Preferencinis aldosterono sintazės genų polimorfizmo ryšys su centriniu kraujospūdžiu ir bangų atspindžiais hipertenzija sergantiems asmenims | žmogaus hipertenzijos žurnalas

Preferencinis aldosterono sintazės genų polimorfizmo ryšys su centriniu kraujospūdžiu ir bangų atspindžiais hipertenzija sergantiems asmenims | žmogaus hipertenzijos žurnalas

Anonim

Anotacija

Hipertenzija sergantiems žmonėms aldosterono sintazės geno polimorfizmo (ASGP) CYP11B 2 ( C-344T variantas) CC genotipas susijęs su padidėjusiu aortos standumu. Niekada nebuvo tiriama, ar ASGP yra susijęs su pakitusiais centrinės (karotidinės) bangos atspindžiais. Po vieno mėnesio plovimo 124 hipertenzija sergantiems asmenims buvo išmatuoti smegenų ir miego arterijos sistolinis kraujospūdis (SBP), aortos pulso bangos greitis (PWV) ir bangos atspindžiai, naudojant miego padidėjimo indeksą (CAI), nustatytą pagal pulso bangą. analizė. Buvo išanalizuoti du pagal amžių ir lytį pritaikyti ASGP poveikio modeliai. Palyginus ASGP-CC su ASGP-TT ir -TC genotipais, pirmieji turėjo žymiai stipresnius tarpgrupinius koreliacijos koeficientus pagal amžių ar CAI ir širdies susitraukimų dažnį ( P = 0, 008; P = 0, 02). Pamažu kelios regresijos parodė, kad miego arterijos SBP nepriklausomai paveikė PWV ir CAI, tačiau tik asmenims, turintiems CC ( P = 0, 0002; P = 0, 03) ir TC genotipus ( P = 0, 0004; P = 0, 004). Šios sąsajos nebuvo stebimos arba buvo tik silpnos, naudojant brachialinės arterijos SBP modelį. Apibendrinant, šis tyrimas parodė, kad hipertenzija sergantiems asmenims ASGP nėra tiesiogiai susijęs su SBP lygiu, o veikiau nepriklausomai nuo dviejų pagrindinių jį lemiančių veiksnių: centrinio PWV ir bangų atspindžio. Rezultatas buvo stebimas tik CC ir TC genotipams. Tokie radiniai pastebimi atliekant centrinius, bet ne brachialinius hemodinaminius matavimus.

Įvadas

Sistolinė hipertenzija yra viena iš stipresnių širdies ir kraujagyslių (ŠK) rizikų, pastebėtų senyviems žmonėms (> 65 metų) (žr. Apžvalgą Safar ir O'Rourke 1 ). Padidėjęs aortos standumas ir CV fibrozė laikomi svarbiausiais patofiziologiniais veiksniais, susijusiais su aukštu sistoliniu kraujospūdžiu (SBP). Angiotenzinas II ir aldosteronas yra žinomi dalyvaujant pradiniame sistolinės hipertenzijos vystymosi etapuose. 1 Klinikinių tyrimų rezultatai rodo, kad angiotenziną konvertuojančio fermento I / D geno polimorfizmas ir aldosterono sintazės geno polimorfizmas (ASGP) CYP11B 2 (variantas C-344T ) dažnai būna susiję su padidėjusiu aortos standumu vyresnio amžiaus žmonėms. 2, 3, 4, 5, tačiau šios kategorijos pacientams dažnai nepastebėta didelio sistolinės hipertenzijos dažnio. 6, 7

Kalbant apie ASGP, padidėjęs aortos standumas ir pulso bangos greitis (PWV) buvo stebimi hipertenzija sergantiems asmenims, tačiau tik palyginus CC genotipą su TT ir CT genotipais. 3 Kadangi CC genotipo nešiotojai šiek tiek sumažina insulto tūrį, buvo pasiūlyta, kad standžių arterijų ir mažesnio insulto tūrio derinys padeda išlaikyti brachialinį SBP normos ribose, todėl paaiškinama, kad padidėja sistolinės hipertenzijos dažnis. . 3 Vis dėlto CC genotipo nešiotojų organizme buvo pastebėtas neigiamas amžiaus ir širdies susitraukimų dažnio (HR) ryšys, kuris rodo, kad hemodinaminiai mechanizmai, susiję su bangų atspindžiu, gali padėti padidinti SBP lygį. 3

