Pasikartojantys dcc genų nuostoliai paukščių evoliucijos metu | mokslinės ataskaitos

Pasikartojantys dcc genų nuostoliai paukščių evoliucijos metu | mokslinės ataskaitos

Anonim

Dalykai

  • Aksonų ir dendritų nurodymai
  • Evoliucinė raidos biologija

Anotacija

Vystymo metu per vidurį kertant aksonus, žaidžiamos labai konservuotos receptorių ir ligandų šeimos. Manoma, kad išskiriamo ligando Netrin-1 ir jo receptoriaus, išbraukto kolorektalinėje vėžyje (DCC), sąveika kontroliuoja kryžminių aksonų trauką vidurinėje linijoje. Čia mes tyrėme paukščių šios ligandų ir receptorių poros evoliuciją, pasinaudodami daugybe naujai surinktų genomų. Iš filogenijos ir sintezės analizių galime daryti išvadą, kad DCC genas buvo išsaugotas daugumoje egzistuojančių paukščių rūšių, o du nepriklausomi įvykiai lėmė jo praradimą dviejose paukščių grupėse - praeiviuose ir galiformose. Šie supanašėję atsitiktiniai genų praradimo atvejai greičiausiai yra susiję su Z chromosomos pertvarkymu. Naudodami viso stiprumo imuninį dažymą ir 3Disco valymą parodome, kad visų paukščių, turinčių DCC geną, nervų sistemoje DCC baltymo ekspresijos schema yra panaši į kitų stuburinių. Keista, bet mes parodome, kad ankstyvasis kommisuralinių traktatų vystymosi modelis yra palyginamas su visais paukščiais, nesvarbu, ar jie turi DCC receptorių, ar ne. Įdomu tai, kad tik 4 iš 5 genų, koduojančių išskiriamus netrinus, DCC ligandai stuburiniuose, buvo rasti paukščiuose, tačiau Netrin-5 nebuvo. Kartu šie rezultatai patvirtina nepaprastą kommisuralinių aksonų nukreipimo mechanizmų plastiškumą paukščiams.

Įvadas

Nepaisant daugiau nei 600 milijonų evoliucijos metų, pagrindiniai dvišalių smegenų jungimo schemos komponentai yra labai konservuoti 1 . Vienas iš jo parašo bruožų yra dviejų kategorijų projekcinių neuronų buvimas: vieni jungiasi prie tikslinių ląstelių, esančių toje pačioje ar pjautinėje nervų sistemos pusėje, ir kiti, jungiantys priešingoje ar priešingoje pusėje. Naujausi yra vadinami komisiniai neuronai ir yra pasiskirstę išilgai rozkaudalinės 2 ašies. Įprasto kommisuralinių traktų rinkinio padėtis ir erdvėlaikis vystymosi seka (priekinis komisas, užpakalinis komisas, fasciculus retroflexus, regos nervas, be kitų) yra labai panašūs tarp stuburinių 3.4 . Tačiau kai kurie komisiniai pėdsakai egzistuoja tik kai kuriuose taksonuose, pavyzdžiui, placentos žinduolių corpus callosum 5 arba Mauthner ląstelių lempučių, teleostų ir varliagyvių 6 . Manoma, kad atsiradus naujoms komisijos grandinėms, buvo įgytos naujos smegenų funkcijos ir elgesys 2, 7 .

