Biallelinių cmp-neu5ac hidroksilazės išmuštų kiaulių gamyba | mokslinės ataskaitos

Biallelinių cmp-neu5ac hidroksilazės išmuštų kiaulių gamyba | mokslinės ataskaitos

Anonim

Dalykai

  • Genetinė inžinerija
  • Imunogenetika
  • Transgeniniai organizmai
  • Cinko pirštų nukleazė

Anotacija

Po α1, 3 galaktozililtransfeazės (Gal-T) išmušimo (KO) Hanganutziu-Deicher antigenas tapo pagrindiniu „ne-Gal antigeno“ antigenu, kuris susijęs su vėlesniu ksenografo atmetimu. Norėdami pašalinti ne-Gal antigeną, sėkmingai pagaminome cinko piršto nukleazę (ZFN) tarpininkaujant monoallelinėms / biallelinėms patinų ir patelių CMP-N-acetilneuramininės rūgšties hidroksilazės (CMAH) KO miniatiūroms kiaulėms: tikslinio geno efektyvumas (41, 7%) buvo didesnis, kai donoro DNR buvo naudojama kartu su ZFN, nei tik ZFN (9, 1%). Monoallelic KO kiaulės neturėjo savo išorės DNR integracijos į savo genomą, tai rodo, kad ši metodika suteiks naują galimybę sumažinti atsparumo antibiotikams riziką, kai pacientams bus persodinami genetiškai modifikuotų kiaulių organai. Iki šiol tiek monoalleliškos, tiek biallelinės CMAH KO kiaulės yra sveikos ir neturi jokių anomalijų ir netaikomų mutacijų požymių. Todėl šios CMAH negalvotos kiaulės Gal-T KO fone galėtų būti svarbiu ksenotransplantacijos modeliu.

Įvadas

Kadangi kiaulių fiziologija yra panaši į žmogaus, kiaulės laikomos svarbiu biomedicinos modeliu. Konkrečiai, kiaulės laikomos potencialiais žmonių organų donorais dėl suderinamo organų dydžio ir fiziologijos bei trumpo veisimosi laiko 1, 2 . Kiaulių, teikiančių organus ksenotransplantacijai, galimybės buvo padidintos, kai kiaulės buvo gaminamos somatinių ląstelių branduolio pernešimo (SCNT) būdu, naudojant genų inžinerijos būdu pagamintas ląsteles. Atsižvelgiant į kiaulių, kaip potencialių organų donorų, vertę žmogui, nenuostabu, kad pirmosios kiaulės buvo išmuštos (KO) ksenotransplantacijai 1, 2 . Šios kiaulės turėjo suardytą α-1, 3-galaktoziltransferazės (GGTA1) geną - pagrindinį geną, kuris sintezuoja fermentą, sukuriantį galaktozės α-1, 3-galaktozės (Gal-T) epitopus. Kiaulių organų veikimas žmogaus krauju sukelia hiperaktyvų atmetimą (HAR). Atmetimą sukelia Gal antigenas ant kiaulės kraujagyslių endotelio ir natūralūs anti-Gal antikūnai žmogaus serume 3, 4 . Kai kiaulės organai ar audiniai yra persodinami į žmogaus kūną, žmogaus IgM anti-Gal izotipas jungiasi su kiaulės audiniuose esančiais antigenais, dėl ko suaktyvėja komplemento kaskados rezultatas - ląstelių lizė 5 . Kai GGTA1 KO kiaulių organai buvo persodinti į beždžionę, HAR išvengta, nes organuose trūko Gal-T epitopų 6 . Šios pirmosios KO kiaulės parodė, kad genetiškai modifikuotos kiaulės gali būti puikus ksenotransplantacijos organų šaltinis.

Nors „Gal-T KO“ kiaulės įveikė pirmąjį ksenotransplantacijos kiaulėms barjerą, vis dar yra daug imunologinių iššūkių, kad kiaulių organai galėtų būti naudojami žmonėms. Deja, dėl menko genetiškai modifikuotų kiaulių produktyvumo tyrimų pažanga yra ribota. Dėl menko efektyvumo kiaulėms buvo modifikuoti tik keli genai 7 . Skirtingai nuo pelių, kiaulėms genetines modifikacijas reikia atlikti somatinėse ląstelėse, kurios vėliau naudojamos SCNT dėl embrioninių kamieninių ląstelių trūkumo. Tačiau genų, nukreiptų į somatines ląsteles, dažnis yra labai žemas - 8, 9 . Naujausi cinko pirštų nukleazės (ZFN) technologijos pokyčiai leidžia mums tiksliai ir labai efektyviai modifikuoti genomą. ZFN sudaro nespecifinis FokI endonukleazės skilimo domenas su cinko piršto domenu, specifišku taikinio 10 DNR sekai. Suprojektuoti ZFN gali sukelti dvigubos grandinės pertraukas (DSB) tam tikrose genomo vietose, ir šie DSB sukelia atsitiktines mutacijas per nehomologinį galo sujungimą (NHEJ) arba stimuliuoja homologinę rekombinaciją (HR), jei pateikiama donoro DNR 11 . Ši technologija plačiai taikoma graužikams 12, tačiau apie kiaules yra nedaug. Pirmą kartą ZNF panaudojimas kiaulių somatinėse ląstelėse buvo parodytas 2010 m. 13, o pirmą kartą mums pranešė KO kiaulės, naudojančios ZFN ir SCNT 14 . Neseniai buvo pranešta apie pirmąsias kiaules, turinčias tikslinį endogeninį geną: heterozigotinės KO kiaulės peroksisomų proliferatorių aktyvuoto gama receptoriaus (PPARγ) genui buvo pagamintos naudojant ZFNs 15 . ZFNs buvo perneštos į somatines ląsteles su plazmidėmis, turinčiomis atsparumo neomicinui (Neo) geną, kad pasirinktų ląsteles, transfekuotas ZFN. ZFN efektyvumas buvo maždaug 4%, daug didesnis nei vidutinis dažnis, stebimas tradiciniam genų taikymui; po vieną iš 10 4–10 7 ląstelių 16 . Taip pat buvo pagaminta biallelio išmušimo kiaulė modifikuojant somatines ląsteles ZFN, po to sekančią SCNT, siekiant nukreipti GGTA1 geną 17 . Šiame darbe „Gal-T“ nulinės ląstelės buvo atrinktos naudojant srauto citometriją, nes „Gal-T“ epitopas galėjo būti atpažįstamas specifiniu lektinu, ir tada buvo atlikti du SCNT raundai, kad būtų gautos „Gal-T“ kiaulės. Nors buvo pranešta apie ZFN efektyvumą kiaulių genetinėje inžinerijoje, jis buvo apribotas tik keliais genais.

Kadangi Gal-T KO kiaulės 2002 m. Gamino dvi grupes 1, 2, ne-Gal antigenai laikomi kitu ksenoantigenu, dalyvaujančiu atmetimo reiškinyje. Tiksliau sakant, N-glikolneuramino rūgštis (NeuGc) yra vienas iš ne-Gal ksenoantigenų, turinčių antrinės svarbos GGTA1 18, 19. Panašiai kaip ir GGTA1 genas, CMP-Neu5Ac hidroksilazė (CMAH) yra plačiai ekspresuojama daugelio žinduolių, išskyrus žmones, endotelio ląstelėse (abu šie genai yra žmogaus pseudogenai), o šis epitopas yra galimas kiaulių taikinys anti-ne-Gal antikūnas žmonėms, nes jis yra atsakingas už NeuGC, pagrindinio ne-Gal antigeno 20, 21, raišką. Anksčiau mes pranešėme, kad viso kiaulės 22 CMAH geno klonavimas ir apibūdinimas bei kiaulių gal-T trūkumas padidina sialiltransferazės aktyvumą, dėl kurio gali kilti ne-Gal ksenoantigeniškumas 23, 24. Šis ne-Gal ksenoantigeniškumo padidėjimas gali leisti kurti strategijas, skirtas užkirsti kelią imunologiniams atsakams į tuos epitopus. Jei kliniškai priimtinas imunosupresinis gydymas negali pakankamai slopinti specifinio anti-ne-Gal antikūno susidarymo, alternatyvus būdas yra ne-Gal epitopo pašalinimas arba modifikavimas kiaulėms naudojant genų inžineriją 19 . Pašalinti CMAH geno ekspresiją kiaulėje yra svarbu, norint gauti organų donorus ksenotransplantacijai.