Normaliai ir hipertenzija sergantiems asmenims brachialinis SBP yra fiziologiškai ir nuolat didesnis nei centrinis (miego arterijos) SBP. Skirtumas tarp brachialinio ir miego arterijos SBP vadinamas SBP amplifikacija. Šis radinys yra klasikinis kraujo spaudimo (BP) plitimo, dažniausiai bangų atspindžių, pasekmė. 1, 8 Šiam SBP amplifikavimui, kuris niekada nepastebėtas dėl diastolinio kraujospūdžio (DBP) ir vidutinio kraujospūdžio (MBP), didelę įtaką daro HR. Žemas HR yra susijęs su sumažėjusiu slėgio impulso tarp aortos ir brachialinės arterijos amplifikacija. Dėl neigiamų CC ir nešiotojų santykio su amžiumi ir HR, mažesnis šių senyvų asmenų ŠS gali pailginti išstūmimo trukmę ir skatinti sistolinės hipertenzijos vystymąsi.

Šiame tyrime mes manome, kad sistolinė hipertenzija gali pasireikšti reaguojant į šiuos hemodinamikos mechanizmus. 1, 8 Pirmiausia, aortos BP kreivė yra širdies pompos išstumiamos priekinės bangos ir atgalinės širdies bangos, grįžtančios į širdį iš periferinių arterijų išsišakojimo vietų, fiziologinė suma. Antra, kai centrinės stambiosios arterijos yra elastingos, kaip ir jaunesniems asmenims, diastolinio BP kreivės komponento metu atgalinė slėgio banga grįžta lėtai, padidindama vainikinių kraujagyslių perfuziją ir nepalikdama širdies papildomo krūvio. Trečia, kai centrinės didžiosios arterijos tampa standžios, kaip ir vyresnio amžiaus žmonėms, aortos BP kreivės sistolinio komponento metu atgalinė slėgio banga labai greitai grįžta į širdį, sumažindama vainikinių kraujagyslių perfuziją ir sukeldama priekinių ir atgalinių slėgio bangų superpoziciją. Šis nenormalus sutapimas palaiko sistolinę hipertenziją krūtinės ląstos aortoje ir toliau išilgai arterinio medžio, kitose teritorijose, tokiose kaip brachialinė arterija. Šiomis sąlygomis sumontavus priekines ir atgalines slėgio bangas, atsiranda papildomas aortos SBP pakilimas, vadinamas augmentacijos indeksu (AI), kuris priskiriamas bangos atspindžių perdavimui ir gali būti dar labiau padidintas, kai širdies ciklas tęsiasi ( tai yra, kai HR yra pastoviai žemas). Galiausiai ASGP-CC genotipo nešiotojai gali būti siejami su sumažėjusiu HR, prisidedant prie aortos ar miego arterijos AI (CAI) padidinimo, tokiu būdu skatinant sistolinę hipertenziją. 1, 8 Atkreipkite dėmesį, kad šis hemodinaminis profilis pirmiausia buvo pastebėtas pacientams, sergantiems atrioventrikuline blokada, o po to keliais terapiniais tyrimais senyvo amžiaus žmonėms. Tuose tyrimuose, naudojant β blokuojančius vaistus, HR dažnai farmakologiškai sumažėjo. 1, 8, 9, 10

Šio tyrimo, atlikto su atskira sistoline hipertenzija ir (arba) sistoline-diastoline hipertenzija asmenims, tikslas buvo nustatyti ASGP genotipo CC savybes ir parodyti, kad tokiomis sąlygomis CC genotipas reikšmingai susijęs su pakitusiais centrinės bangos atspindžiais. ir HR - du svarbūs veiksniai, kurie gali būti senyvo amžiaus sistolinės hipertenzijos priežastis. Reikėtų pažymėti, kad tikimasi, kad šie pokyčiai bus aiškiau pastebimi atliekant centrinės (miego arterijos, krūtinės aortos), o ne brachialinės arterijos matavimus.