Nuo devyniolikto amžiaus pabaigos supratimas apie komisinių grandinių vystymąsi ir struktūrą kontroliuojančius mechanizmus yra nelengvas iššūkis raidos neurobiologams 8, 9 . Reikšminga pažanga padaryta tik per pastaruosius trisdešimt metų atliekant genetinį ir biocheminį patikrinimą. Dabartinis modelis palaiko gana paprastą stūmimo-traukimo mechanizmą, kai CNS vidurio linijoje esančios ląstelės, tokios kaip stuburinių gyvūnų grindų plokštė, išskiria baltymus, kurie pritraukia kommisuralinius aksonus ir palengvina vidurio linijos kirtimą, taip pat repelentus, kurie priverčia komizuracinius aksonus palikti vidurinę liniją . Netrin-1, pirmasis viduriniosios grandies chemoteraptas, tuo pačiu metu buvo identifikuotas C. elegans ir viščiukų embrione 11 . Stuburinio DCC genas (išbrauktas 12 gaubtinės žarnos vėžyje) ir jo homologai C. elegans 13 ir Drosophila 14 koduoja transmembraninį receptorių, tarpininkaujant Netrin-1 traukai. Šioms rūšims DCC funkcijos praradimas neleidžia daugeliui kommisuralinių aksonų kirsti vidurio linijos, taip palaikant DCC pagrindinį vaidmenį nukreipiant vidurinę liniją 14, 15 . Pelėms ir žmonėms DCC mutacijos lemia mirtingumą 15, judėjimo sutrikimus 16 ir vėžį 17 . Buvo pasiūlyta, kad DCC geno nėra vištienos genome, o jo paralogas NEOGENIN tarpininkauja NETRIN-1 pritraukiant šią rūšį 18 . Tačiau daugybiniai in vivo ir in vitro tyrimai parodė, kad viščiukų embrionuose anti-DCC antikūnai slopina NETRIN-1 chemotropinį aktyvumą stuburo smegenų komisinės dalies aksonuose, žarnyno žarnos nervo apvalkalo ląstelėse ir oligodendrocitų pirmtakuose. Be to, vyraujančių neigiamų DCC ar DCC signalų partnerių konstrukcijų in vivo elektroporacija jauniklio nugaros smegenyse reikšmingai trikdo komisinės ir motorinės aksonų gaires 21, 22, 23. Tai rodo, kad viščiukų genome gali būti DCC genas, kuris, kaip žinoma, yra suskaidytas ir turi bent 30 mikrochromosomų 24 . Neseniai buvo išleisti anotuoti 48 paukščių rūšių genomai 25, kurie paskatino mus dar kartą peržiūrėti paukščių DCC ir NETRIN genų evoliucijos istoriją. Taip pat atlikome palyginamąją komisinių grandinių organizavimo ir raidos ankstyvuosiuose paukščių embrionuose analizę.

Rezultatai

DCC genas yra daugelyje sauropsid genomų

Pirmiausia mes ištyrėme, ar DCC genas yra visuose turimuose sauropsidų genuose. Naudodamiesi NCBI ir Ensembl genomo duomenų bazėmis, keliose paukščių, krokodilų ir chelonijų genomuose aptikome genus, pažymėtus „ DCC “ (žr. Papildomą S1 lentelę). Mes atlikome filogenetinę analizę, siekdami atmesti galimybę, kad sauropsid DCC genai iš tikrųjų bus neogenino genai. Rekonstravome stuburinių DCC ir NEOGENIN baltymų filogeniją, naudodami 47 sekas iš 27 amniono genomų, o pogrupyje - drosophila Frazzled receptorius (DCC ortologas musėse) (1a pav.). Šiame medyje DCC ir NEOGENIN sekos susilieja į du skirtingus gerai palaikomus klodus, patvirtinančius, kad abu receptorius koduoja du atskiri genai. Sauropsid DCC sekos yra įtrauktos į stuburinių DCC grupę ir pakartoja žinomą filogeniją. Be to, trumpi šakos ilgiai rodo, kad šis genas yra labai konservuotas tarp visų stuburinių. Svarbu tai, kad neogenino genus buvo galima rasti visose tirtose paukščių rūšyse. Ilgesnė neogenino sekų, gautų iš praeivių (Pseudopodoces humilis, Geospiza fortis, Fiducela albicolis), šaka atskleidžia specifinį šios grupės sekų skirtumą. Visi šie rezultatai patvirtina, kad DCC genas yra sauropsiduose, įskaitant daugelį paukščių rūšių.

Image

a ) Sutaikytų DCC ir NEOGENIN filogenetinis medis. Analizė atlikta 47 stuburinių DCC ir NEOGENIN aminorūgščių sekų metodais, naudojant maksimalios tikimybės metodą, naudojant 1000 įkrovos replikų (sekų nuorodas žr. Papildomoje S1 lentelėje). Medis buvo įsišaknijęs naudojant Drosophila FRAZZLED seką, nes buvo išaugusios šakos ir šakos, kurių įkrovos vertės buvo mažesnės nei 50. Norėdami geriau vizualizuoti, mes iškirpėme pirmines šakas, kurių ilgis lygus 1, 2. b ) Išsaugota amnionų DCC chromosomos srities genominė sintezė. Paveiksle parodytas supaprastintas genominės sintezijos žemėlapis, kuriame palyginamos DCC ir jo kaimyninių genų padėtys skirtingose ​​amniono rūšyse (išsamią analizę žiūrėkite papildomame paveiksle S1). Kiekvieno geno ortologai vaizduojami ta pačia spalva ir pateikiami tame pačiame stulpelyje. c ) Siūlomas DCC genų praradimo paukščių linijoje scenarijus. DCC geno netekimas du kartus, nepriklausomai nuo galūnių ir praeivių.

