Spartus taksonominių atradimų, pagrįstų DNS brūkšniniu kodu ir morfologija, sklaida | mokslinės ataskaitos

Spartus taksonominių atradimų, pagrįstų DNS brūkšniniu kodu ir morfologija, sklaida | mokslinės ataskaitos

Anonim

Dalykai

  • Filogenetika
  • Taksonomija

Anotacija

Taksonominėms kliūtims būdingas silpnėjantis klasikinis taksonominis patyrimas ir lėtas revizijos darbo tempas, todėl reikia greitesnių taksonominių įvertinimų. Čia mes susiejame greitus DNR brūkšninio kodavimo metodus ir greitą morfologijos vertinimą, siekdami įvertinti įvairovę, nustatyti rūšių ribas ir greitai paskleisti taksonominę informaciją prieš atlikdami oficialias taksonomines peržiūras. Mes sutelkiame dėmesį į menkai ištirtą, tačiau įvairią vorų gentį Pseudopoda, kilusią iš Rytų Azijos. Mes papildėme standartinį brūkšninio kodo lokusą (COI) su branduolinės DNR sekos duomenimis (ITS2) ir išanalizavome 572 individų, atstovaujančių 23 aprašytoms rūšims, ir daugelio galimai naujų rūšių, duomenų rinkinių ir rūšių atskyrimo metodų suderinamumą. Mūsų rezultatai rodo, kad CO1 + ITS2 fragmentų derinys geriau identifikuoja ir diagnozuoja rūšis nei vien mitochondrijų brūkšniniai kodai ir kad kai kurie medžių metodai suteikia žymiai didesnius įvairovės įvertinimus nei atstumu grįsti metodai ir morfologija. Atlikdami išsamų lauko tyrimą, aptinkame dvigubai padidėjusią rūšių įvairovę tiriamoje srityje - 42–45 ° C, o dauguma rūšių atstovauja mažo nuotolio endemijoms. Mūsų tyrimas parodo biologinės įvairovės įvertinimo ir greito taksonominių duomenų sklaidos galią greitai atliekant inventorizaciją ir derinant įvairių nariuotakojų rūšių morfologines ir daugiavietės DNR brūkšnines kodo diagnozes.

Įvadas

Tūkstantmečio sandūroje buvo akcentuojamas „taksonominis kliūtis“ 1, 2, kuriam būdingos nykstančios klasikinės taksonomijos žinios. Įprastas lėtas oficialių taksonominių pakeitimų tempas kartu su ribotu finansavimu ir taksonominių darbo vietų trūkumu reiškia didelę atotrūkį tarp rūšių atradimo ir taksonominės sklaidos 3 . Nors šiai problemai įveikti buvo skirta daug pastangų ir lėšų 2, taksonominis kliūtis išlieka 4, nepaisant pastarojo meto modernių taksonomijos metodų, susijusių su DNR brūkšniniu kodu 5, 6, 7, 8 ir kibernetine sklaida 9, 10, vėlavimų . Formaliojo taksonominio progreso greičio problemą dar labiau paaštrina didėjantys globalūs klimato pokyčiai ir buveinių naikinimas, abu padidinantys išnykimo greitį 11, 12, 13 . Rūšių lygio taksonai yra pagrindinė valiuta atliekant daugelį biologinių tyrimų ir priimant sprendimus dėl išsaugojimo, tačiau šiems tikslams taksonominė informacija, kad ir kokia puiki, yra nenaudinga, kol ji nebus paskelbta. Lauke skubiai reikia greitų taksonominių aprašų, kurie leistų paskleisti taksonominę informaciją - rūšių ribas, DNR brūkšninius kodus ir morfologinę diagnozę - ir išvengti tipiško taksonominio laiko tarpo.

Iki šiol aprašytų rūšių, susijusių su labai įvairiais organizmais, tokiais kaip daugelis nariuotakojų, skaičius, sudaro tik dalelę jų tikrosios įvairovės 10, 14 . Rūšių atradimo greitį ir taksonominį apibūdinimą paprastai riboja ribotos kompetencijos ir palyginti lėtas klasikinių monografinių tyrimų tempas. Pavyzdžiui, pavyzdžių rinkimas, tyrimas ir aprašymas paprastai užginčijami iššifruojant taksonominį palikimą, įskaitant tipo paiešką, tyrimą ir aiškinimą, ir peržiūrint išsklaidytą ir dažnai neaiškią literatūrą. Taigi turima informacija yra saugoma ilgus metus, o kartais ir dešimtmečius iki paskelbimo. Šiuo metu taksonomijos galutiniams vartotojams ši informacija yra mažai naudinga arba visai nenaudinga. Toliau skelbiamos iš tikrųjų integruotos taksonominės versijos, kuriose genetiniai / genominiai duomenys sujungiami su klasikiniais visiškai išpūstais taksonominiais gydymo būdais, tačiau paprastai lėtai, todėl gali būti naudingi ir greitesni taksonominiai metodai 15 . Taigi kai kurie tyrimai labai priklauso nuo DNR brūkšninių kodų, skirtų rūšims aptikti, neatsižvelgiant į oficialią taksonomiją (žemiau esanti pastraipa), o kiti pabrėžia greitą neoficialios ar oficialios taksonominės informacijos sklaidą 16, 17 . Mes tyrinėjame tokių metodų derinį, ištyrę įvairius medžiotojų vorų iš Rytų Azijos (1 pav.), Pseudopoda Jäger genties, 2000 (2 pav.), Liniją . Mūsų požiūris jokiu būdu nemėgina pakeisti oficialių taksonominių pakeitimų, o tik paspartina informacijos perdavimą.