medžiagos ir metodai

Studijų grupė

Šis tyrimas buvo atliktas su 124 hipertenzija sergančiais asmenimis, 20–85 metų amžiaus, iš pradžių dalyvavusiais anksčiau praneštame terapiniame tyrime. 10 asmenų, kuriems buvo atlikti brachialinės ir centrinės (karotidinės) BP matavimai ir kurie buvo atlikti po 1 mėnesio plovimo laikotarpis. Brachialinis SBP nuolat buvo> 160 mm Hg, nepriklausomai nuo DBP. Neįtraukti pacientai, sergantys cukriniu diabetu ar antrine hipertenzija, 2, 10 asmenų, kurių SBP> 210 mm Hg ir DBP> 110 mm Hg, ir tie, kuriems anamnezėje yra vainikinių arterijų liga, širdies nepakankamumas, insultas ir (arba) periferinių arterijų liga. Visos mūsų tyrimo savybės atitiko mūsų vietos etikos komiteto kriterijus.

Visi dalyviai buvo apžiūrimi ryte, nevalgius mažiausiai 12 valandų, ir jiems atlikta ta pati procedūra. Po 20 minučių poilsio gulimojoje padėtyje, remiantis gyvsidabrio sfigmomanometru (trijų matavimų vidurkis), buvo išmatuoti brachialiniai BP ir HR, remiantis I ir V fazėmis, ir gautas elektrokardiogramos pėdsakas. Brachialinis MBP buvo apskaičiuotas kaip DBP + 1 / 3PP, o impulsų slėgis (PP) buvo apibrėžtas kaip skirtumas tarp brachialinio SBP ir DBP. Tada visiems asmenims buvo nustatyti miego ir šlaunikaulio PWV bei centrinės (miego arterijos) BP matavimai. Mes įsitikinome, kad mūsų 124 asmenų pogrupyje brachialinis ir centrinis BP bei PWV atspindi pradinę terapinio tyrimo populiaciją 10, vertinamą pagal palyginamąsias kitų klinikinių ir biologinių parametrų vidutines vertes. Klinikinės procedūros pabaigoje buvo paimtas kraujas standartinei biocheminei analizei ir DNR paėmimui.

Trumpai aprašomi naudojami echo-Doplerio metodai. PWV buvo nustatytas naudojant automatinį prietaisą „Complior“ (Colson, Paryžius, Prancūzija), kuris gali gauti internetinį impulsų bangos registravimą su dviem keitikliais, kurių vienas yra ant kaklo pagrindo virš bendros miego arterijos, o kitas virš šlaunikaulio arterija, tokiu būdu įgalinant automatinį PWV apskaičiavimą. 1, 10 Apie šio automatinio įtaiso patvirtinimą ir jo atkuriamumą buvo pranešta anksčiau. 1, 8 Remiantis 25 tyrime dalyvavusių asmenų atkuriamumas čia buvo 8 ± 1%.

Centrinės BP kreivės buvo nustatytos naudojant miego arterijos ir radialinių arterijų tonometriją. Tokiems lokaliems BP nustatymams buvo laikomi lygiaverčiai miego miego, brachialinių ir radialinių arterijų MBP ir DBP. Karotidinio slėgio banga pirmiausia buvo matuojama tiesiai ir transkutaniškai, atliekant aplanacinę tonometriją, ir buvo sukalibruota remiantis brachialinės arterijos BP matavimais, darant prielaidą, kad MBP (nustatomas čia planimetriškai) visose arterinio medžio vietose buvo vienodas. 1, 10 Antra, torakalinės aortos ir miego arterijos slėgio bangos taip pat buvo gautos iš radialinio arterijos slėgio bangos, naudojant tą pačią kalibravimą ir „SphygmoCor“ sistemą („AtCor Medical“, Sidnėjus, Australija). 1, 8, 11, 12 Šis prietaisas naudoja apibendrintą perdavimo funkciją, kad nustatytų aortos ir miego arterijos BP kreives nuo radialinio slėgio bangos, o jos patvirtinimas išsamiai aprašytas kitur. 1, 8, 11, 12 visose 124 asmenų grupėse patikrino artimą miego miego SBP ir PP, tiesiogiai išmatuotų transkutanine tonometrija, ir miego arterijos SBP bei PP, gautų naudojant „SphygmoCor“ įtaisą, 1, 8, 11, 12, kad taip buvo analizės rezultatas nesiskyrė, jei buvo naudojama kiekviena iš šių dviejų metodikų. Radialinėse ir miego arterijose SBP ir PP buvo banguotų bangų vidurkis per 10 sekundžių. Pakartojamumo koeficientai po 1 ir 3 mėnesių pertraukų buvo atitinkamai 6, 8 ir 7, 2 mm Hg. 1, 8, 13, 14 CAI, įvertinanti atgalinių bangų atspindžių amplitudę ir (arba) vėlavimą ir jo poveikį SBP amplitudėms, buvo nustatyta pagal anksčiau paskelbtus patvirtintus metodus. 1, 8 CAI atkuriamumas buvo išsamiai įvertintas kitur. 1, 8, 15 CAI buvo apskaičiuota kaip procentinė PP 1, 8 prieš ir po koregavimo HR.

