per didelė ekspresija gali skatinti apoptozę. Mes nustatėme, kad TrkA ir p75 buvo mažai išreikštos kaulų čiulpų MSC, todėl postuliavome, kad p75 slopinimas gali būti susijęs su NGF poveikiu skatinant MSC proliferaciją ir jo ryšį su MSC angiogeneze. Kadangi mūsų eksperimentai rodo žemą TrkA ir p75NTR ekspresijos lygį, gali būti ir kitų mechanizmų, kuriuos reikia toliau tirti.

Pranešama, kad PI3K / Akt signalizacijos kelias dalyvauja angiogenezėje endotelio ląstelėse ir vaidina svarbų vaidmenį fiziologiniam NGF poveikiui, ypač angiogenezės procese 22 . Park et al parodė, kad NGF stimuliuoja endotelio ląstelių invaziją ir virkštelės formavimąsi ir kad PI3K / Akt signalizacijos kelias gali būti atsakingas už angiogenezės sukėlimą 20 .

Daugybė ataskaitų parodė, kad PI3K / Akt signalizacijos kelias yra labai svarbus MSC proliferacijai, antiapoptozės ir migracijos procesams ir skatina angiogenezę per specifinę stimuliaciją 23, 24 . Suaktyvinus PI3K, gali suaktyvėti receptorių-PI3K kompleksai, o po to Akt aktyvuoti antruoju pasiuntiniu. Fosforilinimo būdu aktyvuotas Akt tarpininkavo kelių taikinių aktyvacijai ir slopinimui, todėl įvairiais mechanizmais atsirado ląstelių augimas, išgyvenimas ir proliferacija 25 .

Mūsų Western blot analizės rezultatai parodė, kad NGF stimuliavo Akt fosforilinimą MSC. LY294002 PI3K p110 subvieneto katalizinio aktyvumo slopinimas daugelį metų buvo plačiai naudojamas in vitro 25 . Matrigel tyrimas parodė, kad NGF sukeltas MSC vamzdelio susidarymas buvo visiškai užblokuotas LY294002. Naudodami specifinį kinazės inhibitorių, mes parodėme, kad PI3K / Akt signalizacijos kelias yra labai svarbus NGF sukeltų MSC vamzdžių formavimui Matrigel in vitro .

Ląstelių proliferacija vaidina svarbų vaidmenį angiogenezėje. Mes panaudojome ląstelių augimo kreivės metodą, kad įvertintume, ar padidėjęs NGF apdorotų MSC angiogeninis potencialas yra susijęs su padidėjusiu proliferacija. Mes nustatėme, kad NGF gali pastebimai skatinti MSC platinimą. Angiogenezės metu NGF gali skatinti MSC sudygimą ir proliferaciją vamzdelių formavimo metu.

Buvo pranešta, kad NGF reguliavo VEGF ekspresiją tiek in vitro, tiek in vivo . NGF gali skatinti endotelio ląstelių augimą, kuris yra susijęs su padidėjusia VEGF ekspresija. Dėl šios padidėjusios išraiškos gali būti kapiliarų dygimas 26 . VEGF yra svarbus tarpininkas kraujagyslių hiperpermeabiliteto, angiogenezės ir uždegimo srityse. Šie procesai yra glaudžiai susiję su audinių atstatymu ir regeneracija 27 . NGF vaidino funkcinį vaidmenį reparatyvinėje neovaskuliarizacijoje per VEGF tarpininkaujantį mechanizmą 10 . Park et al parodė, kad NGF gali sukelti reprezentuojančią angiogenezę suaugusiųjų timos regeneracijos metu padidinus VEGF ekspresiją 13 . Wu ir kt. Parodė, kad kaulų čiulpų MSC stimuliuoja endotelio ląstelių proliferaciją, migraciją ir organizavimąsi kanalėliuose, išreikšdamas aukštą VEGF 28 kiekį . Mūsų duomenys parodė, kad MSC gali sintetinti VEGF. Tačiau VEGF raiška nesiskyrė nei su NGF, nei su kontrolinėmis grupėmis. Mūsų išvados skyrėsi nuo aukščiau aprašytų tyrimų, galbūt dėl ​​skirtingų ląstelių naudojimo. NGF gali skatinti VEGF ekspresiją kraujagyslių endotelio ląstelėse ir užkrūčio epitelio ląstelėse, tačiau jis neturi įtakos VEGF ekspresijai MSC. Atitinkamai mes pasiūlėme, kad NGF sukelta angiogenezė MSC nėra susijusi su VEGF ekspresija.

Angiogenezė yra labai sudėtinga ir susideda iš kelių procesų, įskaitant endotelio ląstelių proliferaciją, migraciją ir invaziją, ir yra būtina jų išgyvenimui. Mes ištyrėme NGF poveikį MSC migracijai atlikdami įbrėžimų testus ir trans-šulinio tyrimus, tačiau pastebėjome, kad NGF nepropagavo migracijos (duomenys nepateikti). Manome, kad MSC angiogenezės sustiprinimas NGF prisideda prie padidėjusio ląstelių proliferacijos ir virkštelės formavimo, nors gali būti ir kitų mechanizmų.

Apibendrinant, šis tyrimas rodo, kad NGF padidina MSC proliferaciją ir suaktyvina PI3K / Akt signalizacijos kelią. Šis poveikis gali vaidinti svarbų vaidmenį angiogenezėje, ir šie rezultatai gali turėti reikšmės gydant miokardo infarktą naudojant MSC transplantaciją.