Visas dydis

DCC genas buvo prarastas du kartus per evoliuciją

Paukščiuose DCC genas yra daugumoje pagrindinių paukščių grupių 26, įskaitant paleognatus, anseriformes, strisores, kolumbaves, gruiformes, aequorlitornithes, agrastų formavimo formas, koraciimorphes, falconiformes ir psittaciforme (papildoma S1 lentelė). Tačiau sutikdami su ankstesne ataskaita 18, šiuo metu turimo vištienos Gallus gallus genome neradome jokio DCC geno. Tai pasakytina ir apie du kitus tulžinius vorus: kalakutieną Meleagris gallopovo ir putpelę Coturnix japonicus. Tai rodo, kad šioje grupėje nėra DCC geno. Kitas ryškus rezultatas buvo DCC geno nebuvimas antroje pagrindinėje paukščių grupėje - praeiviuose. Iš tikrųjų mes nenustatėme DCC sekų nė viename iš vienuolikos NCBI turimų praeivių formų genomų, įskaitant zebro peleką Taenopygia guttata . Ir galutiniams, ir praeiviams buvome nustatę DCC genus jų atitinkamoje seserų grupėje, būtent anseriformus ir psittaciformus, kurie palaiko nepriklausomus genų nuostolius (papildoma S1 lentelė).

Norėdami suprasti paukščių DCC geno evoliucijos istoriją, mes ištyrėme DCC genomo sritį. Atlikdami fizinį genetinių lokusų lokalizavimą toje pačioje chromosomoje, atlikome šio konkretaus regiono individo ar rūšies analizę (arba sintezę) amniono genomuose, ty žinduoliuose (žmogus, pele, plekšnė), testudinose (dažytas vėžlys), krokodiluose ( aligatorius) ir įvairius paukščius, įskaitant paleognathe (stručio), galloanseres (vištiena, kalakutiena, antis, žąsis) ir 15 neoves (1b pav., papildomą S1 pav. ir papildomą lentelę S3-4-5). Esant DCC , paukščių lytinė chromosoma visada yra Z, priešingai nei kiti sauropsidai ir žinduoliai, kurių DCC yra autosomose 27, 28.

Sintenijos analizė parodė, kad šis regionas buvo labai konservuotas amnionuose ir tarp sauropsidų ir žinduolių buvo galima pastebėti tik keletą genų pertvarkymų, išskyrus du pagrindinius genų blokų nuostolius galiformose ir praeiviuose (1b pav. Ir papildoma S1 pav.).

Galutiniame formavime sintetiniame regione nebuvo 12 genų, įskaitant DCC, bloko: MAPK4, ME2, ELAC1, SMAD4, MEX3C, DCC, MBD2, POLI, STARD6, DYNAP, RAB27B ir CCDC68 (papildomas S1 pav.). Be to, kalakutoje trūko 13-ojo geno TCF4 (papildoma S1 pav.). Tik du iš šių genų buvo galima aptikti kitose šių tulžies formų genomai, naudojant NCBI tblastno algoritmą: MBD2 genas vištienoje ir putpelėse ir CCDC68 kalakutoje (papildomas S1 pav.), Tačiau jų padėtis genome vis dar nėra nustatyta. Be to, galliformose paskui šį regioną buvo galima pastebėti daugybę chromosomų pertvarkymų, priešingai nei šio genomo regiono stabilumas seserų grupėje, anseriformuose. Visų pirma, šalia šios delecijos esančių genų blokas (nuo TCF4 iki CPLX4 ) yra atvirkštinis, palyginti su protėvių seka. Be to, TCF4 genas, esantis ties delecijos bloko kraštu , yra anotuojamas 875 bp tikslumu nuo Z chromosomos pradžios (Gallus_gallus-4.0; Ch.Z NC_006127.3). Kartu tai rodo, kad DCC blokas buvo prarastas tulžies formose per Z chromosomos galūnės apversmą, kaip parodyta 1c pav.