Pastaraisiais metais pakartojamumo tyrimai, naudojant Brand-Altman grafikus, ir šiuolaikinė kompiuterinė technologija neinvazinį nustatymą padarė lengvai prieinamą tiriant aortos standumą ir bangų atspindžius klinikinių tyrimų metu. 10 Šiame tyrime buvo surengtos ikiteisminės treniruotės, skirtos apibrėžti ir palyginti pradinio CV nustatymo kokybę ir registruoti centrinę BP, PWV ir CAI. Kiekvienas tyrėjas gavo pažymėjimą po to, kai du ekspertai aklai įvertino. Jų pradiniai įrašai buvo elektroniniu būdu persiųsti koordinavimo centrui ir iš karto peržiūrėti, kad juos patvirtintų Kokybės kontrolės komitetas. Tyrimo metu tyrėjams buvo prieinama internetinė pagalba. Tyrimo procedūrų pabaigoje visus matavimus, įskaitant BP, bendrai nustatė du gydytojai, kurie buvo uždaryti į gydymą, klinikinius duomenis ir fizinę apžiūrą.

CYP11B2 geno polimorfizmų identifikavimas ir nustatymas

T –344 C genotipui nustatyti buvo paimtas kraujas DNR ekstrakcijai. Visų asmenų genotipas buvo atliktas naudojant aleliui specifinius oligonukleotidus, kaip aprašyta anksčiau. 2, 3, 17 Pradmenys, naudojami amplifikuojant PGR, regionai, apimantys variantus, buvo T –344 C, viršutinė – 5 ′ AGGGGGTACGTGGACATTTT 3 ′, apatinė – 5 ′ CAGGGCTGAGAGGAGTAAAA 3 ′. Po fermentinio amplifikavimo penktadalis PGR produkto buvo denatūruoti ir užpūsti ant nailono membranų. Kiekvienas alelis buvo aptiktas po inkubacijos su specifiniais oligonukleotidų zondais, kurie buvo skirti T –344–5 ′ TCCAAGGCTCCCTCTCA 3 ′ ir C −344–5 ′ TCCAAGGCCCCCTCTCA 3 ′. Hibridizacijos temperatūra buvo atitinkamai 49 ir ​​51 ° C. Skalbimo temperatūros standartiniame natrio citrate buvo atitinkamai 54 ir 56 ° C, tiriant T- 344 ir C- 344 .

Statistinė analizė

Kiekybiniai duomenys išreiškiami kaip vidurkis ± 1 sd arba vidurkis ± se, pakoregavus jį į vieną ar kelis tirtus kintamuosius. Kokybiniai duomenys išreiškiami procentine dalimi kiekvieno modulio. A 0, 05 buvo laikomas reikšmingu. Visos statistinės analizės buvo atliktos naudojant SAS programinės įrangos versiją 8.2 (Cary, NC, JAV), naudojant Windows NT 2000.

Alelių ir genotipų dažnis buvo išanalizuotas pagal genų skaičiavimo metodą, ir Hardy – Weinberg pusiausvyra, patikrinta χ 2 testu, buvo laikoma išlaikyta, kaip aprašyta anksčiau. 2 Visos priemonės ir koreliacijos buvo toliau koreguojamos atsižvelgiant į seksą ir ankstesnį antihipertenzinį gydymą.

Pirmiausia apibūdinome pagrindinius tiriamųjų pacientų CV parametrus pagal genotipą ir juos palyginome, naudodamiesi bendruoju tiesiniu nuolatinio ir kategorinio kintamojo su vienu koeficientu modeliu (F-testas). Įvairių parametrų vertės buvo gautos atlikus šią analizę ir pateikiamos atsižvelgiant į genotipą, pritaikius lytį ir buvusiam antihipertenziniam gydymui. Informacija apie kitus pakeitimus ir reikšmingumas pateikiami kiekvienoje lentelėje.