Image

1. JSM (Joshimath, Indija): P. prompta ; 2. LYS (Langyashano kalnas, Yunnan): P. sp19, P. semiannulata, P. sp12, P. sp9 ; 3. YFS (Yunfengshan kalnas, Yunnan): P. sp19, P. sp12, P. sp1, P. sp6 ; 4. LJPZ (Linjiapuzi apsaugos stotis, Yunnan): P. digitata, P. sp6, P. sinapophysis ; 5. LFS (Laifengshan kalnas, Yunnan): P. namkhan ; 6. HKBG (Haokango botanikos sodas, Yunnan): P. sp10 ; 7. TB (Taibao parkas, Yunnan): P. namkhan ; 8. XSBN (Xishuangbanna, Yunnan): P. confusa, P. namkhan ; 9. BTM (Ban TavanMai, Luang Nam Tha rajonas, Laosas): P. confusa ; 10. ABM (Ant britų paminklas pianinu, Yunnan): P. sp2 ; 11. YJP (Yaojiaping apsaugos stotis, Yunnan): P. gibberosa, P. interposita, P. sp15 ; 12. PLD (Puladi kaimas, Yunnan): P. sp13 ; 13. KD (Kongdang kaimas, Yunnan): P. sp14 ; 14. FLS (Feilaisi šventykla, Yunnan): P. sp18 ; 15. WFS (Wufengshan kalnas, Yunnan): P. yunnanensis wfs ; 16. WCT (Wenchangta bokštas, Yunnan): P. bibulba we ; 17. MLP (Malipingo kaimas, Yunnan): P. sp11 ; 18. EWS (Erwushan Mountain, Yunnan): P. yunnanensis ews, P. bibulba we ; 19. HLT (Heilongtan parkas, Yunnan): P. sp18 ; 20. QSS (Qianshishano kalnas, Yunnan): P. sp11, P. yunnanensis qss ; 21. LYST (Lingyuanshi šventykla, Yunnan): P. sp17 ; 22. YLS (Yuelingshano kalnas, Yunnan): P. sp8 ; 23. CS (Cangshan Mountain, Yunnan): P. cangschana, P. daliensis, P. rivicola, P. signata ; 24. ZXS (Zixishan kalnas, Yunnan): P. bibulba xz, P. sp7, P. sp16, P. signata ; 25. XS (Xishano kalnas, Yunnan): P. bibulba xz, P. kunmingensis, P. roganda, P. spiculata ; 26. JFL (Jianfengling Mountain, Hainan): P. bicruris ; 27. WZS (Wuzhishano kalnas, Hainanas): P. bicruris, P. mediana ; 28. BHL (Baihualing Mountain, Hainan): P. bicruris ; 29. TTZ (Tiantangzhai nacionalinis miško parkas, Hubei): P. tiantangensis ; 30. HS (Huangshano kalnas, Anhui): P. sp3 ; 31. LS (Lushano kalnas, Jiangxi): P. lushanensis ; 32. DYS (Daiyunshan kalnas, Fujian): P. sp4, P. sp5 ; 33. YMS (Yangmingshano kalnas, Taivanas): P. recta ; 34. GWS (Guanwushan kalnas, Taivanas): P. recta ; 35. LL (Loulano miško parkas, Taivanas): P. serrata . Žemėlapį sukūrė „ArcView GIS 3.2“ (//www.esri.com/software/arcgis/arcview).

Visas dydis

Image

( A ) P. yunnanensis qss poravimas; ( B ) P. yunnanensis qss ant lapo; C ) vyrų įpročiai, nugaros vaizdas; ( D ) moters įpročiai, nugarinis vaizdas; ( E ) vyriškas palpa, priekinis vaizdas; ( F ) vyro delnas, ventralinis vaizdas; ( G ) vyro palpa, vaizdas atgaline data; ( H ) epigininis, ventralinis vaizdas; ( I ) „Vulva“, nugarinis vaizdas. Mastelio juostos: ( C, D ) = 1 mm; EI = 0, 2 mm.

Visas dydis

Hebertas ir kolegos 6, 7 pasiūlė, kad DNR brūkšninis kodavimas, pagrįstas mitochondrijų geno citochromo oksidazės I subvieneto (COI) 650 bp fragmentu, galėtų būti naudojamas rūšims identifikuoti ir atribojimui tarp įvairių gyvūnų fiilų, ir nuo to laiko lauke pastebimas dramatiškas vystymasis ir sprogmens panaudojimas 18, 19 . Nepaisant kai kurių ankstyvųjų prieštaravimų 20, 21, DNR brūkšninis kodavimas dabar yra įprastas vorų taksonomijoje 22, 23, 24, 25, 26, 27, nors literatūroje ir toliau nesutariama, ar COI duomenų gali pakakti 19, ar ne 28, kad tiksliai apibrėžtų rūšis. Be klasikinio mtDNR brūkšninio fragmento, autoriai vis dažniau analizuoja papildomus branduolinių žymenų 29, 30 ir genomo duomenis. Genominiai metodai tikrai yra galingi, tačiau gali būti nereikalingi (ir brangiai kainuojantys), jei tikslas yra greitas taksonominis sklaida; duomenis gali būti pernelyg sudėtinga analizuoti, nepridedant svarbių elementų prie taksonominių sprendimų, be to, gali pailgėti, o ne sumažėti laiko tarpas nuo atradimo iki aprašymo. Tačiau brūkšninių kodų iš biparentinio paveldėto branduolinio genomo ir nepopieniškai paveldėto mitochondrijų genomo derinys siūlo paprastą ir greitą būdą, kaip pagerinti DNR brūkšninių kodų efektyvumą. Tarp branduolinių DNR lokusų tiek augaluose, tiek gyvūnuose vidiniai perrašyti tarpikliai (ITS, ITS2) yra vieni populiariausių žymenų patikimam rūšių atradimui. Priežastys yra lengvas amplifikavimas ir konservuotų bei kintamų sričių derinys 31, 32 . ITS2 buvo naudojamas vorinių filogenetinių 14, 33, 34 ir filogeografinių 29, 30 analizėse. Tačiau, mūsų žiniomis, jis nebuvo panaudotas kaip antrasis branduolinių brūkšninių kodų taksas nustatant taksonomines rūšis, kaip sėkmingai padaryta, pvz., „Collembola 35“ .