Passeriforme 7 lokalių genų, įskaitant DCC , bloko taip pat nėra: DCC, MBD2, POLI, STARD6, DYNAP, RAB27B ir CCDC68 . Be to, turimų baltažiedžių žvirblių ir Zebra pelekų genomuose trūksta 8-ojo geno TCF4 (papildomas S1 pav.). Negalima aptikti nė vieno iš šių genų naudojant tblastn algoritmą ant praeivių genomo genų sekų. Ši praeivio formos genomų dalis yra blogai sukomplektuota, ir neįmanoma nustatyti, kaip šie pastoliai yra išdėstyti Z chromosomoje. Ankstesni tyrimai parodė, kad paukščių evoliucijos metu Z chromosoma genų netenka ir sutrumpėja 29 . Mūsų stebėjimai yra suderinami su scenarijumi, kuriame pateikiami du nepriklausomi Z chromosomų pertvarkymai galiformose ir praeiviuose, sukeliantys didelius chromosominio regiono nuostolius, įskaitant DCC geno bloką (1c pav.).

Netrin genai, išskyrus NETRIN-5 , yra visuose paukščiuose

Toliau mes ištyrėme, ar žinomų paukščių genomuose buvo genų, koduojančių pagrindinius DCC ligandus, išskiriamus NETRIN 30, 31, 32 . Aprašyti stuburinių gyvūnų 5 išskiriami NETRIN baltymai (nuo NETRIN nuo 1 iki 5). Manoma, kad visi jie jungiasi prie DCC 12, 33, 34, 35 . Ankstesnis tyrimas rodo, kad NETRIN genai atsirado prieš stuburinių spinduliuotę 36 . Norėdami ištirti paukščių NETRIN genų evoliucinę istoriją, rekonstravome jų filogeniją, naudodami amfioksus NETRIN-1 ir NETRIN-4 kaip pogrupius (papildomas S2 pav.). Šis filogenetinis medis atskleidė, kad NETRIN-2 ir NETRIN-3 sekos susilieja į vieną gerai palaikomą apvalkalą (žr. Papildomą S2 pav.), Parodydamos, kad tai iš tikrųjų yra dvi to paties geno anotacijos. Šis pastebėjimas buvo patvirtintas sintezės analize (duomenys nepateikti). Nebuvo galima pastebėti jokių paukščių NETRIN-1, NETRIN-2/3 ar NETRIN - 4 sekų skirtumų , palyginti su kitais stuburiniais. Visų pirma, šie genai taip pat buvo ir konservuoti tiek tulžies forma, tiek praeivių forma (papildomas S2 pav.). Priešingai, ilgos šakos rodo, kad NETRIN-5 sekos labai skiriasi visais stuburiniais gyvūnais. Be to, paukščių genomuose nebuvo įmanoma rasti jokio NETRIN-5 geno (papildomas S2 pav.). Visi šie duomenys rodo, kad DCC geno praradimo galiformose ir praeiviuose nėra ligando modifikavimo atitikmens.