Apskritai tiksliniuose vektoriuose, naudojamuose genų taikymui, yra atsparumo antibiotikams genai, tokie kaip neomicinas ar higromicinas, skirti in vitro patikros procesui. Panašiai daugeliu atvejų plazmidė, kurioje yra atsparumo antibiotikams genas, yra naudojama kartu su ZFN, kad pasirinktų somatines ląsteles, sėkmingai transfekuotas ZFN. Ši strategija, naudojant atranką antibiotikams, tokiems kaip G418, gali apriboti kiaulių pritaikymą žmogaus organų transplantacijai, nes persodinti organai turės atsparumą antibiotikams. Ankstesniame tyrime, norint ištrinti pasirinkimo žymeklį tikslinėje vietoje, buvo naudojama „cre / lox“ kasečių sistema 25 . Tačiau atsižvelgiant į tai, kad somatinių ląstelių gyvenimo trukmė in vitro yra ribota, tai yra sudėtingas požiūris ir tikėtina, kad ląstelės pasens po dviejų transfekcijos ir selekcijos etapų. Jei mes galime sukurti naują metodą, kuriame nenaudojamas atrankos žymeklis KO somatinėms ląstelėms tirti, kitaip tariant, nėra integruota egzogeninė DNR, ši technika suteiktų naują galimybę sumažinti persodintų organų atsparumo antibiotikams riziką dėl transgeninių kiaulės po ksenotransplantacijos. Čia pateikiame greitą vieno žingsnio metodą, kaip sugeneruoti kiaulių geną, naudojant inžinerinius ZFN, kad būtų atlikta ksenotransplantacija kiaulėms. Šio tyrimo tikslas buvo nustatyti tinkamą transfekcijos ir selekcijos metodą KO somatinėms ląstelėms gaminti ir panaudoti jas genetiškai modifikuotoms kiaulėms auginti naudojant SCNT technologiją.

Rezultatai

ZFN ir ZFN veiklos projektavimas ir konstravimas

Individualios ZFN plazmidės buvo sukurtos surišti ir suskaidyti kiaulės CMAH geno 8 egzoną. ZFN projektavimą, klonavimą ir patvirtinimą atliko Sigma-Aldrich. Šiame tyrime buvo atliktos dvi skirtingos CMAH geno KO kiaulės somatinėse ląstelėse strategijos; supažindinant vien tik ZFN su ZFN su donoro DNR (1a ir b pav.). Tiksliau sakant, ZFNs sukels DSB CMAH gene, sukeldamas nukleotidų įterpimus ar trynimus taikinyje, tuo tarpu ZFN su donoro DNR sukels HR taikinį. Norėdami padidinti tikslinių ląstelių su ZFN sukeltomis mutacijomis dažnį, mes sukūrėme donoro DNR vektorių. Donoro DNR turi neo atsparumo geną kaip selekcinį žymeklį ir jame yra dvi homologinės rankos HR reakcijai; abu buvo trumpesni nei 800 bp. Fig. 1b parodo donoro plazmidės schemą. Donoro plazmidės buvo sukurtos atsižvelgiant į dviejų ZFN porų skilimo vietą. ZFN su patvirtintu aktyvumu mielių MEL-1 tyrime buvo gauti iš „Sigma-Aldrich“ (1c pav.). Šiame tyrime buvo naudojamas ZFN rinkinys, kuris parodė didžiausią aktyvumą mielių tyrime. Po to ZFN rinkinio plazmidės kartu su donoro DNR (užtikrinančia atsparumą neomicinui) buvo elektroporacijos būdu naudojamos kiaulių patinų ar moterų fibroblastų ląstelėms. Ląstelių pasirinkimas naudojant G418 leidžia žymiai praturtinti ląsteles potencialiomis CMAH KO ląstelėmis (1d pav.).

Image

(a, b) CMAH geno ekspresijos sutrikdymo strategija. (A) diagrama iliustruoja CMAH lokuso 8 egzono dalį ir seką, kurią atpažįsta ZFN poros. ZFN tikslinės sekos yra pažymėtos dėžutėje. Kiekvieną ZFN sudarė penkių pirštų baltymai, atpažįstantys taikinio seką (pilkai ovalią) ir nespecifinį Fok I restrikcijos fermento skilimo domeną. b) homologinė seka, naudojama homologinei rekombinacijai skatinti (5 ′ ir 3 ′ rankos). Vidurinė diagrama iliustruoja donoro DNR, naudojamą CMAH ekspresijai sutrikdyti. Tarp homologinių rankų buvo įdėta neoekspresinės kasetės (PGK-neo pA), kad būtų galima pasirinkti antibiotiką. Apatinėje diagramoje parodytas redaguotas CMAH lokusas po homologinės rekombinacijos su donoro DNR. c) ZFN su patvirtintu aktyvumu mielių MEL-1 tyrime. (d) Atskirų ląstelių atranka po ZFN arba ZFN + donoro DNR transfekcijos. (e) Tyrėjo (Cel-I) nukleazės tyrimas ZFN sukeltoms CMAH geno mutacijoms nustatyti. Cel4 I endonukleazės suvirškinimas iš 534 bp heteroduplekso DNR, gauto hibridizuojant DNR iš kontrolinės ir kiekvienos tikslinės ląstelės į 308 bp ir 221 bp fragmentus, įrodė vieno CMAH alelio (48 ir 64 eilutės) arba bialelio (47 ir 47 eilutės) mutagenezę. 49) tikslinėse ląstelėse. Rodyklių galvutės rodo numatomą suardytų produktų padėtį. SM, E ir K atitinkamai nurodo dydžio žymeklį, kontrolinius ausų ir inkstų DNR amplifikuotus produktus. f) Chromosomų analizė SCT tyrimui naudotose moters (kairėje) ir vyro (dešinėje) somatinėse ląstelėse, nukreiptose į ZFN.

Visas dydis

Tyrėjo mutacijų aptikimo tyrimas buvo atliktas siekiant nustatyti tikslinių ląstelių, turinčių CMAH mutaciją, dažnį, pjaustant heteroduplekso DNR, gautą hibridizuojant kontrolinės kiaulės DNR su DNR iš ZFN įvestų ląstelių, naudojant Cel-I endonukleazę. Analizė atskleidė dalinį 534 bp DNR suskaidymą į 308 bp ir 221 bp fragmentus tikslinėje ląstelėje (1 e pav.). Chromosomų analizė rodo, kad ląstelių kariotipas išliko normalus po visų atrankos procesų (1f pav.).

Donoro DNR homologijos ilgio poveikis ZFN tarpininkaujamam efektyvumui

Norint nustatyti mažiausią donoro DNR homologijos ilgį, galintį sukelti HR nukreipimo vietoje, DNR fragmentų, turinčių įvairaus ilgio 5 ′ prieš srovę arba 3 ′ pasroviui esančią CMAH 8 egzoną, serija buvo klonuota į PGK-neo + 2A + GFP vektorių (2 pav.). Kiekviena konstrukcija buvo laikinai transfekuota į kiaulės fibroblastų ląsteles kartu su PGK-neo + 2A + GFP plazmidėmis, kad normalizuotų transfekcijos efektyvumą dvigubam reporterio tyrimui. Kiaulių fibroblastų ląstelės buvo išgautos praėjus 5 dienoms po transfekcijos įvairaus ilgio ZFN plazmidėmis ir donoro DNR. HR efektyvumas buvo analizuojamas PGR ir (arba) pagal GFP teigiamų kolonijų skaičių. Geriausias HR efektyvumas buvo gautas naudojant donoro DNR su 789 bp homologija. Tačiau donoro DNR su 200 bp homologija HR sumažėjo iki 50%, palyginti su donoro DNR su 789 bp homologija. Be to, HR įvykiai buvo sunkiai aptinkami, kai buvo naudojama donoro DNR, turinti tik 76 bp homologiją.

Image

a) Donorų vektorių, turinčių 5 skirtingos homologijos ilgio, konstravimas. b) Kiekybinė PGR analizė, skirta aptikti ZFN / donoro DNR tarpininkaujamas ląsteles. Apie donoro DNR konstrukciją ir PGR pradmenų rinkinius žiūrėkite metodą. Atliekant PGR analizę pagal ZFN palaikomus homologinius rekombinacijos įvykius, mes panaudojome tuos pačius metodus, kaip ištirti ir išnaikinti kolonijas, naudodami Neo A ir CMAH B pradmenis, esančius už rekombinacijos srities ribų (1 papildoma lentelė).