Tyrime mes siekėme: (i) surinkti DNR etaloninę biblioteką iš aprašytų ir, remiantis mūsų morfologiniais identifikavimais, tariamai naujų Pseudopoda rūšių; ii) ištirti DNR brūkšninių kodų efektyvumą nustatant, ribojant ir identifikuojant rūšis; iii) įvertina COI ir ITS2 brūkšninių kodų ir morfologijos suderinamumą su Pseudopoda taksonomija; iv) suteikti morfologinius požymius, kad būtų galima tiesiogiai pagrįsti kiekvieną numanomą Pseudopoda rūšies identifikavimą; ir v) greitai skleisti taksonominę informaciją, palengvinančią standartinių metodų „taksonominį atsilikimą“, turint aiškų tikslą laiku pateikti oficialią jų peržiūrą. Naudodami brūkšninio kodo DNR derinį su greitu morfologiniu įvertinimu, be 23 anksčiau aprašytų rūšių, mes randame 19–22 naujų rūšių. Mes teikiame įrodymus ir taksonomiškai diagnostinę informaciją apie kiekvieną rūšį ir, greitai paskleisdami, šiuos taksonus, kurie dar nėra oficialiai įvardyti, galime nedelsdami pateikti galutiniams vartotojams.

Rezultatai

Morfologija

Remiantis tradicinėmis lytinių organų diagnostikos ypatybėmis, iš viso 572 individai priklauso 42–45 rūšims, iš jų 19–22 naujoms rūšims, čia vadinamoms Pseudopoda sp. Pirmą kartą pranešama apie dviejų rūšių, anksčiau žinomas tik iš patinų, patelių ( P. roganda ir P. interposita) pateles . Mes teikiame pagrindinę morfologinę informaciją, įskaitant habituso (S1 pav.), Palpo (S2 pav.) Ir epigyno (S3 pav.) Diagnostines nuotraukas su visu taksonominiu gydymu (Cao et al . Prep.). Daugelio rūšių žuvys yra palyginti mažos ir turi panašius raukšlių modelius, todėl rūšių identifikavimas remiantis somatinėmis ypatybėmis yra sudėtingas (S1 pav.). Priešingai, daugumą rūšių galima lengvai diagnozuoti naudojant lytinių organų charakterius, tačiau su šiomis išimtimis: P. bibulba populiacijos (P. bibulba xz surinktos iš XS, ZXS ir P. bibulba mes iš EWS, WCT, žr. S1 lentelę) ir trys populiacijos. P. yunnanensis (P. yunnanensis wfs iš WFS , P. yunnanensis qss iš QSS ir P. yunnanensis avys iš EWS, žr. S1 lentelę) yra genetiškai skirtingi, tačiau morfologiškai panašūs. Priešingai, rūšys, priklausančios P. sinapophysis grupei, įskaitant P. sinapophysis, P. interposita, P. sp15 , ir rūšys , priklausančios P. sp2 grupei, įskaitant P. sp2 ir P. sp12 (S2 ir S3 paveikslai), yra genetiškai skirtingos, bet ne lengvai morfologiškai diagnozuojamos rūšys. P. bibulba, plačiai paplitusio Yunnan provincijoje, metu mes paėmėme pavyzdžius iš keturių vietų (XS, ZXS, EWS, WCT) (1 pav.) Ir nustatėme du morfus, paremtus menkaverčiais vyriškos lyties palpsų ir epigynos elementais (S2H2, S2H3 paveikslai, S3L2, S3L3, S3M2, S3M3): P. bibulba mes iš WCT ir EWS, P. bibulba xz iš XS ir ZXS. Jas galima atskirti pagal aštrų, išlenktą embolinę galą, šiek tiek skirtingą vyriškos lyties organų šonkaulio apofizę (S2H2, S2H3 paveikslai) ir šiek tiek plačias patelių šoninių skilčių priekines kraštines (S3L2, S3L3, S3M2, S3M3 paveikslai). Panašiai išsami informacija apie lytinius organus gali diagnozuoti P. sinapophysis grupės ir P. sp2 grupės rūšis, įskaitant abiejų grupių vyrų retrospektyvinį blauzdikaulio apofizės formą (S2C3, S2C4, S2D1 pav. Sinapophysis grupei; S2B3, S2B4 P. sp2 formai). grupė), patelių šoninių skilties priekinių kraštų sinapofizės grupei (S3E1, S3E2, S3E3 paveikslai) ir patelių šoninių skilties užpakalinių kraštų P. sp2 grupei (S3C3, S3D1 paveikslai). P. yunnanensis , taip pat paplitusio Yunnan provincijoje, metu mes surinkome daug egzempliorių iš trijų vietų (QSS, EWS, WFS) (1 paveikslas), priklausančių atitinkamai trims morfams : P. yunnanensis qss, P. yunnanensis avys, P. yunnanensis wfs ties vyriškos lyties delno teofine apofize (S2J1, S2J2, S2J3 paveikslai), o epigina nėra diagnozuojama (S3O1-P3 paveikslai).

Filogenetinės išvados

Iš visų čia ištirtų 42–45 rūšių 36–39 atstovavo keli individai ir 6 - vienas individas (S1 lentelė). Visos filogenetinės analizės (BI ir ML COI, ITS2, COI + ITS2) davė didelę skiriamąją gebą, iš esmės sutinkančią apie rūšių ribas, tačiau pasižymint keletu pastebimų topologijos skirtumų (3 ir S4–8 pav., 1 lentelė). BI ir ML medžiai, pagrįsti COI + ITS2, visus asmenis vienareikšmiškai suskirsto į darnias, morfologiškai diagnozuotas grupes, dauguma jų yra stipriai palaikomi (100% įkrovos ir užpakalinės galimybės) (3 ir S8 paveikslai, 1 lentelė). BI ir ML medžiai, paremti COI, parodė, kad aprašytos rūšys, kurias reprezentuoja keli individai, buvo monofiletinės su dideliu palaikymu, išskyrus P. yunnanensis, kuri yra parafiletinė (S4–5 paveikslai, 1 lentelė). BI IT medis, pagrįstas vien ITS2, taip pat palaikė 34 iš 35 galimų rūšių monofoniją, išskyrus vienintelę iš P. serrata lizdus P. recta (ML medis beveik identiškas, S6–7 pav., 1 lentelė). Kitos penkios rūšys, pavaizduotos pavieniu egzemplioriumi, kiekviena formavo atskirtą šaką už kitų rūšių gaubtų (3 pav. Ir S4 – S8).

Image

Mėlyna juosta nurodo židinių rūšių brūkšninį kodų sutapimą. Skaičiai mazguose yra užpakalinės tikimybės; ML analizės įkrovos palaikymas nurodomas kaip kietos žvaigždės, kai vertės yra> 95%, atvirų žvaigždžių -> 50–95%.