Antra, mes įvertinome kiekvieno genotipo „Spearman“ (neparametrinius) koreliacijos koeficientus pagal amžių ir HR ar CAI, o HR ir CAI ryšius kiekvienam genotipui; P reikšmė rodo ryšį tarp hemodinaminių parametrų reikšmės. PWV modelyje buvo daug koreliacijų, naudojant MBP, amžių, gliukozės kiekį plazmoje, CAI ir HR. Norėdami nustatyti, ar šlaitai skyrėsi tarp genotipų (palyginimai su tarpais), mes panaudojome šlaitų heterogeniškumo testą, kuris parodo natūralų kovariacijos analizės pratęsimą. Kiekvieno genotipo karotidinio ar brachialinio SBP veiksniams nustatyti buvo naudojamos kelios tiesinės regresijos. Buvo naudojami du modeliai, įskaitant amžių, HR, PWV (1 modelis) arba amžių, CAI, PWV (2 modelis). Jie aprašyti rezultatuose (žr. 3 lentelę). Taip pat buvo išbandyta sąveika siekiant kontroliuoti, ar CAI ir PWV nepriklausomai modifikuoja SBP. Galiausiai, atsižvelgdami į standartinę 5 mm Hg amplifikaciją tarp brachialinės ir radialinės arterijų, 18 įsitikinome, kad bendrieji tyrimo rezultatai ryškiai nesiskyrė, kai buvo atliktas kvazi-nulis arba standartinis 5 mm Hg SBP brachialinės-radialinės amplifikacija. laikomas. Atkreipkite dėmesį, kad sveikiems asmenims dažniausiai stebimas 5 mm Hg smegenų ir radialinis amplifikavimas 18, tačiau jis nebuvo išsamiai ištirtas hipertenzija sergančių asmenų grupėse.

Rezultatai

Vidutinės vertės

1 lentelėje pateiktos klinikinės ir biologinės savybės (vidutinės vertės) pagal genotipą. 124 tyrimo dalyviams reikšmingo tarpgenotipų skirtumo nepastebėta.

Pilno dydžio lentelė

Santykiai tarp HR, CAI ir amžiaus

Spearmano koreliacijos koeficientai amžiaus – HR, amžiaus – CAI santykiams ir tarp HR – CAI parodė reikšmingus amžiaus – HR ir HR – CAI tarpgenotipų skirtumus (2 lentelė). Tai buvo pastebėta tarp CC varianto ir TT bei TC variantų (atitinkamai P <0, 008 ir P <0, 02).

Pilno dydžio lentelė

Pamatinė miego arterijos SBP regresija

1 modelio (1 lentelė) analizė parodė, kad miego miego SBP buvo reikšmingai susijęs tik su TT genotipo amžiumi ( P = 0, 02) ir TC nešėjų tik su PWV ( P = 0, 007), tuo tarpu HR ( P <0, 007) ir PWV ( P <0, 03) turėjo reikšmingą poveikį miego arterijos SBP CC grupėje. Kai daugialypės regresijos modelis pakeitė HR CAI 3 lentelėje (2 modelis), buvo gautos žymiai didesnės daugybinės r 2 ir P vertės nei 1 modelyje, ypač CAI ir PWV CC ir TC genotipams. TT genotipui nebedarė įtakos amžius ir CAI. Pagrindiniai rezultatai turėjo didelę reikšmę tiek tarp grupių, tiek tarp grupių. Nei 1, nei 2 modeliuose reikšmingos sąveikos nepastebėta.

Pilno dydžio lentelė

Laipsninės SBP laipsniška daugybinė regresija

Veiksniai, susiję su brachialiniu SBP (3 lentelė, 2 modelis), skyrėsi nuo veiksnių, veikiančių miego arterijos SBP, ypač CC genotipui, kuriam tik PWV turėjo šiek tiek reikšmingą „poveikį“. Palyginus su miego arterijos matavimais, atliekant brachialinių arterijų matavimus, buvo gautos silpnesnės P vertės , nesvarbu, ar buvo įvestas HR (1 modelis) (duomenys nepateikti), ar CAI (2 modelis) (3 lentelė).