DCC mRNR ir baltymų negalima aptikti tulžies formose ir praeiviuose

Norėdami patvirtinti DCC praradimą tulžies ir praeivių forma, palyginti su kitomis paukščių rūšimis, mes įvertinome jo mRNR ir baltymų produktą atlikdami in situ hibridizaciją ir imuninį dažymą. Mes panaudojome du riboprobus, atitinkamai klonuotus iš ančių ir balandžių cDNR, ir du skirtingus antikūnus, būdingus DCC tarpląsteliniam ir tarpląsteliniam domenui (žr. Metodus). Mes atlikome eksperimentus su įvairių rūšių paukščių embrionais, turimais turimais genomo duomenimis: vištiena ( Gallus gallus ), putpelėmis ( Cortunix japonica ), antis ( Anas platyrhynchos ), balandžiu ( Columba livia ) ir zebro peleku ( Taeniopygia guttata ). Be to, mes panaudojome dar tris galiformas (fazanus, košes ir putpeles) darant prielaidą, kad jie neturi DCC geno. Balandžių ir ančių DCC antisense riboprobai galėjo aptikti DCC mRNR jų atitinkamose rūšyse, o sens riboprobes negalėjo (S3 pav.). Be to, abu zondai galėjo aptikti DCC mRNR abiejose rūšyse (2e, f pav.). Priešingai, nė viename gaubiforminių ir praeivinių formavimo zonduose nebuvo aptinkamas joks signalas (2a – d, g pav.), Kas rodo, kad šiuose embrionuose nėra DCC mRNR. Panašiai dviem anti-DCC antikūnais buvo pažymėti nugaros smegenų pažeidimai ančių ir balandžių embrionuose, bet ne emblemose iš tulžies ir praeivių (2l ir n pav.). Kommissuraliniai aksonai taip pat buvo imunoreaktyvūs DCC stručių embrionų užpakalinėse smegenyse (duomenys nepateikti). Šis rezultatas patvirtina specifinių DCC genų nuostolių praeivių ir tulžies formose genomo duomenis. Imuninis dažymas antikūnu prieš paneroninį žymeklį ßIII-Tubuliną parodė, kad bendras septynių tirtų rūšių stuburo smegenų pjūvių aksonų traktavimas buvo labai panašus (2 pav.). Svarbu tai, kad visiems paukščiams buvo pažeisti stuburo smegenys. Mes taip pat atlikome imuninį dažymą antikūnais prieš „Roundabout 3“ (ROBO3) receptorius, kurie, kaip žinoma, yra ekspresuojami augančiais komssuraliniais aksonais stuburo smegenyse ir užpakalinėse smegenyse besivystantiems žinduoliams 37, 38, zebrafish 39 ir vištienai 40 . Visuose paukščiuose buvo aptiktas vienas ROBO3 genas (duomenys nepateikti), todėl visų tirtų paukščių embrionų stuburo smegenų atkarpose buvo stebimi ROBO3 imunopozityvūs kommisuraliniai aksonai (2 pav.). Taigi, atrodo, kad DCC receptorių nebuvimas neturi įtakos paukščių stuburo smegenų komisinei formacijai.

Image

Skirtingi įvairių paukščių stuburo smegenų skyriai: dažomi košės ( a, h ), fazano ( b, i ), putpelės ( c, j ), viščiuko ( d, k ), ančio ( e, l ), balandžio ( f, m ). ir zebro pelekas ( g, n ). ( a – g ) In situ hibridizavimas naudojant DCC antisense riboprobes, klonuotus iš ančių ir balandžių, nustato stiprią DCC mRNR raiškos reikšmę nugaros smegenyse ( e, f ). Anties ir balandžio riboprobai kryžmiškai reaguoja tarp dviejų rūšių, tačiau nepavyksta aptikti DCC mRNR galūnėse ( a – d ) ir praeiviuose ( g ). ( h – n ) ßIII-tubulino ir ROBO3 ekspresija buvo nustatyta visų stuburo smegenų venose. Anti-DCC antikūnai prieš tarpląstelinius ir tarpląstelinius domenus aptinka stiprią DCC baltymo išraišką antros ( l ) ir balandžio ( m ) ventraliniuose komisariniuose neuronuose, tačiau nesugeba aptikti jokios DCC išraiškos tulžies forma ( h – k ) ir praeivių forma ( n ). Rodyklės rodo vidurinę ventralinę liniją. Santrumpos, Drg, nugaros šaknies ganglijos; Pone, motorinė nervinė šaknis. Svarstyklės: 50 μm.