Visas dydis

Pilno dydžio lentelė

Rūšių atribojimas

Brūkšninio kodo spraga

Buvo sukurti visų 572 asmenų COI brūkšniniai kodai, priklausantys 42–45 tariamoms rūšims (S1 lentelė). ITS2 buvo amplifikuotas 140 individų, atstovaujančių visas numanomas rūšis, išskyrus vieną, pogrupis. Mes nustatėme ne normaliai pasiskirstusius K2P duomenis (Kolmogorovo – Smirnovo testas visoms grupėms P <0, 001) visoms grupėms ir statistiškai reikšmingus K2P verčių skirtumus tarp visų intraspecifinių ir tarpspecifinių palyginimų (Manno – Whitney testas P <0, 001) (S2 lentelė). . Vieno žymeklio brūkšninio kodo atotrūkis neapibrėžė viso 42–45 tariamų rūšių rinkinio (4 paveikslas). Tačiau dauguma tariamų rūšių, kurias atstovauja keli individai, turėjo brūkšninių kodų spragas poromis. Išimtys yra keletas rūšių, turinčių didelį skirtumą tarp skirtingų rūšių, kurios gali reikšti papildomą kriptų įvairovę. Taigi P. bibulba, P. namkhan, sp18, P. yunnanensis neturi porų brūkšninių kodų spragų COI (S4 paveikslas, S2 lentelė), o P. daliensis ir P. sp15 neturi porų brūkšninių kodų spragų ITS2 (S6 paveikslas, S2 lentelė). Tik P. yunnanensis negali būti atskirtas nuo artimų giminaičių, turinčių poros brūkšninio kodo spragą kombinuotame COI + ITS2 duomenų rinkinyje (3 paveikslas, S2 lentelė). Dėl „globalių“ brūkšninių kodų spragų susietas COI + ITS2 duomenų rinkinys palaikė 44 rūšis, visiškai atitinkančias morfologiją, o vieno geno duomenų rinkiniai apibrėžė 41–44 rūšis (4 pav., S2 lentelė).

Image

Intraspecifinių ir tarpspecifinių (įgimtų) genetinių skirtumų dažnio pasiskirstymas, apskaičiuotas naudojant Kimura 2 parametrų (K2P) modelį Pseudopoda voruose.

Visas dydis

Rūšių atskyrimo metrika iš „Geneious“

Apskritai, Rosenbergo P AB statistika ir P ID (liberalas) davė didesnį numanomų rūšių skaičių nei P ID (griežtas) ir P RD (atsitiktinai atskirtas). COI duomenų rinkinyje visos numanomos rūšys, išskyrus P. yunnanensis , buvo monofiletinės, tačiau tiek P ID (griežtas) = ​​0, 88, tiek P ID (liberalas) = ​​0, 97 palaikė P. yunnanensis (S3 lentelė). P ID (griežtas) tariamų rūšių vertės buvo didesnės nei 0, 7, išskyrus P. confusa (0, 47), P. sp14 (0, 58), P. sp4 (0, 58), P. sp7 (0, 58). Tačiau bent du iš keturių rodiklių palaikė visas rūšis (S3 lentelė) ir, pavyzdžiui, visų kladžių P ID (liberaliosios) vertės buvo didesnės nei 0, 9, išskyrus P. confusa (0, 84) (S3 lentelė). P RD (atsitiktinai išskiriama) ir Rosenberg P AB statistika taip pat palaikė daugumą rūšių (išsamiau žr. S3 lentelę). Vien tik ITS2 duomenų rinkinyje ir susietosios COI + ITS2 duomenų rinkinyje kiekvienos rūšies hipotezę palaiko bent du rodikliai (S3 lentelė).

ABGD

COI duomenų rinkinyje ABGD analizė naudojant skirtingus parametrų derinius davė neidentiškus rezultatus (S4 lentelė). Remiantis JC arba K2P atstumais, buvo gautos 48 rūšys pagal kiekvieną parametrą, iš esmės sutinkančią su aukščiau pateiktais rezultatais, tačiau dar labiau suskaidžius P. bibulba, P. namkhan, P. sp18, P. yunnanensis į P. bibulba xz, P. bibulba WCT, P. bibulba EWS, P. namkhan FLS, P. namkhan XSBN, sp18 FLS, sp18 HLT, P. yunnanensis qss, P. yunnanensis ews, P. yunnanensis wfs (S4 pav.). Analizės, pagrįstos p atstumu, davė dar tariamesnes rūšis (S4 lentelė). ITS2 duomenų rinkinio ABGD rezultatai skyrėsi pagal skirtingus parametrų parametrus (S4 lentelė), tačiau jie iš esmės sutiko su kitais metodais. Remiantis JC arba K2P atstumu, buvo gautos 46 rūšys (nepalaikančios P. prompta ), palaikančios 41 spėjamų rūšių pagrindinį rinkinį, taip pat papildomai padalijant: P. daliensis ir P. recta buvo padalyti į dvi dalis, o P. sp15 - į tris spėjamas rūšis, atitinkamai. P. yunnanensis buvo suskaidytas į P. yunnanensis qss, P. yunnanensis avys, P. yunnanensis wfs ir P. sp7 bei P. spiculata buvo sujungti (S6 pav.). Vėlgi, p atstumais pagrįstos analizės davė daugiau rūšių. Sujungtos matricos analizė davė iš esmės suderintus rezultatus (3 paveikslas, S4 lentelė).

GMYC

Apskritai, taikant vieno slenksčio GMYC modelį, buvo gauta daugiau rūšių hipotezių (46–62 rūšys), tikėtina, kad genetiškai struktūrizuotos populiacijos per daug išskaidytos (3, S4 ir S6 pav.). COI, COI + ITS2 GMYC rezultatai atrodo biologiškai nerealistiški, suskaidžius keletą morfologinių rūšių į keletą geografinių grupių (3 ir S4 pav.). Tačiau atlikus ITS2 branduolio fragmento analizę, buvo gautos 46 numanomos rūšys, kurios iš esmės sutampa su kitomis analizėmis ir morfologija (S6 pav.).

bPTP

Panašiai kaip GMYC, bPTP rezultatai rodo iki 102 rūšių, tačiau analizuojant sujungtus duomenis gaunamos šiek tiek mažiau kraštutinės vertės (59 rūšys, 3 pav.).