Visas dydis

ZFN orientuota tikslinė integracija į endogeninį lokusą

Šešiasdešimt keturios ir 48 neo atsparios kolonijos vyriškose ląstelėse, perkeltos atitinkamai su ZFN plazmidė ir mRNR, buvo analizuojamos PGR. Buvo nustatyta, kad devyniolika kolonijų neša HR su KO vektoriu ląstelėse, transfekuotose ZFN DNR. Buvo patvirtinta, kad penkiolika kolonijų buvo taikytos ląstelėse, perkeltose su ZFN mRNR (1 lentelė). Moteriškos lyties ląstelėse teigiamos buvo tik trys iš 39 ir dvi iš 62 kolonijų, transfekuotų atitinkamai ZFN plazmidė ir mRNR. Genų taikymas buvo didesnis vyriškose ląstelėse (30, 4%), palyginti su moteriškose ląstelėse (5%). Genų taikymo efektyvumas tarp ZFN plazmidės ir ZFN mRNR vyriškų ir moteriškų ląstelių nesiskyrė. Tačiau veiksmingumas, nukreiptas į geną, naudojant donoro DNR naudojant ZFN padedantį HR, parodė dramatiškus skirtumus tarp vyro ir moters ląstelių. Visos KO ląstelės buvo atpažintos PGR metodu kaip heterozigotai, kai buvo sutrikdytas tik vienas CMAH geno alelis: KO ląstelėse buvo gauti tik tikėtini 1, 2 kb PGR produktai, sėkmingai nukreipus CMAH geno lokusą su donoro DNR ir ZFN (3c pav.) .

Pilno dydžio lentelė

Image

a) Donorinės DNR ir pradmenų, naudojamų šiam tyrimui, dizainas. Gruntų, naudojamų genotipui nustatyti, vietos pavaizduotos paveiksle. (b) SNP ZFN surišimo vietos CMAH geno heterozigotiškumas. Sekvenciniai PGR produktai apima ZFN pjovimo vietą rodo, kad ZFN rišimo vietoje yra SNP (rodyklė). Moterys visiškai nesutapo, palyginti su etalonine kiaulių CMAH seka (NC_010449). DNR nukleotido mutacijos vieta yra pažymėta raudona dėžute. c) KO įvykių tikrinimas naudojant PGR. 1, 2 kb PGR produktas, naudojant Neo 3-1 ir ScAS3 pradmenis, rodo KO įvykį. PGR produktai (1, 2 kb) rodo dešinės HR jungties amplifikaciją, naudojant Neo3-1 ir ScAS3 pradmenis. M, dydžio žymeklis (λ / HindIII ir 1 kb kopėčios); P, teigiama kontrolė; N, neigiama kontrolė; Skaičius, G418 atsparios kolonijos. d) ZFN sukurta mutagenezė. PGR produktų sekos sudarymas apima ZFN pjaustymo vietą. Tai rodo, kad vien tik ZFN gali sukelti mutacijas šalia ZFN pjaustymo vietų. Buvo pastebėtas adenozino įterpimas kairėje ZFN pjovimo vietos pusėje. e) Numatoma CMAH aminorūgščių seka iš NHEJ suardyto alelio KO kiaulėms. Priešlaikinį stop kodoną (*) sukuria NHEJ ir aminorūgščių sekų serijos, kol stop kodonas nekoduoja jokio žinomo baltymo. Raudonos raidės rodo naujai susidariusias aminorūgštis dėl rėmelio poslinkio.

Visas dydis

SNP ZFN surišimo vietos CMAH geno heterozigotumas

Kadangi tikslinimo efektyvumas aiškiai skyrėsi tarp vyriškų ir moteriškų ląstelių, mes hipotezavome, kad taikymo efektyvumo skirtumą lėmė nenuoseklus ZFN surišimo afinitetas. Siekiant patvirtinti ZFN surišimo vietą, buvo atlikta tiesioginė PGR produktų sekos iš vyriškos ir moteriškos genomo DNR. Šiame eksperimente naudojami ZFN buvo sukurti remiantis NCBI prisijungimo numeriu NC_010449. Tiesioginio DNR sekos nustatymo kiekybiniai metodai tiksliai nustatė SNP heterozigotiškumą kairiojo ZFN surišimo vietoje vyriškose ląstelėse (3b pav.). AY smailė (žymima citozinu ir timinu) gali būti stebima kairėje vyriškų ląstelių ZFN jungimosi vietoje. Šie rezultatai rodo, kad vyriškose ląstelėse citozinas, esantis ant vieno alelio, buvo pakeistas timinu. Citozinas taip pat buvo mutavęs su timinu abiejuose moters ląstelių aleliuose. Ši analizė patvirtino, kad SNP yra ZFN surišimo vietos srityje, ir paaiškinama, kodėl ZFN surišimo afinitetas moterų ląstelėse greičiausiai sumažėjo.

Norėdami dar labiau patvirtinti mintį, kad ZFN tarpininkavimas taikymas buvo mažesnis dėl SNP ZFN surišimo vietos srityje, genui buvo naudojamos Minesotos mažų kiaulių fibroblastinės ląstelės, turinčios skirtingą genetinį foną, kurių genotipas yra identiškas etaloninei sekai. taikymas. Taikymo efektyvumas vyrų ir moterų ląstelėse buvo panašus (2 lentelė ir 3c pav.). Vidutinis tikslinis vyrų ir moterų ląstelių efektyvumas buvo 41, 7%. Biallelinės modifikacijos iš ZFN buvo panašios tiek vyrams, tiek moterims, naudojant donoro DNR; po vieną įvykį kiekviename. Šios ląstelės su bialleliniu modifikavimu buvo naudojamos CMAH KO kiaulėms gaminti.

Pilno dydžio lentelė

CMAH geno sutrikimas dėl NHEJ

Kai CMAH genui sukurti ZFN buvo įvesti į patinų fibroblastų ląsteles be donoro DNR, aptikta ZFN sukeltos DSB mutacija. Po transfekcijos ląstelės buvo suskirstytos į kelias 96 šulinėlių plokšteles; kiekvienoje duobutėje yra viena ląstelė. Iš viso buvo patikrinta vienuolika ląstelių kolonijų ir viena kolonija parodė tikslinę CMAH geno mutaciją. Mutacija buvo vieno adenozino nukleotidinis įterpimas greta ZFN pjovimo vietos. Taikymo efektyvumas naudojant tik ZFN buvo 9, 1% (1/11 kolonijų; tikslinio įvykio genotipą žr. 3d paveiksle). Vėliau donoro ląstelės buvo naudojamos CMAH KO kiaulėms gaminti ir mes stebėjome DNR sekos polimorfizmą kiaulių genomo ZFN pjaustymo vietoje.

Monoallelių ir biallelinių CMAH išpjaustytų miniatiūrų kiaulių gamyba

Patikrinus kiekvienos kolonijos, gautos iš atskirų ląstelių, KO įvykius, CMAH KO kiaulėms gaminti buvo naudojamos kelios ląstelių kolonijos. C3 vyriškos lyties ląstelės, turinčios ZFN, sukėlė CMAH geno mutaciją per NHEJ, vyriškos D11 ir moteriškos lyties D1 ląstelės, turinčios CMAH bialilelinę modifikaciją, o kitos ląstelių linijos, turinčios CMAH monoallelinę modifikaciją, buvo naudojamos CMAH KO kiaulėms gaminti. Naudojant vyriškas C3 ląsteles, SCNT pagamino 13 paršelių, turinčių 1 bp įterpimą be donoro DNR įterpimo į vieną CMAH alelį (3d pav.). Taip pat buvo pagamintos 5 miniatiūrinės kiaulės, turinčios mono- arba biallelinį CMAH geno modifikavimą, kai genų taikymui buvo naudojamas ZFN su donoro DNR (4a pav. Ir papildomas 1 pav.). Iš klonuotų kiaulių pagamintas DNR genotipas parodė numatomas CMAH geno mutacijas. Iš C3 gautų kiaulių patinų, kaip ir donorų ląstelių, genotipo nustatymas parodė, kad šalia numatomo ZFN pjovimo srities buvo įterptas adeninas. 3e paveiksle pavaizduota modifikuoto CMAH KO kiaulių alelio aminorūgščių seka. Mutacija sukūrė priešlaikinį kodono sustojimą dėl kodono kadro poslinkio. Kai sekos panašumui ieškoti buvo panaudota naujai prognozuojama aminorūgščių seka, jos nepavyko rasti (3e pav.). Naudodami moterišką D1 koloniją, mes sugebėjome užauginti 2 kiaules su BMAH geno biallelinėmis mutacijomis. D1 kiaulėms pasireiškė abiejų alelių mutacijos, kurias, matyt, sukėlė HR ir NHEJ derinys (kiaulių, gautų iš B2 patino ir D1 patelių, genotipai parodyti 4b pav.). Atlikus sekos PGR produktus, amplifikuotus iš HR jungčių, paaiškėjo, kad vieną alelį sutrikdė aiški HR reakcija, o kitą alelį modifikavo įterpdama sutrumpintą donoro DNR formą; buvo aptiktas dalinis Neo genas (apie 500 bp) (papildomas 1a ir c pav.). Šiame tyrime vidutinis SCNT efektyvumas buvo 0, 9% (3 lentelė), o CMAH KO kiaulės pasiekė lytinį brendimą ir yra derlingos, be jokių anomalijų požymių (4a pav.).