Kiekvieno genotipo PWV reikšmingai koreliavo su amžiumi ( P <0, 0001) (duomenys nepateikti). Tik CC genotipui PWV buvo reikšmingai susijęs su CAI ( P = 0, 03) ir MBP ( P = 0, 014) (duomenys nepateikti).

Galiausiai, kadangi nebuvo nustatyta sąveikos tarp CC ir TC genotipų, PWV ir CAI turėjo nepriklausomą poveikį miego miego SBP. Šie radiniai rodo genotipo poveikį atspindžio bangoms (CAI), tačiau nenustatyta kritusių bangų. Brachialinio SBP tokių skirtumų nepastebėta. Svarbu tai, kad su ASGP atrodė susiję tik du klasikiniai miego miego SBP lemiantys faktoriai, tai yra PWV ir CAI, o ne pats SBP.

1 paveiksle pavaizduotos vidutinės miego miego SBP vertės atsižvelgiant į aukšto arba žemo CAI buvimą TT ir TC + CC genotipų nešiotojuose; pastarojo miego miego SBP yra žymiai didesnis, kai CAI viršijo 27%. 27% vertė rodo vidutinę visų gyventojų CAI vertę. Panašus pastebėjimas buvo padarytas, kai HR pakeitė CAI (duomenys nepateikti). Jokių reikšmingų SBP skirtumų nepastebėta, kai vietoj centrinio BP matavimų buvo naudojami brachialinio BP matavimai.

Image

Vidutinis miego miego sistolinio kraujospūdžio (SBP) (± sd) vertės pagal miego padidėjimo indekso (CAI) (%) lygį TT ir (TC + ​​CC) genotipų nešiotojuose. CAI vertė (27%) yra vidutinė visos populiacijos vertė, kuri yra arba

Image
, <27%, arba
Image
, 27%.

Visas dydis

Diskusija

Šiame tyrime ištyrėme statistinį ASGP ryšį su miego ir brachialine BP, taip pat su HR, CAI ir PWV vyrų ir moterų populiacijoje, įskaitant izoliuotą sistolinę hipertenziją arba sistolinę-diastolinę hipertenziją. Šioje populiacijoje reikšmingi ASGP skirtumai buvo pastebėti pritaikius lytį ir ankstesnį antihipertenzinį gydymą CC genotipo nešiotojais, palyginti su TT ar TC genotipų pacientais. Rezultatai buvo stebimi tik svarstant karotidinius (centrinius), o ne brachialinius matavimus. Pirmiausia buvo pastebėti reikšmingi tarpgenotipų skirtumai tarp amžiaus ir ŽS santykio. Antra, nors ir turėdamas TT genotipą, tik CAI šiek tiek „paveikė“ miego miego SBP (2 modelis), PWV ir CAI CC ir CT genotipo nešiotojuose pasižymėjo labai reikšmingomis asociacijomis su miego miego SBP. Kaip ir CC genotipas, HR ir CAI buvo atvirkščiai susiję, todėl vyresnis amžius buvo susijęs su mažesne HR, panašu, kad lėtesnis HR senyvo amžiaus žmonėms buvo susijęs su žymiai padidėjusia KAI, taigi ir sistoline hipertenzija (1 paveikslas). ). Brachialinio SBP palyginamų genotipų skirtumų nepastebėta. Taigi, rezultatai buvo stebimi daugiausia atliekant centrinės miego arterijos, o ne brachialinius nustatymus.