BPP

Bajeso filogenetikos ir filogeografijos metodas buvo suderintas su daugeliu aukščiau pateiktų hipotezių, parodančių didžiausią 44 rūšių hipotezę (P = 1) ir tik šiek tiek mažesnį palaikymą 41 rūšies hipotezei (P = 0, 983).

Biogeografiniai modeliai

Mūsų rezultatai rodo, kad Pseudopoda rūšims būdingas mažo diapazono endemizmas, tačiau kelios rūšys yra simetriškos (S1 lentelė, 1 ir 5 pav.). Filogenetinės analizės atskleidė stiprią geografinę struktūrą, kurią iliustruoja du klodai: (Rytų Kinija; Tropinė žemyninė Kinija, Taivanas ir Hainano salos, Laosas) (5 pav.).

Image

( A ) žemėlapis su mėginių ėmimo vietomis, išskyrus JSM (Joshimath, Uttarakhand, Indija), sukurtas naudojant „ArcView GIS 3.2“ (//www.esri.com/software/arcgis/arcview); ( B ) mėginių ėmimo vietos YJP (Yaojiaping apsaugos stotis, Yunnan provincija), kurioje buvo surinktos dvi glaudžiai susijusios rūšys ( P. interposita ir P. sp15 ), žemėlapis, atskirtas mažu srautu rodykle (žemėlapio duomenys: „Google“, „DigitalGlobe“); ( C ) Bajeso analizė, pagrįsta COI + ITS2 duomenų rinkiniu, palaikymas nurodytas kaip 3 paveiksle. Spalvos atspindi konkrečias skiltis.

Visas dydis

Diskusija

Tikslus rūšių identifikavimas yra labai svarbus žingsnis daugelyje biologinių tyrimų sričių. Šis žingsnis gali būti sudėtingas dėl trūkstamų taksonominių žinių ir ilgo atotrūkio tarp rūšių atradimo ir oficialių taksonominių pakeitimų. Taigi informacija, net jei ji yra prieinama, galutiniams vartotojams yra neprieinama prieš paskelbiant taksonominius pakeitimus. Kita vertus, rimtas DNR brūkšninio kodo, kaip praktinio taksonominio šaltinio, naudingumo apribojimas yra lydimųjų morfologinių duomenų trūkumas ir galimas klaidingas kvito pavyzdžių identifikavimas 36 . Tikslaus identifikavimo svarba yra akivaizdi, o pateikiant išsamią informaciją apie kuponą ir identifikavimui naudotus morfologinius požymius, žymiai padidėja brūkšninės DNR naudingumas37. Mūsų metodu siekiama sušvelninti šias problemas greitai skleidžiant taksonominę informaciją, tokiu būdu suteikiant galimybę nedelsiant patekti į patikimai identifikuotus egzempliorius, susietus su DNR brūkšniniais kodais ir morfologinius kvito pavyzdžius. Be to, mes pateikiame kiekvienos numanomos rūšies pagrindinių simbolių diagnostines iliustracijas.

DNR brūkšninis kodavimas paprastai nustato vieną mitochondrijų žymeklį, kad nustatytų 6, 7 rūšių ribas. Neseniai buvo įrodyta, kad šis metodas gerai veikia vorų rūšių identifikavimą 19 ir atribojimą 27 . Tačiau kai kurie autoriai abejoja vien tik PKI duomenų 28 naudingumu ir verčiau siūlo naudoti kelis žymenis, ypač delimitacijos problemai spręsti. Iš tikrųjų, mūsų rezultatai rodo, kad atskirai pavienis mitochondrijų žymeklis suteikia rūšių ribas, kurios skiriasi nuo tų, kai abu yra sujungti (lentelės S2 – S4), o dviejų žymenų derinys labiau atitinka morfologinius ir geografinius duomenis. Iš patikrintų rūšių ribojimo metodų GMYC ir bPTP pasiūlė žymiai didesnius įvairovės įverčius, palyginti su labiau suderintais, ir nuoseklius įverčius, naudojant brūkšninio kodo atotrūkio analizę, PID, BPP ir morfologiją. Atrodė, kad turtingumas yra per didelis, naudojant GMYC analizuojant PKI atskirai ir kombinuotą duomenų rinkinį, bet ne analizuojant vien ITS2. Taigi mtDNR duomenų struktūrizavimas populiacijos lygiu, atrodo, klaidina metodą, kuris gali būti tinkamiau naudojamas su branduoliniais žymenimis.

Nepaisant tam tikrų metodų skirtumų, daugumoje analizių sutinkama, kad žinomos Pseudopoda rūšių įvairovės padidėjimas dvigubai padidėjo mūsų mėginyje, kuris dabar įvertintas tarp 42 ir 45. Atitikimas tarp standartinių morfologinių diagnostinių požymių (vyriškų palmių) ir molekulinių rūšių ribų yra toks: labai didelis, išskyrus tai, kad kai kurie brūkšninių kodų metodai rodo papildomą morfologinių rūšių dalijimąsi.

Mes įtraukėme tik dalį Pseudopoda įvairovės (23/121 žinomos rūšys), todėl biogeografinės analizės yra per ankstyvos, tačiau kai kurie aiškūs modeliai išryškėja iš mūsų rezultatų. Nors tam tikros rūšys yra šiek tiek paplitusios, pastebimas ryškus modelis, kad dauguma rūšių yra nedidelio nuotolio endemijos, apsiribojančios vienu kalnu, kai kurios - tik viename natūraliame miško parke ar net vienoje vietoje (5 pav.). Pavyzdžiui, vienu atveju, dvi glaudžiai susijusios rūšys ( P. interposita ir P. sp. 15 ) yra mažo nuotolio endemai tame pačiame mažame plote, tačiau neparodo, kad sutampa tik viena upė (5 pav.). Remiantis Jäger 38 ir Jäger et al . 39 Pseudopoda rūšys kartais pasižymi didele vietinių rūšių įvairove dėl stiprios diferenciacijos aukštyje ir nesugebėjimo balionuoti. Tai gali paaiškinti daugelį nedidelių diapazonų endemijų genties ir kitų vorų grupių, pvz., Coelotinae, kalnuotose Pietryčių Azijos dalyse 39, 40 . Be to, mūsų filogenetinės analizės rodo geografijos ir filogenijos atitikimą, galbūt užsimenant apie nepriklausomus Rytų Kinijos kolonizacijos atvejus, palyginti su žemyninės Kinijos atogrąžų, Hainano, Taivano ir Laoso kolonijomis. Mes pabrėžiame, kad mūsų mėginys yra per daug ribotas atliekant išsamią biogeografinę analizę ir kad norint visapusiškai išspręsti santykius ir išbandyti biogeografinius scenarijus Pseudopoda gentyje, reikia daugiau geografinių mėginių ir papildomų žymeklių. Tačiau atsirandantys trumpo nuotolio endemijos ir geografiškai struktūruotos filogenijos modeliai turėtų skatinti tolesnius grupės biogeografijos tyrimus.