Image

a) CMAH KO kiaulių vaizdai. b) CMAH KO kiaulių genotipas. Norint atlikti genotipą, KO įvykiams patikrinti buvo paleisti trys skirtingi PGR. Dešinė rodo dešinės HR sankryžos amplifikaciją naudojant Neo3-1 ir ScAS3 pradmenis. Kairė rodo kairiojo HR jungties amplifikaciją (1, 2 kb endogeninei ir 3, 2 kb KO HR). Ilgas yra visos HR jungties amplifikacija (1, 8 kb endogeniniam ir 3, 7 kb KO HR). Iš Biallelinių KO kiaulių PGR produktai rodo, kad vienas alelis turi 1 bp įterpimą per pilną HR, o kito alelio įterpimas 500 bp yra lokusas: 1 ir 3 juosta: kiaulės iš D1 patelės (biallelio KO); 2 juosta: kiaulė iš B2 (heterozigotinė); 4 juosta: neigiama kontrolė. HR (raudona rodyklė), NHEZ (balta rodyklė) ir Endo (žalia rodyklė) atitinkamai nurodo amplifikuotą DNR pagal homologinę rekombinaciją, nehomologinius galinius sujungimus ir endogeninę DNR. c) CMAH KO kiaulių genetinių DNR FokI domeno PGR amplifikacija [41–1 ir 47–1 yra DNR, gautos iš patinų ir patelių, parodytų (a) punkte. HPRT genas buvo naudojamas kaip vidinė kontrolė. (d) Viršutinis heteroduplekso DNR skaidymas Cel-I nerodė jokių papildomų pašalinių taikinių mutacijų 8-iuose lokusuose, turinčiuose aukščiausią homologiją su CMAH; 1 juosta, AGAP1; 2, TRPM7; 3, NJEJ1; 4, TLK2; 5, TMOD2; 6, ESR1; 7, AKAP13; 8, NME2, SM, dydžio žymeklis. Apačia) Genai, genų IDS ir su CMAH susijusios sekos homologijos, kad būtų pašalintos tikslinės mutacijos. Didžioji raidė: ZFN surišimo vietos; mažosios raidės; ZFN išpjaustymo vieta; homologinės bazės poros raudonai. SM nurodo dydžio žymeklius. e) Western blot analizė: CMAH geno ekspresija fibroblastų ląstelėse iš laukinių, CMAH monoallelinių (MKO) ir biallelinių (BKO) mutantinių miniatiūrinių kiaulių; Aktinas buvo naudojamas kaip namų ūkio baltymas. f) Kontrolinių ir KO kiaulių Neu5Ac ir Neu5Gc turinio palyginimas. Neu5Gc kiekis buvo nustatytas remiantis kiekvieno 1, 2-diamino-4, 5-metilendioksibenzeno (DMB) fluorescencija pažymėto Neu5Gc ir Neu5Ac signalo intensyvumu (smailių plotai iš papildomo 2 pav.). Kiekviena vertė yra trigubų nustatymų vidurkis ± SD ir buvo patvirtinta t-testu.

Visas dydis

Pilno dydžio lentelė

Kadangi antikūnas prieš pelių CMAH neturi kryžminio reaktyvumo su kiaulėmis, sintetiniai peptidai, atitinkantys kiaulės CMAH aminorūgščių liekanas (CQELVVEKDEENG 5-gale ir KDPTDSKGIVEPPEGTK 3-galinei), buvo naudojami kaip imunogenas, siekiant padidinti polikloninius antikūnus prieš kiaulių CMAH triušiuose. Šie afinitetu išgryninti antikūnai specifiškai atpažįsta kiaulės C-galinį CMAH, kaip parodyta Western blot analizėje (4e pav.). Gauta analizė patvirtino viso ilgio CMAH baltymo praradimą fibroblastų ląstelėse, gautose iš homozigotinių mutantų kiaulių, ir reikšmingą CMAH baltymo sumažėjimą heterozigotinėse kiaulėse, tuo tarpu kontrolinėms kiaulėms buvo nustatyta stipri CMAH ekspresija.

Ne tikslinė analizė

Visose tyrimo metu išaugintose kiaulėse nebuvo ZFN konstruktų integracijos požymių; iš kiaulių genominės DNR nebuvo nustatyta FokI sekos amplifikacijos (4c pav. ir 3 papildoma lentelė pradmenų komplektams). Toliau mes išbandėme ZFN skilimo ne vietoje galimybes. 8-iuose lokusuose, ištirtuose atliekant aukščiausią sekos homologiją su cinko pirštų surišimo ir pjaustymo vieta CMAH gene, nebuvo nustatyta jokių tikslinių mutacijų, atlikus tyrėjo mutacijų nustatymo metodą (4d pav. Ir PGR pradmenų rinkinių žr. 4 papildomą lentelę). . Kaip parodyta 4d pav., Šie rezultatai aiškiai parodo, kad CMAH KO kiaulėse nebuvo atsitiktinių tikslinių mutacijų, kurias sukūrė ZFN tarpininkaujantys genomo modifikacijos, o tai rodo aukštą ZFN surišimo ir aktyvumo ištikimybę.

Sumažėjęs HD ir Tn susijusių genų nuorašo lygis CMAH KO kiaulės ląstelėse

Hanganutziu-Deicher (HD) vaidina lemiamą vaidmenį ūminiam imuniniam kiaulių ksenografų atmetimui . 23, 24, 26 . Todėl mes ištyrėme sialio rūgšties (Sias) kiekį pagal chromatogramos intensyvumo signalą fibroblastų ląstelėse, gautose iš kontroliuojamų, monoallelinių (MKO) ir biallelinių (BKO) suaugusių CMAH KO kiaulių, naudodami kalibravimo kreivę, gautą DMB dariniui. standartiniai Neu5Ac ir Neu5Gc (4f pav. ir papildomas 2 pav.). Skirtingai nei kontrolinėse ir CMAH MKO kiaulėse, fibroblastų ląstelėse, gautose iš CMAH BKO kiaulių, neradome jokio NeuGC.

Paprastai HD antigenų šeimos buvo klasifikuojamos kaip 2 skirtingos porūšiai; ST3Gal1, ST3Gal2, ST3Gal3, ST3Gal4, ST3Gal5, ST3Gal6 - ST3Gal, ST6Gal1 ir ST6Gal2 - ST6Gal, pagal sintezuotų angliavandenių ryšį 27 . Kontrolinių, monoallelinių ir biallelinių kiaulių mRNR lygiui normalizuoti buvo naudojamas vidinis etino mRNR. Po normalizacijos su mRNR, ST3Gal1, ST3Gal3 ir ST6Gal1 genų ekspresija biallelinėse CMAH KO kiaulėse buvo žymiai sumažinta, tuo tarpu ST3Gal2, ST3Gal4 ir ST6Gal2 biallelinėse CMAH KO kiaulėse buvo padidinta, palyginti su kontrolinėmis kiaulėmis. (Pav. 5 ir RT-PGR pradmenų komplektų 5 lentelę). Šis pastebėjimas leido manyti, kad dėl žemai sureguliuotų ST3Gal1, ST3Gal3 ir ST6Gal1 biallelinėse CMAH KO kiaulėse gali sumažėti Siaα2, 3Galβ1, 3GalNAc-R, Siaα2, 3Galβ1, 4GlcNAc-R ir Siaα2, 6Galβ1, 4GlcNAc-R raiška. Siaα2, 3Galβ1, 3GalNAc-R, Sialyl Lew X: Siaα2, 3Galβ1, 4 (Fucα1, 3) GalNAc-R ir Siaα2, 4Galβ1, 4GlcNAc-R ekspresija, atitinkamai veikiantys kaip imuninis antigenas persodintiems recipientams. Be to, STSGalNac6 ekspresija Sialyl-Tn antigenui, GalNT3 ir GalNT7 raiška Tn antigenui biallelinėse CMAH KO kiaulėse, palyginti su kontrolinėmis kiaulėmis, buvo žymiai sumažinta (5b, c pav.).