Daugelyje pranešimų apie hipertenzijos genetiką hipotezė, kad genetinis kintamumas gali prisidėti prie didelio BP lygio, buvo patikrinta palyginus vidutines pacientų, turinčių skirtingus genotipus, DBP reikšmes (žr. Apžvalgas „Safar“ ir „O'Rourke 1“ ir „Luft 19“ ). Kadangi praeityje hipertenzija buvo klasifikuojama remiantis tik ciklinio BP kreivės tašku, DBP, o ne niekada - SBP ar PP, daugelį atliktų pastebėjimų labai apribojo šis netinkamas BP aprašymas. Be to, daugelį metų buvo nustatyta, kad brachialinės arterijos BP kreivė teikia tik nedidelę informaciją, palyginti su centrine (miego ar aortos) BP kreive. Mūsų ir kitų išvados plačiai dokumentuoja šią hipotezę. 2, 20 Kalbant apie ASGP, mes anksčiau 3 parodėme nedidelėje hipertenzinių vyrų grupėje, kuriai hemodinaminiai parametrai buvo nepriklausomai išmatuoti, kad CC genotipas buvo žymiai didesnis ir insulto tūris mažesnis nei sujungto TT ir TC genotipo. Be to, ryšys tarp aukšto amžiaus ir žemo HR buvo labai reikšmingas. 3 Čia pateikti rezultatai parodė, kad vyrų ir moterų, kuriems buvo išmatuotas smegenų ir miego arterijos BP, populiacijoje CAI reikšmingai buvo siejama tik su CC genotipo nešiotojais. Tačiau pats SBP lygis nebuvo tarpininkaujamas, o tarpininkauja tik per jo atgalinį komponentą. Galiausiai mūsų radinys buvo stebimas nepriklausomai nuo PWV rezultatų.

Net jei mūsų populiacija buvo santykinai kukli ir galimai galėjo sukelti I tipo klaidą, CAI ir HR rezultatai sutinka su Ylitalo ir kt. Pranešimais. , 21, kuris nustatė, kad ASGP yra susijęs su genotipo sukeltomis individualių skirtumų tarp baroreflekso jautrumo ir HR kintamumu asmenų, turinčių CC genotipą. Panašios išvados buvo gautos atlikus HR spektrinę analizę didelėse Europos populiacijose, ir paaiškėjo, kad jas darė pastovus natrio suvartojimas, net atliekant šeimos narių tyrimus ir (arba) konkrečiuose geografiniuose regionuose. 22, 23, 24 Visi šie pastebėjimai sutinka su ankstesniais nusistovėjusiais duomenimis apie aldosterono, katecholaminų, autonominės nervų sistemos ir natrio homoeostazės ryšį hipertenzija sergantiems asmenims. 1, 25, 26 Mūsų čia užmegzti ryšiai tarp ASGP, HR ir CAI negalėjo būti priskiriami metodologinėms problemoms, susijusioms su centriniais (miego arterijos) BP matavimais. Pirmiausia karotido slėgio nustatymai, tiesiogiai išmatuoti ir sukalibruoti arba naudojant perdavimo funkciją, anksčiau buvo patvirtinti tuo pačiu metu atliekant intraarterinius BP matavimus. 27 Antra, CAI, apskaičiuota kaip PP procentas, nereikalavo jokio BP kreivės kalibravimo ir buvo tvirtai koreliuojama su radialinės arterijos AI, kai ji buvo nustatyta kartu su CAI. Visi šie rezultatai rodo, kad kai kuriems senyviems pacientams sistolinė hipertenzija gali atsirasti dėl sutrikusios centrinės bangos atspindžių ir reikšmingo ASPG ryšio su HR sumažėjimu.

Padidėjęs arterijų standumas, nepriklausomai nuo MBP, anksčiau buvo užfiksuotas ASPG CC genotipo nešiotojuose. 3 Dažniausiai po 50 metų PWV padidėjo su amžiumi labiau nei CC nei TT ar TC genotipo. Į šią išvadą svarbu atsižvelgti, nes padidėjęs aortos standumas ir padidėjęs aldosterono kiekis plazmoje asmenims, sergantiems esencine hipertenzija, yra teigiami ir reikšmingai koreliuojami. 28 Be to, ASGP CC genotipas buvo reikšmingai susijęs su aukštesnėmis PWV ir plazmos aldosterono vertėmis nei TT ir TC genotipai, net pritaikius amžių ir 24 valandų natriurezę. 28, 29 Tokie pastebėjimai atitinka hipotezę, kad C alelis gali būti susijęs su padidėjusia CYP11B 2 ekspresija / aktyvumu, taigi ir vietine aldosterono sekrecija. Tačiau, kaip ir keliose kitose ataskaitose, 10, 30, 31, šie genotipų skirtumai praeityje nebuvo siejami su tiesiogiai išmatuoto smegenų ir daugiausia miego arterijos SBP skirtumais.