DNR brūkšninis kodavimas ir toliau yra svarbi priemonė, padedanti nustatyti taksonominius atradimus ir nustatyti tiek rūšis, tiek aukštesnius taksonominius lygius 7, 36 . Tačiau vieno trumpo COI regiono klasikinių brūkšninių kodų kartais gali nepakakti tiksliam identifikavimui, todėl buvo naudojami alternatyvūs žymekliai, pvz., ITS2 augaluose. Sutikdami su mūsų rezultatais, kiti naujausi tyrimai taip pat nustatė, kad mitochondrijų ir branduoliniai žymekliai kartu gali pralenkti standartinius brūkšninius kodus, nesukeldami per daug naštos duomenų kaštams ir duomenų analizei. Pvz., COI ir ITS2 derinys pasirodė naudingas brūkšnuojant Kollembola 35 . DNR brūkšninis kodavimas gali tapti galingesnis, jei jis derinamas su klasikinėmis morfologinėmis diagnozėmis ir standartinės taksonominės informacijos sklaida, naudojant įvairius analizės metodus 41, 42, 43, 44, 45 .

Išvados

Mūsų tyrimas parodo greitų taksonominiu požiūriu pagrįstų inventorių galią kartu su greitu morfologinių ir DNR duomenų paskleidimu, kad būtų galima greitai paskleisti įvairių nariuotakojų rūšių linijų taksonominius duomenis, suteikiant informaciją dar ilgai, kol bus baigtas išsamus revizinis darbas. Toks požiūris gali būti ypač tinkamas taksonomiškai apleistoms linijoms, turinčioms didelę neatrastą įvairovę. Kadangi didžiąją dalį rūšių dar reikia aptikti ir aprašyti, mes pasisakome už tai, kad būtų kuo labiau sumažintas skirtumas tarp atradimo ir platinimo, kad būtų lengviau atlikti biologinius tyrimus ir išsaugojimo planavimą.

Medžiagos ir metodai

Taksonominis dėmesys

Su 121 aprašyta rūšimi Pseudopoda Jäger, 2000 (2 pav.), Gentis yra trečia pagal dydį genties Sparassidae 39, 40 gentis, nors jos tikroji rūšių įvairovė nėra pakankamai žinoma. Jos rūšys gyvena 46, 47 pietų, rytų ir pietryčių Azijos kalnuotuose miškuose ir dažniausiai apsiriboja skirtingomis aukščio juostomis nuo 300 iki 3800 m 38, 39 . Apie pusė žinomos įvairovės, 51 rūšis, yra žinoma iš Kinijos. Daugelio rūšių pasiskirstymas yra labai ribotas (pvz., P. mediana Quan ir kt . 46 ir P. bicruris Quan ir kt . 46 ), tačiau jų diapazonas taip pat dažnai sutampa (1 ir 5 pav.). Pseudopodoje morfologinis rūšių atskyrimas yra sudėtingas dėl rūšių simpatijos, įpročio panašumo ir galimo kriptų rūšių gausos. Taigi specialistai sutinka, kad norint atrasti ir identifikuoti rūšis bei tiksliai išsiaiškinti šios genties taksonomiją, reikalingas morfologinis ir molekulinis metodai 39 .

Pavyzdžių kolekcija

Mes atrinkome 572 Pseudopoda ir 2 Sinopoda asmenis iš 35 vietovių rytinėje Kinijoje (Hubei, Jiangxi, Anhui ir Fujian provincijose), Kinijos pietvakariuose (Yunnan provincija) ir dviejų didelių salų Kinijos pietuose ir rytuose (Hainanas ir Taivanas). Taip pat mes gavome nukleotidų duomenis iš „GenBank“ ( P. prompta , iš Indijos, taip pat P. confusa ir P. namkhan , abu iš Laoso) (1 pav., S1 lentelė). Individualų pavadinimą sudaro rūšies pavadinimas, po kurio nurodomas vietovės kodas ir pavyzdžio kodas. Vietovių kodai yra vietovių santrumpos, naudojant didžiąsias raides (S1 lentelė). Kaip pogrupius panaudojome 2 Sinopoda rūšis ( S. anguina, S. pengi ). Lauke surinkti suaugusiųjų bandiniai buvo fiksuoti absoliučiame etanolyje, o jų dešinės kojos buvo pašalintos, kad būtų galima laikyti –80 ° C temperatūroje, kad vėliau būtų galima ekstrahuoti DNR. Visi kvitai, kuriuos mes perkėlėme į 75% etanolio identifikavimui ir morfologiniam tyrimui, yra deponuojami Elgesio ekologijos ir evoliucijos centre (CBEE), Hubei universitete, Kinija.

Morfologija

Kiekvienos numanomos morfologinės rūšies genitalijų struktūros (epigyna, vyrų palpsas) ir įpročiai buvo skaitmeniškai pavaizduoti. Patinų delnai ir epigyna buvo ištirti ir nufotografuoti naudojant „Leica M205C“ stereomikroskopą ir „Olympus BX51“ mikroskopą, kai jie buvo išpjaustyti iš vorų kūnų. Skaitmeniniai vaizdai, vaizduojantys įpročius ir lytinių organų morfologiją, buvo kelių vaizdų, padarytų skirtingose ​​židinio plokštumose išilgai Z ašies, kompozicija, surinkta naudojant programinės įrangos paketą „Helicon Focus 3.10“. Kairieji palpsai buvo fotografuojami, jei nebuvo nurodyta kitaip. Genitalijos buvo valomos verdant 10% KOH kelioms minutėms, kad ištirptų minkštieji audiniai.