Image

a) Elektroforetinė RT-PGR analizė iš kontroliuojamų, monoallelinių ir biallelinių CMAH KO kiaulienos ląstelių ląstelių. (b) Sialiltransferazės genų ekspresijos palyginimas kontroliuojamose, monoallelinėse ir biallelinėse kiaulės fibroblastinėse ląstelėse realaus laiko RT-PGR. c) realiojo laiko RT-PGR analizės kiekybinis įvertinimas kontrolinėse, monoallelinėse ir biallelinėse kiaulių fibroblastinėse ląstelėse. Visos RT-PGR reakcijos buvo atliktos trimis tiražais ir normalizuotos naudojant kiaulės aktino mRNR. Kiekvienos kiaulės monoallelių ir biallelinių kiaulių santykinės vertės pateikiamos kaip n-raiškos skirtumo skirtumas, palyginti su kontroline kiaulė, kuri buvo nustatyta kaip 1. * P <0, 05 ir ** P <0, 001.

Visas dydis

Diskusija

Čia parodome kiaulių CMAH geno ZFN tarpininkaujamo KO įgyvendinamumą ir sėkmingą CMAH monoallelių ir biallelinių KO kiaulių produkciją SCNT naudojant ZFN nukreiptas ląsteles. Nors galimas transgeninių kiaulių panaudojimas yra gerai žinomas, tačiau genetiškai modifikuotų kiaulių pritaikymas praktikoje yra kliudomas, nes jų gamyba nėra veiksminga. Šie neefektyvumai yra bendras rezultatas, kai somatinėse ląstelėse įvedama genetinė modifikacija, o vėliau kiaulės pagamintos SCNT. Čia aptariamas donorų ląstelių genetinio modifikavimo efektyvumas ksenotransplantacijai.

Gal epitopai yra pagrindiniai ksenoantigenai, sukeliantys hiperaktyvų atmetimą ksenotransplantacijos metu tarp kiaulių ir žmonių 28 . Šie Gal epitopai taip pat dalyvauja ūminiame ksenografų kraujagyslių atmetime. Ankstesnis tyrimas parodė, kad genetiškai modifikuotų gyvūnų, neturinčių pagrindinio GGTA1 geno ksenoepitopo Gal pagal KO, organai buvo nepaprastai apsaugoti nuo žmogaus komplikacijų sukelto sužalojimo, tačiau ksenografuoti organai nuo kiaulės iki babuino galiausiai mirė dėl ūmaus humoralinio ksenografto atmetimo 29 . Šis pastebėjimas aiškiai rodo, kad reikalingas tolesnis vystymasis, norint kontroliuoti ūminį kraujagyslių ir ląstelių atmetimą bei lėtinį ksenografų atmetimą (pvz., Indukuojant toleranciją). Angliavandeniai, tokie kaip Hanganutziu-Deicher (HD), Thomsen-Friedenreich (T arba TF), Tn ir sialyl-Tn, vaidina lemiamą vaidmenį ūminiam imuniniam kiaulių ksenografų atmetimui 26 . Tarp jų HD antigenai yra su glikokonjugatais sujungta N-glikolneuramininė rūgštis (Neu5Gc), kuri yra sialio rūgšties rūšis, tokia kaip N-acetilneuramininė rūgštis (Neu5Ac). Į tarpląstelinę būklę Neu5Gc daugiausia gaminamas iš Neu5Ac, katalizuojant CMAH citochromu b5 ir NADH kaip kofaktoriu 26 . Nors iš BKO gaunamų fibroblastų ląstelės neparodė jokios Neu5Gc ekspresijos, HD, T ar TF, Tn ir sialilo-Tn genų mRNR ekspresija BKO išvestose fibroblastų ląstelėse buvo sumažinta arba padidinta, palyginti su laukiniais tipais. (5 pav. Ir papildomas 2 pav.) Tai skiriasi nuo rezultatų, gautų naudojant dvigubas KO peles, kuriose genų ekspresija buvo sumažinta. Šį neatitikimą galima nustatyti atsižvelgiant į rūšių ar ląstelių specifiškumą. Taigi šiuos neatitikimus gali reikėti ištirti toliau.

Šiame tyrime mes sugebėjome sugeneruoti CMAH KO ląsteles pagal ZFN arba ZFN su donoro DNR, nors taikinio įvykio efektyvumas buvo didesnis, kai donoro DNR buvo naudojama kartu su ZFN; Atitinkamai 9, 1% ir 41, 7% (1 lentelė). Be to, nebuvo naudojami jokie bialiniai CMAH pokyčiai, kai buvo naudojami tik ZFN. Galimas šio skirtumo paaiškinimas yra tai, kad sunku išrinkti neperkeltus iš visų ląstelių, naudojamų transfekcijai. Tai paaiškina, kodėl ankstesniuose tyrimuose ZFN buvo transfekuoti kartu su atrankos žymekliu 15, 30 . Tačiau mes sugebėjome gaminti monoallelines CMAH KO ląstelių linijas ir kiaules tiesiog įvesdami ZFN konstruktus. Mes taip pat efektyviai gavome CMAH KO ląsteles, naudodami ZFN padedantį HR kiaulių fibroblastų ląstelėse, nepaisant to, kad KO vektorių sudarė labai trumpa HR ranka (2 pav.). Mūsų žiniomis, tai yra pirmasis tyrimas, parodantis genų taikymą naudojant ZFN padedant donoro DNR kiaulių somatinėse ląstelėse.

Nebuvo pastebėta jokių reikšmingų skirtumų tarp ZFN plazmidės ir ZFN mRNR tikslinio efektyvumo atžvilgiu. Pirmajame eksperimente, naudojant tikslinį vektorių (donoro DNR), vektorius efektyviai pakeitė taikinių sekas vyriškose ląstelėse, bet ne moteriškose ląstelėse (2 lentelė) be biallelinių modifikacijų požymių. Tai priešingai nei išvados, susijusios su kiaulių kiaulių GGTA1 geno ištrynimu pagal ZFN, kai nebuvo pastebėtas lyčių skirtumas nustatant ZFN nukreipimą į ląsteles 31 . Išsamesnis tyrimas atskleidė SNP buvimą ZFN surišimo vietoje. Vyriškose ląstelėse kairiojo ZFN surišimo vieta turėjo vieną bazinę porą, neatitinkančią vieno alelio, o moteriškose ląstelėse abiejų alelių neatitikimas buvo lyginamas su NCBI etalonine seka. Dėl neatitikimo greičiausiai moteriškos lyties, palyginti su vyriškos lyties, tikslinimo efektyvumas buvo mažas. Tai buvo dar kartą patvirtinta, kai panaudojome fibroblastų ląsteles, turinčias tą patį genotipą, kaip ir pamatinė seka NCBI, taikydami ZFN tarpininkaujantį geną; buvo pastebėtas didelis tikslinimo efektyvumas tiek vyriškose, tiek moteriškose ląstelėse (2 lentelė ir 3b pav.). Be to, galėtume gauti biallelinį KO vyriškos ir moteriškos somatinėse ląstelėse. Mūsų išvados pabrėžia potencialių ZFN jungimosi vietų sekų patvirtinimo svarbą prieš ZFN surinkimą. Be to, šie rezultatai rodo, kad genas, nukreiptas pagal ZFN padedantį HR, gali įvykti gene, kuris turi SNP ZFN surišimo vietos heterozigotiškumą; tačiau bialleliniam modifikavimui greičiausiai reikia identiškos ZFN atpažinimo sekos atitikties.

Kai mes toliau tyrėme homologijos ilgį, reikalingą HR panaudojimui per ZFN tarpininkaujant genų taikymui, net labai mažas DNR fragmentas, turintis homologiją, galėjo sukelti HR. Tačiau donoro DNR homologija, mažesnė nei 100 bp, lėmė HR nebuvimą per ZFN tarpininkaujant genų taikymui. Be to, mes galime rasti ryšį tarp HR efektyvumo ir homologijos ilgio donoro DNR; ilgesnė homologija lėmė didesnį HR efektyvumą. Remdamiesi šiais atradimais mes siūlome, kad homologija turėtų būti ne mažesnė kaip 100 bp, kad indukuotų HR ZFN tarpininkaujamame gene, nukreiptame naudojant kiaulių somatines ląsteles. Daugelis tyrėjų tikslinės sekos rekombinacijai panaudojo ilgas homologines dalis (6, 8–21 kb). Ankstesnės ataskaitos rodo, kad paprastai ŽS žinduolių ląstelėms indukuoti reikalinga 200–800 bp homologija, besiribojanti su ZFN taikinių vietomis 32 . Musėse rekomenduojamas bendras homologijos ilgis yra 200–500 bp 33 . Mūsų rezultatai rodo, kad homologija gali būti trumpesnė (apie 100 bp), nei buvo pranešta anksčiau; tačiau ilgesnė homologija gali padidinti HR įvykių su donoro DNR dažnį, kai nukreipiama į ZFN tarpininkaujantį geną. Ši informacija bus naudingas parametras kuriant donoro DNR, kuri gali būti naudojama nukreipiant ZFN tarpininkaujant genams.