Šiame tyrime mes nustatėme nuoseklų ASGP ryšį su amžiaus ir PWV santykiais, bet ne su amžiaus ir SBP (miego ar smegenų sąnario) santykiais. Šis pastebėjimas atitinka kitų tyrimų rezultatus, rodančius, kad C alelis neturėjo įtakos BP nuo dozės priklausomu būdu. 30, 31, 32 Kita vertus, remiantis eksperimentiniais tyrimais, žinoma, kad aldosteronas daro poveikį CV sistemai, vartojant nuo BP nepriklausančias dozes. 32, 33 Taigi, sutinkant su ankstesniais Lacolley ir kt. , 34 galima teigti, kad aldosteronas iš tikrųjų gali paveikti CV biologiją, sukeldamas širdies, PWV ir bangų atspindžio pokyčius, bet ne tiesiogiai matuojamo (miego ar smegenų) SBP moduliacijai. Priešingai, verta paminėti, kad šiame tyrime žemesnė HR yra susijusi su padidėjusia CAI, ypač CC genotipo kontekste. Iš tiesų, CV fiziologijoje sulėtėjęs širdies ritmas palaiko greitą atspindėtos slėgio bangos grąžinimą sistolės metu, sukeldamas ankstesnius aortos bangos atspindžius ir gaudamas aukštą sistolinę smailę nepriklausomai nuo PWV (žr. 3 lentelę). Galiausiai, ankstesni centrinės bangos atspindžiai gali būti pasikeitusio laiko pasireiškimas krūtinės aortos lygyje ir (arba) pakitusi amplitudė arteriolarinio atspindžio vietose. Pirmoji galimybė, o ne antroji, tinka stebint daug didesnį mineralokortikoidų receptorių tankį krūtinės ląstos aortoje nei arteriolių vietose. 35

Keliuose pranešimuose apie CYP11B 2 ekspresiją žmonių ir graužikų populiacijose buvo parodyta, kad aldosteronas gali būti sintetinamas vietoje, ypač širdies 33, 36 ir didžiųjų kanalų arterijose. 37, 38 Jei C alelis gali savarankiškai padidinti CYP11B 2 ekspresiją širdies ir arterijos audiniuose, tai gali padidinti vietinę aldosterono koncentraciją ir turėti specifinį lokalų poveikį be sisteminio poveikio BP. Remiantis čia pateiktais atradimais, akivaizdu, kad stebėjome nepriklausomą poveikį širdžiai (insulto tūris, HR) ir didelėms arterijoms (PWV, CAI). Taigi atrodo tikėtina, kad širdies ir kraujagyslių lygyje šie stebėjimai gali netiesiogiai atspindėti aldosterono sukeltą fibrozę ir (arba) sutrikusius bangų atspindžius, kurių laipsnis būtų skirtingas kiekviename konkrečiame CV audinyje.

Apibendrinant, šio tyrimo rezultatai parodė, kad ASGP yra susijęs su reikšmingais arterinės funkcijos pokyčiais, kaip nustatyta hipertenzija sergantiems asmenims, atsižvelgiant į dažnio, o ne laiko, fiziologinius pagrindus. 1, 39 Kaip mes nustatėme ankstesniame pranešime 3, kad insulto tūris gali dalyvauti ASGP polimorfizme, rezervuaro metodas gali būti naudingas patofiziologiniu pagrindu. 39 Dabar yra įrodymų, kad arterinės sistemos rezervuaro charakteristikos prisideda prie arterinio slėgio bangos formos forma, o galbūt atspindi nedidelį atspindėtų bangų vaidmenį. 40, 41 Kita vertus, išvados atitinka lokalų, bet skirtingą endogeninio aldosterono poveikį dideliems kraujagyslėms, pavyzdžiui, miego arterijai ir krūtinės aortai. Rezultatai, kuriuos įtakoja amžius, gali turėti įtakos tradiciniams ŠK ligų fenotipams, tokiems kaip širdies nepakankamumas ir dažniausiai sistolinė hipertenzija senyvo amžiaus žmonėms. Kai kuriems pacientams pastebėtas poveikis gali paaiškinti specifinio mineralokortikoidų poveikį širdžiai ir (arba) kraujagyslėms, ypač sistolinę hipertenziją CC genotipo nešiotojams. 31, 42 Todėl svarbu atsižvelgti į ankstyvą rizikos grupės asmenų identifikavimą, kad farmakoterapija būtų nukreipta į aldosterono receptorių blokadą.

Image

Interesų konfliktas

Autoriai teigia, kad interesų konflikto nėra.