DNR ekstrahavimas, PGR amplifikacija ir sekos nustatymas

DNR buvo ekstrahuota nuo dviejų iki keturių kiekvieno bandinio kojų, naudojant „Universal Gen DNA Kit“ (CWBIO, Pekinas, Kinija). COI mes panaudojome universalius gruntus LCOI1490 (GGTCAACAAATCATAAAGATATTGG) ir HCOI2198 (TAAACTTCAGGGTGACCAAAAAATCA), taip pat ITS5.8 (GGGACGATGAAGAACGCAGC) ir ITS4 (TCCAT ITC8TCCCCTCCTCTTGGCTATT). Pastiprinti fragmentai buvo seka abiem kryptimis naudojant „Tsingke Biological Technology“ (Uhanas, Kinija), o po to surinkti ir koreguoti naudojant „Chromaseq“ modulį Meskite, naudojant „Phred“ ir „Phrap“. Mes sukūrėme visų pavyzdžių COI brūkšninius kodus, o 140 pavyzdžių - ITS2 sekas; jie buvo pasirinkti reprezentuojant visų spėjamų rūšių ir visų vietovių unikalius PKI haplotipus. Sekos buvo pateiktos „Genbank“ (registracijos numeriai KY095934 – KY096645, žr. S1 lentelę).

Filogenetinė analizė

Visas sekas, naudodamos MAFFT 49, suderinome per EMBL-EBI internetinį portalą su 100 medžio atkūrimo replikacijų ir 100 maks. Pakartojimų, kad galėtume atlikti išsamią paiešką, kitaip naudodami numatytuosius parametrus. Baltymus koduojančios genų sekos buvo perkeltos į aminorūgštis ir patvirtinta, kad jose nėra sustabdomųjų kodonų. Kai kurių COI sekų 5 'ir 3' galai buvo prastos kokybės, todėl visos COI sekos buvo sutrumpintos iki 621 bp. ITS2 sekos taip pat buvo rankiniu būdu apkarpytos iki 398 bp. Buvo patikrinta, ar visos individualios sekos priklauso Sparassidae, naudojant BLASTn „GenBank“. Abu genai buvo sujungti Meskite. Mes atlikome Bajeso ir maksimalių tikimybių analizę, kad įvertintume filogenetinius ryšius tarp rūšių, reikalingų rūšių atskyrimui. Visose analizėse spragos ir dviprasmiškos bazės buvo traktuojamos kaip trūkstami duomenys. Norėdami ištirti galimą duomenų konfliktą, sukūrėme keturis duomenų skaidinius jautrumo analizei: ITS2, COI1st, COI2nd, COI3rd. Atitinkami Bajeso analizės modeliai, atrinkti naudojant „jModelTest2“ ant XSEDE (2.1.6) 50, naudojant „Akaike“ informacijos kriterijų (AIC), buvo: GTR + I + G COI1st ir COI2nd, GTR + G COI3rd ir ITS2. Duomenų matricos buvo analizuojamos naudojant Bayesian darytas išvadas su MrBayes 3.2.3 naudojant XSEDE 51, analizuojant abu atskirus genus, taip pat susietas matricas. Markovo grandinės Monte Karlo paieška kiekvienoje matricoje vyko su keturiomis grandinėmis 50 000 000 kartų, imant Markovo grandinę kas 1 000 kartų, o pirmųjų 12 500 000 kartų mėginių taškai buvo atmesti kaip „burninas“, po kurio grandinės pasiekė apytikslį nejudamumą, kaip nustatyta analizuojant programoje „Tracer“. Maksimalios tikimybės analizė buvo atlikta naudojant „RAxML Black Box“ ant XSEDE 52 ant židinio matricos su tomis pačiomis pertvaromis, kurios buvo įgyvendintos Bajeso analizėje, tačiau visoms pertvaroms naudojant GTR + I + G modelį, išlaikant kitų parametrų numatytuosius nustatymus. Visos didelės analizės, įskaitant „jModelTest2“, „MrBayes 3.2.3“ ir „RAxML 8.0“, buvo vykdomos lygiagrečiai CIPRES grupėje San Diego superkompiuterių centre.

Rūšių atribojimas

Išanalizavome atskiras ir susietas matricas, naudodamiesi šešiais rūšių atskyrimo metodais. Kadangi DNR brūkšninio kodo 7 atotrūkis ir rūšių apibrėžimo metrika (SDM) iš „Geneious“ reikalauja a priori rūšies žymėjimo, mes priskyrėme 572 individus 42–45 spėjamoms rūšims, atsižvelgdami į bendrą filogenetinės topologijos iš genų medžių, morfologinės ir geografinės informacijos analizę.

Mes atlikome dvi DNR brūkšninio kodo atotrūkio analizes: viename tyrime visi duomenys buvo rodomi vienu metu (globaliai), o kitoje - porų palyginimai tarp rūšių (židinio) 36 . Atlikdami DNR brūkšninių kodų spragų analizę, apskaičiavome genetinius atstumus, naudodami Kimura 2 parametrą (K2P) kiekvienai rūšiai kandidatei Mega6 53 . Statistiškai reikšmingų skirtumų tarp K2P skirtumų tarp vidinių ir skirtingų tipų, naudojant vidurkius ar medianas, priklausomai nuo duomenų pasiskirstymo 19 . Mes panaudojome Kolmogorovo – Smirnovo normalumo testą, tada atlikome parametrinę (vienpusio ANOVA) arba neparametrinę (Manno – Whitney testas) statistiką SPSS.