ZFN panaudojimas kiaulių ląstelėse, apie kurias pirmiausia buvo pranešta perkeliant ZFN mRNR į kiaulių somatines ląsteles, išreiškiančias eGFP geną, lėmė ZFN sukeltą tikslinės eGFP geno sekos 13 išstūmimą. Tada mes parodėme taikymą pagal ZFN, o SCNT galėjo būti naudojamas kiaulėms auginti su specifinėmis genetinėmis modifikacijomis 14 . 2011 m. Buvo pirmasis pranešimas apie ZFN, nukreiptą į endogeninį kiaulių geną 15, kuriame buvo pranešta apie heterozigotines PPARγ KO kiaules. Efektyvumas buvo 4, 2%, tačiau tik 20% kiaulių sutrikdė PPARγ, kai ląstelės buvo naudojamos kaip SCNT donorai. Šiame tyrime mes sugebėjome nustatyti tikslinių donorų ląstelių genotipą prieš SCNT, o visos kiaulės nustatė numatomus genotipus. Neseniai buvo pranešta apie biallelinių GGTA1 KO kiaulių auginimą naudojant ZFN ir SCNT 17 . Tai buvo pirmasis pranešimas apie biallelinį endogeninio geno modifikavimą kiaulėms naudojant ZFN. Biallelinio taikymo efektyvumas tyrime buvo maždaug 1% donoro ląstelėse po ZFN transfekcijos. Kaip minėta įvade, GGTA1 KO ląstelės gali būti rūšiuojamos arba lektino pagrindu, arba vaisto atrankos metodais ir naudojamos SCNT 17, 30, 34 . Todėl žemas veiksmingumas nustatant geną gali būti ne gyvybiškai svarbus. Tačiau gali būti atvejų, kai tokios selekcijos metodikos nėra praktiškos ar tinkamos konkrečiai genetinei modifikacijai. Mūsų tyrime vidutinė biallelio modifikacija naudojant ZFN su donoro DNR buvo 5, 6%. Kadangi dar neturėjome atrankos metodo CMAH KO ląstelėms nustatyti, mes nustatėme CMAH KO mutantus donorų ląstelių kolonijose, gautose iš pavienių ląstelių, ir pagaminome KO kiaules naudodamiesi tomis ląstelėmis.

Ankstesni GGAT1 KO tyrimai, naudojant ZFN, KO kiaulėms du kartus sukėlė SCNT 17, 30 . Pirmasis SCNT turas buvo atliktas naudojant GGTA1 KO ląstelių fondą, o tada vaisiai buvo paimti iš pirmojo SCNT. Atlikus vaisiaus genotipą, kiaulės buvo pakartotinai klonuotos iš ląstelių su pasirinkta mutacija. Tai suprantama, nes fibroblastinės ląstelės yra pirminės kultūrinės ląstelės, turinčios ribotą proliferacijos pajėgumą. Šiame tyrime mes sugebėjome efektyviai nustatyti genetinius modifikacijas fibroblastų ląstelėse pagal ZFN, taip leisdami mums gaminti KO kiaules tik vienu SCNT ratu. Palyginti su ankstesniais tyrimais, kuriuose KF kiaulėms gaminti buvo naudojamas ZFN, mes galėtume efektyviau gaminti CMAH KO kiaules. Norint gaminti genetiškai modifikuotas kiaules, labai svarbu veiksmingai modifikuoti somatines ląsteles SCNT. Čia parodome, kad KO kiaulės gali būti efektyviai generuojamos naudojant ZFN. Mes sugebėjome gaminti CMAH KO kiaules iš KO ląstelių, gautų vien tik iš ZFN, ir iš ZFN su donoro DNR, tačiau tikslo efektyvumas naudojant donoro DNR buvo didesnis. Pabaigus šį rankraštį, mes radome ataskaitą, kurioje aprašyta CMAH KO kiaulių gamyba 35 . Šiame tyrime sėkmingai sukūrėme tiek CMAH KO kiaulių, tiek vyrų, tiek moterų. Tiek vyriškos, tiek moteriškos ląstelės parodė didelį ZFN surišimo ir aktyvumo ištikimumą, taip pat pademonstravome veiksmingą būdą, kaip panaudoti donoro DNR, nukreipiant geną į ZFN tarpininkaujant.

Apibendrinant galima pasakyti, kad šio tyrimo metodai apibūdina specifinių CMAH KO ląstelių linijų ir kiaulių generavimo metodą, kurį galima panaudoti norint išbandyti seniai iškylantį klausimą, kodėl Gal-T KO kilmės kiaulių organai, persodinti į babuinus, galiausiai sukelia ūmų atmetimą. Apibendrinant, mes prognozuojame, kad šios Minesotos miniatiūrinės CMAH KO kiaulės bus vertingi šaltiniai kiaulių ir žmonių ksenotransplantacijai.

Metodai

Tyrimo protokolas ir standartinės darbo procedūros buvo peržiūrėtos ir patvirtintos Pietų Korėjos nacionalinio gyvulininkystės instituto gyvūnų globos ir naudojimo instituciniame komitete (IACUC patvirtinimo numeris: 2010-006, D laipsnis). Visus eksperimentuose naudojamus gyvūnus patvirtino Misūrio universiteto Institucinis gyvūnų priežiūros ir naudojimo komitetas.

ZFN ir ZFN veiklos projektavimas ir konstravimas

Visi reagentai buvo įsigyti iš „Sigma-Aldrich“ (Sent Luisas, MO, JAV). Apibrėžtas galvijų vaisiaus serumas (FBS), DMEM, nepakeičiamos aminorūgštys ir natrio piruvatas buvo įsigyti iš HyClone (Logan, UT, JAV). Visi restrikcijos fermentai buvo įsigyti iš Takaros (Ohtsu, Japonija). ZFN, skirti suskaidyti CMAH geno 8 egzono sritį, buvo įsigyti iš „Sigma-Aldrich“. Šie ZFN turėjo penkių cinko pirštų baltymą, atpažįstantį 15 bazių (1a pav.).

Donoro išmušimo vektoriaus konstravimas

Homologinės rankos, naudojamos KO kiaulėms gaminti, buvo amplifikuotos polimerazės grandinine reakcija (PGR) iš Minesotos miniatiūrinės kiaulių genominės DNR. CMAH geno 789 bp 5 ′ fragmento fragmentas buvo klonuotas PGR amplifikacija, naudojant priekinį gruntą su nepagruntuota XbaI vieta (TCTAGACTCTCTATTTGGTGGCTCTGTTT) ir atvirkštinį pradmenį su papildoma EcoRI vieta (GAATTCAGGAGTTTCTTCCTTTCTGTTTT). 763 bp 3 ′ rankos fragmentas buvo amplifikuotas, naudojant priekinį gruntą su papildoma XhoI vieta (CTCGAGCCTACAACCCAGAATTTACTGCC) ir atvirkštinį pradmenį su papildoma KpnI vieta (GGTACCAACAGGGACCTGCCAAGAGGCCA). PGK-neo-polyA fragmentas teigiamam atrankai buvo išskirtas iš pKJ2 neo plazmidės, suardžius EcoRI ir XhoI. Visi fragmentai PGR amplifikacijai buvo subklonuoti į pGEM-T lengvą vektorių (Promega. Madison, WI, JAV), o visų fragmentų sekos buvo patvirtintos. Norėdami sukonstruoti KO vektorių (donoro DNR), PGK-neo-polyA fragmentas buvo ligotas į pBluescriptII SK plazmidės EcoRI ir XhoI vietas, kad gautų pBSK-PGK-neo-poliA plazmidę. Tada 789 bp 5 ′ rankos fragmentas buvo įterptas į pBSK-PGK-neo-polyA plazmidės Xbal ir EcoRI vietas, kad būtų gauta pBSK-5 ′ arm-neo plazmidė. Galiausiai, norint sugeneruoti KO vektorių, 763 bp 3 ′ rankos fragmentas buvo sujungtas su pBSK-5′arm-neo plazmidės XhoI ir KpnI (1b pav.). Šie KO vektoriai prieš transfekciją buvo linearizuojami suardant NotI restrikcijos fermentu.