Rūšių atskyrimo papildinys „Geneious v8.1.6“ buvo naudojamas norint gauti rūšių atskyrimo metriką, įskaitant Rosenbergo PAB statistiką 54, PID statistiką, kurioje yra PID (griežtas) ir PID (liberalas) bei PRD. Rosenbergo PAB statistika yra tikimybė, kad tariamasis taksonas bus monofiletinis seserinės skraistės, kurioje yra „b“ taksonai, atžvilgiu pagal nulio atsitiktinio sujungimo modelį 54 . PID statistika parodo, kaip dažnai galima tiksliai nustatyti tariamos rūšies narį, atsižvelgiant į specifinį sekų derinimą. PID (griežtas) reikalauja, kad užklausos seka patektų į monofiletinį apvalkalą, kad būtų galima identifikuoti. PID (liberalas) reikalauja, kad užklausų seka patenka į monofilinio klodo ribas arba yra jos sesuo. PRD (tikimybė, kad atsitiktinai išsiskiria) yra tikimybė, kad klotas turi pastebėtą skiriamąjį požymį dėl atsitiktinio sujungimo. Tikimybės reikšmė, mažesnė kaip 0, 05, paneigia niekinę hipotezę apie atsitiktinį sugretinimą ir leidžia manyti, kad klosto nariai gali būti klasifikuojami kaip rūšys.

Automatinė brūkšninio kodo spragų aptikimo procedūra (ABGD) 55 suskirsto gnybtus į hipotetines rūšis, apskaičiuotas p-vertes, pagrįstas brūkšninių kodų tarpu. Mes atlikome ABGD analizę internetu (//wwwabi.snv.jussieu.fr/public/abgd/), naudodamiesi trimis skirtingais atstumo rodikliais: „Jukes-Cantor“ (JC69), „Kimura 2“ parametru (K2P) ir paprastu atstumu (p- atstumas). Duomenis išanalizavome naudodamiesi dviem skirtingais parametrų Pmin (0, 0001 ir 0, 001), Pmax (0, 1 ir 0, 2) ir santykinio tarpo pločio (X = 0, 5, 1 arba 1, 5) dydžiais, o kiti parametrai buvo numatytosios.

Apibendrintoje mišraus judesio koalescencinio (GMYC) metodikoje 56 naudojama tikimybė patikrinti rūšių ribas, nustatant tarpžvaigždinės ir intraspecifinės linijų kolescencijos greičio pereinamąjį tašką. Mes atlikome GMYC analizę R. „padalijimo“ pakete. Po Xu ir kt . 27, mes naudojome vieno slenksčio modelį. Mes panaudojome BEAST v. 1.8.0 57, kad gautume ultrametrinį genų medį kaip GMYC kreipiamąjį medį pagal griežtą molekulinio laikrodžio modelį. Remdamiesi „Yule“ specifikacijos modeliu ir naudodamiesi 50 milijonų kartų, imdami mėginius kas 5000 kartų, mes vartojome standartinius nariuotakojų pakeitimo procentus, naudojant normalųjį prieš, kurio vidutinė vertė buvo 0, 01115, pagal „Yule“ specifikacijos modelį. Mes panaudojome „TRACER v 1.6 58“, kad nustatytume sudeginimą ir patikrintume nestabilumą, tada išmesdavome kaip 10% medžių kiekvienoje grandinėje, kad jie įsitvirtintų ant ultrametrinio medžio, naudodami „TreeAnnotator“.

Mes atlikome Bajeso Puasono medžio procesų (bPTP) analizę, naudodami BI medį kaip įvesties medį, įdiegtą internete (//species.h-its.org/ptp/) 59 . PTP yra vieno lokuso rūšių atskyrimo metodas, kuriame naudojama tik nukleotidų pakeitimo informacija, įgyvendinant modelį, darant prielaidą, kad genų medžio šakelių ilgiai susidaro iš dviejų nepriklausomų Puasono proceso klasių (pakaitų įvykiai tarp rūšių ir tarp rūšių). BPTP analizė buvo atlikta naudojant 100 000 MCMC kartų, su 100 skiedžiant ir 0, 1 sudeginant, pašalinant pogrupius.

Galiausiai, naudojant BPP 3.1 60 programą, buvo atskirtos rūšys ant kreipiamojo medžio (A10). Tai leidžia naudoti kombinuotus COI ir ITS2 duomenų rinkinius kiekvienos rūšies ribojimo hipotezei apskaičiuoti užpakalinės tikimybės palaikymą. Šioje analizėje (kai rūšių modeliavimas = 1, speciestree = 0) naudojamas judėjimas tarp grįžtamojo šuolio MCMC (rjMCMC) algoritmo, kad būtų galima judėti tarp skirtingų rūšių atskyrimo modelių, suderinamų su fiksuotu kreipiamuoju medžiu. Skirtingų rūšių medžių modeliams (speciesmodelprior = 1) naudojome numatytąjį prieš, kuris paskiria vienodas šaknų medžių tikimybes. Populiacijos dydžio parametrams (teta, θ) buvo priskirta gama prieš G (2, 1000), kurių vidurkis 2/2000 = 0, 001. Rūšies medžio šaknyje (tau, τ) nukrypimo laikas buvo priskiriamas gama prieš G (2, 1000), o kitiems nukrypimo laiko parametrams priskiriamas Dirichlet prior (Yang ir Rannala, 2010: 2 lygtis) 60 . Šie parametrai buvo gauti ir optimizuoti naudojant analizę A00 (Parametrų įvertinimas pagal daugelį rūšių koalescentuojant, kai rūšių imitacija = 0, speciesė = 0), kuris generuoja rūšių pasiskirstymo laiko (tau, τ) ir populiacijos dydžių (teta, θ) užpakalinį pasiskirstymą. MSC modelis, kai yra nustatyta filogenijos rūšis. Kiekviena analizė buvo atlikta mažiausiai du kartus, kad būtų patvirtintas bandymų nuoseklumas. Mes panaudojome BI medį kaip orientacinį medį, naudodami numanomas 41 arba 44 rūšis.

Papildoma informacija

Kaip cituoti šį straipsnį : Cao, X. et al . Spartus taksonominių atradimų, pagrįstų DNR brūkšniniu kodu ir morfologija, sklaida. Mokslas. 6 rep. , 37066; „doi“: 10.1038 / srep37066 (2016).

Leidėjo pastaba: „ Springer Nature“ išlieka neutralus paskelbtų žemėlapių jurisdikcijos reikalavimų ir institucinių ryšių atžvilgiu.

Papildoma informacija

PDF failai

  1. 1.

    Papildoma informacija

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.