Norint sukonstruoti donoro DNR su minimalia homologine seka, 5 ′ ir 3 ′ rankos (789, 240, 200, 160 ir 76 bp) buvo klonuojamos PGR amplifikacija, naudojant pradmenų rinkinius 1 papildomoje lentelėje. Šie pradmenų rinkiniai turėjo NotI ir EcoRI apribojimus. kairiosios rankos fermento vieta ir dešinės rankos HindIII ir XhoI restrikcijos fermento vieta. PGK-neo fragmentas (EcoRI-SalI) buvo amplifikuotas, naudojant pKJ2 plazmidę kaip šabloną, naudojant PGR su sensaciniu pradmeniu (GAATTCTACCGGGTAGGGGAGGCGC) ir antissensinį pradmenį su papildoma SalI seka. 2A seka (92 bp) buvo išskirtas pBSK-2A sekos plazmidės XhoI ir KpnI restrikcijos fermentais. EGFP buvo klonuotas naudojant PEGFP-N3 plazmidę kaip šabloną, naudojant PGR, naudojant priekinį gruntą su papildoma KpnI vieta (GGTACCATGGTGAGCAAGGGCGAGGAGCTGT) ir atvirkštinį pradmenį su papildoma HindIII vieta (AAGCTTTTACTTGTACAGCTCGTCCATGCCG). PGK-neo (EcoRI-SalI) buvo sujungtas į pBSK (EcoRI-SalI) vektorių, kad gautų pBSK-PGKneo plazmidę. 2A seka (XhoI-KpnI) buvo įterpta į pBSK-PGKneo plazmidės SalI-XhoI vietą, kad būtų gauta pBSK-PGKneo-2A plazmidė. EGFP fragmentas (KpnI-HindIII) buvo sujungtas į pBSK-PGKneo-2A plazmidės KpnI-HindIII vietą, kad gautų pBSK-PGKneo-2A-EGFP plazmidę. Norint gauti ilgą ir trumpą rankos išmušimo vektorių, 5 ′ ir 3 ′ rankos fragmentai buvo įterpti į pBSK-PGKneo-2A-EGFP plazmidės NotI-EcoRI ir HindIII-XhoI vietas. Linearizuotų įpratimo vektorių transfekcijai į kiaulių fibroblastus, įpjaustymo vektoriai buvo suskaidomi NotI fermentu.

Kiaulės ausies fibroblastų paruošimas ir auginimo sąlygos

Kiaulių ausies fibroblastinės ląstelės buvo paruoštos iš ausų odos biopsijos iš specifinių Minesotos patinų ir patelių miniatiūrinių kiaulių, saugomų Seulo nacionaliniame universitete 36 . Fibroblastai buvo pasėti ant indų ir plokštelių, padengtų želatina, ir plokštelių (SPL Lifescience, Gyeonggi-Do, Korėja) ir kultivuoti DMEM, papildyta 15% apibrėžta FBS, 1 x nepakeičiamų aminorūgščių, 1 × natrio piruvato, 0, 1 mM â- merkaptoetanolio, 100 vienetų ml −1 penicilino ir 100 μg ml −1 streptomicino, sudrėkintoje atmosferoje, kurioje 37% C yra 5% CO 2 .

Nokauto vektoriaus, ZFN plazmidės ar RNR transfekcija

Fibroblastai buvo kultivuojami iki 90% santakos, po to plaunami EDTA-PBS ir apdorojami 0, 25% tripsino-EDTA. Po to, kai fibroblastai buvo suspenduoti kultūrinėje terpėje, ląstelės buvo išskirtos centrifuguojant, o tada ląstelės buvo resuspenduotos 1, 25x107 ląstelių ml –1 F10 maistinių medžiagų mišinyje elektroporacijai. Ląstelių suspensija (400 μL) buvo elektroporuota 4 mm kiuvetėje su keturiais 1 ms impulsais, naudojant 400 V talpines iškrovas, naudojant BTX elektroelementų manipuliatorių (ECM 2001, BTX, Holliston, MA, JAV). Iš viso 10 μg linearizuoto išmušimo vektoriaus ir žiedinės ZFN plazmidės arba RNR buvo sumaišyti su 100 μL F10 maistinių medžiagų mišinio, kurio molinis santykis yra 1: 1: 1 (išmušimo vektorius: kairysis ZFN: dešinis ZFN) ir buvo naudojami elektroporacijai. Po elektroporavimo kiuvetė 10 minučių buvo dedama ant ledo. Kiuvetės ląstelės buvo pakartotinai suspenduotos 10 ml terpės, paskirstytos į 48 šulinėlių plokštelę ir toliau auginamos 24 valandas. Antibiotikų selekcija buvo atliekama 11 dienų, naudojant 300 μg mL −1 G418 (Gibco BRL, Grand Island, NY, JAV). Po atrankos pavienės kolonijos buvo perkeliamos į 24 duobučių plokšteles ir toliau auginamos analizei PGR būdu (apie pradmenų rinkinius skaitykite 2 papildomoje lentelėje).

Išnaikintų kolonijų ir kiaulių atranka ir analizė

Knockout kolonijos buvo identifikuotos pagal pirmąjį ir antrąjį PGR. 200 μL ląstelių suspensijos alikvotinė dalis iš 24 šulinėlių plokštelės buvo gauta centrifuguojant, kad būtų patikrinta G418 atsparių kolonijų patikra pagal pirmąjį PGR. CMAH KO kolonijų atrankai naudojami pradmenys parodyti 2 papildomoje lentelėje. Ląstelės buvo pakartotinai suspenduotos 50 μL distiliuoto vandens, kuriame yra 0, 05 mg / ml proteinazės K (Roche, Indianapolis, IN, JAV). Norėdami išgauti genominę DNR, ląstelės buvo inkubuojamos 55 ° C temperatūroje 130 minučių ir 10 minučių kaitinamos iki 98 ° C iki neaktyvios proteinazės K. Pirmasis PGR buvo atliktas 50 μL tūrio, kuriame buvo 20 μL genomo ekstrakto, 0, 1 M Neo3. -1 ir CMAH ScAS3 pradmenys, esantys už rekombinacijos srities ribų, 1 × PGR buferis, 1, 25 U Ex Taq DNR polimerazė (Takara) ir 200 μM kiekvieno dNTP. PGR amplifikacija buvo pakartota 35 ciklus po 30 sek., Esant denatūracijai 95 ° C, 30 sek., Esant 68 ° C atkaitinimui, ir 2 min., Esant 72 ° C, pratęsimui. Pirmojo PGR teigiamos kolonijos buvo subkultūruojamos 12 ir 6 šulinėlių plokštelėse, taip pat 6 cm ir 10 cm induose, po vieną. Tada ląstelės buvo užšaldomos terpėje (terpėje, kurioje yra 10% DMSO) tolimesnei analizei. Pirmai PGR analizei iš teigiamų ląstelių buvo išskirta genominė DNR, naudojant „GenElute“ žinduolių genominės DNR Miniprep rinkinį (Sigma-Aldrich), kad būtų galima tiksliai analizuoti KO kolonijas per antrąją PGR. Antrasis PGR amplifikacija buvo atliktas tomis pačiomis sąlygomis kaip ir pirmasis PGR. Kelios HR jungtys buvo amplifikuotos naudojant ScS5 / CMAHR ir ScS5 / ScAS3 pradmenis (2 papildoma lentelė). PGR produktai (20 μL) buvo patvirtinti elektroforeze naudojant 0, 8% agarozės gelį.

ZFN surišimo vietos analizė

Genominė DNR buvo išgauta iš Minesotos miniatiūrinių kiaulių patinų ir moterų ausų fibroblastų, naudojant „GenElute Mammalian Genomic DNA Miniprep“ rinkinį (Sigma-Aldrich). PGR reakcijos buvo atliktos su 100 ng genominės DNR, 200 μM kiekvieno dNTP ir 1, 25 vieneto Ex Taq DNR polimerazės, 1 × PGR buferio, 0, 1 M jutimo (CTACTTCTGCATCACTCAACTGTCA) ir antisense pradmens (AAAATAAGCTCCAGACCCCTACTAA), viso tūrio 50 μl. Iš pradžių DNR denatūravo 98 ° C temperatūroje 2 minutes, po to buvo veikiami 35 ciklų 95 ° C 30 s, 58 ° C 30 s ir 72 ° C 1 min., O paskutinis pratęsimo žingsnis buvo 72 ° C. 15 min. PGR produktai (377 bp) buvo elektroforezuoti ant 1, 2% agarozės gelio, o amplifikuoti DNR fragmentai buvo išgauti iš gelio ir išgryninti naudojant „QIAquick Gel Extraction kit“ (Qiagen. Valencia, CA, JAV). Tiesioginis abiejų sruogų sekavimas buvo atliktas naudojant „ABI PRISM 3730XL“ DNR analizatorių („Applied Biosystems“, Foster City, CA, JAV), ir kiekviena elektroferograma buvo vizualiai išanalizuota naudojant „Chromas 2.13“ („Technelysium Pty Ltd.“, Helensvale, Queensland, Australija).

Nėra ZFN konstrukto integracijos į kiaulių genomą

Norint ištirti ZFN konstrukto buvimą genome, PGR pagalba buvo amplifikuotas FokI domeno fragmentas ZFN vektoriuje ir hipoksantino guanino fosforibosiltransferazės (HPRT) genas. Iš CMAH KO kiaulių išaugintų ląstelių genomo DNR buvo išskirta, kaip aprašyta anksčiau. PGR buvo panaudota penkiasdešimt ng genominės DNR. PCR amplifikacijos sąlygos buvo pradinė denatūracija 2 min. 95 ° C temperatūroje, po to sekė 32 ciklai po 30 sek., Esant 94 ° C denatūracijai, 30 sek., Esant 55 ° C atkaitinimui, ir 30 min., Esant 72 ° C prailginimui (žr. 3 papildoma lentelė PGR pradmenų rinkiniams). Numatomas PGR produktų dydis buvo 170 bp FokI ir 798 bp HPRT. Kaip teigiama kontrolė FokI buvo naudojama ZFN plazmidė, o HPRT - laukinio tipo kiaulių DNR. PGR produktai buvo įpilti į 2, 0% agarozės gelį.

Somatinių ląstelių branduolio pernešimas (SCNT)

SCNT tyrimams iš paršavedžių išvežti oocitai buvo įsigyti iš ART (Madison, WI). Oocitai buvo surinkti iš paršavedžių kiaušidžių, po to per naktį pernešami į brandinimo terpę (TCM199 su 2, 9 mM Hepes, 5 μg / ml insulino, 10 ng / ml EGF, 0, 5 μg / ml p-FSH, 0, 91 mM piruvato, 0, 5 mM cisteino, 10 proc.). kiaulės folikulo skystis, 25 ng / ml gentamicino). Atvykę oocitai buvo perkelti į šviežią terpę ir auginami papildomai 20–24 valandas. Po 40–42 val. Subrendimo gumulinės ląstelės buvo pašalintos iš oocitų, maišant 3 minutes, esant 0, 1% hialuronidazei. Nuimtais oocitais buvo manipuliuojama manipuliavimo terpėje, papildytoje 7, 0 μg / ml citochalazino B. Polinis kūnas kartu su gretimos citoplazmos dalimi buvo pašalintas, o donoro ląstelė buvo įdėta į perivitellino erdvę, kaip aprašyta anksčiau. Tada rekonstruoti embrionai buvo sulydyti suliejimo terpėje (0, 3 M manitolio, 0, 1 mM CaCl 2, 0, 1 mM MgCl 2, 0, 5 mM Hepes) dviem nuolatinės srovės impulsais (1 sek. Intervalas), esant 1, 2 kV / cm, 30 μs (naudojant BTX). Elektros ląstelių manipuliatorius, Harvardo aparatūra, Holliston, MA). Po suliejimo sulieti embrionai buvo visiškai suaktyvinti 200 μM timerozaliu 10 min. Tamsoje, po to 8 mM ditiotreitolio 30 min. 38 . Embrionai buvo inkubuojami PZM3 39 su 0, 5 μM skriptu, histono dezacetilazės inhibitoriumi, 14–16 valandų. Kitą dieną SCNT embrionai chirurginiu būdu buvo perkelti į surogato ampuliarinę ir isteminę jungtį, praėjus 0 arba 1 dienai po pastebėto estrus.

Antikūnų gamyba ir Western blot analizė

Triušio antiserumas buvo išaugintas naudojant kiaulės CMAH sintetinius peptidus, atitinkančius aminorūgščių liekanas (CQELVVEKDEENG 5-gale ir KDPTDSKGIVEPPEGTK 3-gale). Polikloninių antikūnų gamybai triušiams buvo įšvirkštas afinitetu išgrynintas CMAH baltymas, iš pradžių su pilnu Freundo adjuvantu, vėliau su nepilnu Freundo adjuvantu. Polikloniniai antikūnai iš serumo buvo išgryninti naudojant „Protein G Sepharose“ kolonėlę (Amersham Pharmacia, Orsay, Prancūzija) ir buvo tiriami CMAH atpažinimui ELISA metodu. Kohler ir Milstein 40 metodas buvo pritaikytas gaminti monokloninius antikūnus. Pasirinktų monokloninių antikūnų izotipai buvo nustatyti naudojant komerciškai prieinamą izotipų rinkinį (Roche Diagnostics, Manheimas, Vokietija). Western blot ir sialio rūgšties kiekio analizė buvo suprojektuota ir atlikta, kaip aprašyta anksčiau 39, 19 .

Sialio rūgšties kiekio analizė

Iš viso 0, 2 ml WT, MKO, BKO-CMAH nulinių kiaulių ląstelių lizato buvo sumaišyti su tokiu pat tūriu 4 M propiono rūgšties (pH 2, 3). Remiantis ankstesne ataskaita, sialio rūgštys (Sias) buvo atpalaiduojamos inkubuojant 80 ° C temperatūroje 4 valandas. Mėginiai buvo aušinami ir centrifuguojami 10 min., Esant 20 000 g. Gautos granulės buvo pakartotinai suspenduotos 0, 5 ml 0, 1 M HCl, inkubuojamos 1 valandą 80 ° C temperatūroje, kad Sias būtų visiškai išlaisvintos iš glikokonjugatų, ir centrifuguojamos, kaip aprašyta aukščiau. Supernatantai, surinkti po hidrolizės, buvo praleisti pro Amicon Ultra-0.5, Ultracel-3 membranos filtrą (Millipore, Bedfordas, MA, JAV), o visi išsiskyrusių Sias mėginiai buvo liofilizuojami, pakartotinai suspenduoti 10 µL 2 M acto rūgšties ir inkubuojami. 2 val. 55 ° C temperatūroje tamsoje 50 μL reagento, susidedančio iš 7 mM 1, 2-diamino-4, 5-metilendioksibenzeno (DMB), 0, 75 M 2-merkaptoetanolio ir 18 mM NaHSO 3, ištirpinto vandenyje. Mėginiai buvo atšaldyti po derivatizacijos ir 10 μL alikvotinės dalys buvo analizuojamos HPLC naudojant atvirkštinės fazės ODS kolonėlę (4, 6 x 150 mm, TSK-gelio kolonėlė ODS-80TM; „Tosoh Bioscience“) su 30% judančiąja metanolio faze. Srauto greitis buvo palaikomas ties 0, 5 ml / min., O išvestiniai Neu5Ac ir Neu5Gc buvo aptikti naudojant modelį RF-10A fluorescencinį detektorių (Shimadzu, Tokijas, Japonija) esant sužadinimo ir emisijos bangos ilgiui atitinkamai 373 nm ir 448 nm, atitinkamai 42 . Neu5Ac ir Neu5Gc kiekybinis įvertinimas buvo atliktas išmatuojant kiekvieno mėginio chromatografinius smailių plotus ir naudojant kalibravimo kreivę, gautą standartinių Neu5Ac ir Neu5Gc DMB dariniams (Sigma-Aldrich).

RNR išskyrimas ir realaus laiko RT-PGR

Visa RNR buvo ekstrahuota iš WT, MKO ir DKO CMAH neturinčio kiaulės fibroblastų naudojant RNeasy mini rinkinį (Qiagen, Valensija, CA, JAV). Realaus laiko atvirkštinės transkriptazės polimerazės grandininė reakcija (RT-PCR) buvo atlikta naudojant „ABI ViiA ™ 7“ sistemą („Applied Biosystems“, Foster City, CA, JAV) ir „SYBR Green“ kaip dvigubos grandinės DNR specifinius fluorescencinius dažus („Bio-Rad“)., Hercules, CA, JAV) (RT-PGR pradmenų rinkinius žr. 5 papildomoje lentelėje). Kiaulės aktino genas buvo naudojamas kaip vidinė kontrolė, norint normalizuoti RT-PGR efektyvumą ir kiekybiškai įvertinti genų raišką WT kiaulėje, heterozigotinėse ir homozigotinėse CMAH KO kiaulėse gautoje mRNR. Normalizavę aktino mRNR, mes palyginome kiekvienos mRNR santykinę iš heterozigotinių ir homozigotinių CMAH KO kiaulės genų ekspresiją su kontrolinių. Mes atlikome RT-PGR kiekviename mėginyje atskirai ir trimis egzemplioriais.

Papildoma informacija

PDF failai

  1. 1.

    Papildoma informacija

    Papildomi duomenys

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.