Visas dydis

Norėdami toliau tirti DCC raiškos modelį paukščiuose, HH21-22 atlikome viso stiprumo anti-DCC imuninį dažymą, 3DISCO išvalymą ir 3D vaizdą su šviesos lapo mikroskopija viščiukų, fazanų, ančių, balandžių ir zebrų pelekų embrionams. Viščiukas ankstyvuosius aksoninius traktus 41 ir periferinius nervus galėjo žymėti anti-ßIII tubulino imuniniu dažymu, tačiau nė vienas neišreiškė DCC (3a, b pav. Ir papildomas filmas S1). Mums taip pat nepavyko aptikti DCC išraiškos fazanų ir zebro pelekų embrionuose (papildomas S4 pav.), Patvirtinančiais tai, kas rasta nugaros smegenyse. Priešingai, daugelis aksonų buvo imunoreaktyvūs DCC ančių ir balandžių embrionuose (3c pav., D). Kaip anksčiau buvo parodyta graužikams ir ksenopusui, DCC plačiai buvo ekspresuojamas komensuraliniais aksonais mezencephalone, diencephalone ir rombencephalone. DCC taip pat buvo aptiktas tinklainės gangliono ląstelėse, uoslės nervuose, motoriniuose aksonuose ir fasciculus retroflexus (3e – j pav. Ir papildomas filmas S1). Šie duomenys kartu patvirtina, kad DCC selektyviai prarado galiformos ir praeeriformos linijas, nepaisant labai konservatyvaus ekspresijos modelio kituose tetrapoduose.

Image

DCC ( a ) ir ßIII-Tubulinas ( b ), ištisinis imuninis dažymas HH22 vištienos embrionuose po 3DISCO valymo. Vištienos embrionuose DCC ekspresijos nenustatyta, tuo tarpu daugelis aksonų traktų yra stipriai paženklinti anti-ßIII-tubulinu. ( c – j), priešingai, DCC yra stipriai išreikštas balandžių ( c, e – g ) ir ančių ( d, h – j ) embrionuose, lygiais HH22 arba HH28. ( h – j ) balandžių embrionuose DCC randamas komisinės dalies aksonuose, kertančiuose grindų plokštę (rodyklės galvutė e ), tinklainės ganglinėse ląstelėse (Rgc) ir regos nerve (On; f ), habenulo branduolyje ( Ha) ir fasciculus retroflexus (Fr; g ). ( h – j ) ančių embrionuose DCC randamas stuburo smegenų (Sc) komisiniuose šerdies aksonuose, motorinių nervų šaknyse (Mr), Rgc akyje ( i ), regos nervo (On) diencephalon (Di) ir uoslės nerve (Olf). ). Mastelio juostos yra 200 μm, išskyrus ( e, j ), 100 μm ir f, 50 μm. Santrumpos, Di: diencephalon; Hb: užpakalinis smegenys; Tec, tektumas; Olf: uoslės nervas; Tel, telencephalonas; Tg, trišakis ganglionas.

Visas dydis

Homogeninis ankstyvųjų komisinių pėdsakų organizavimas paukščių embrionuose

Norėdami išsiaiškinti, ar dėl DCC trūkumo praeiviuose ir tulžies pavidalo organizmuose jų organizmo kommisuralinės projekcijos galėjo skirtis, palyginome ankstyvą commissural traktų vystymąsi viščiuke su balandžių ir ančių embrionais. Mes panaudojome anti-ROBO3 imuninį dažymą, kad specialiai pažymėtume visus užpakalinius komisinius pėdsakus ir atkurtume jų 3D struktūrą. Be to, mes panaudojome anti-ßIII tubuliną, norėdami ištirti komosuralinių rostralinių traktų raidą. Visuose embrionuose kommisuralinių aksonų padėtis, raidos seka ir tankis buvo panašūs (4 pav.). Kaip buvo tikėtasi iš ankstesnio darbo su pele, esant DCC, homogeniškai nudažė visus nugaros smegenų ir užpakalinių smegenų komisinius aksonus, kaip ir ROBO3 (4 pav., Papildomas S2 pav. Ir papildomi filmai S2-S3). Taip pat buvo pažymėtas fasciculus retroflexus ženklas, o didelių skirtumų nepastebėta (duomenys nepateikti). Daugiau rostralinių lygių, kur nebuvo išreikštas ROBO3, su anti-ßIII tubulinu buvo galima pastebėti tokius komisinius traktus, kaip užpakalinis ar po optinio užmetimo traktas (papildomas S4 pav.), Ir nebuvo pastebimas skirtumas tarp viščiuko ir anties ar balandžio. embrionai.

Image

( a – o ) Nesudėtingų, ant paukščių embrionų, pažymėtų anti-Robo3 antikūnais, 3D šviesos lakštų vaizdai. ( a – c ) H21-22 viščiukų embrionuose Robo3 yra išreikštas komssuraliniais aksonais tektumoje (Tec), vidurinėje smegenų dalyje (Mb) ir užpakalinėje smegenyse (Hb), bet ne telencephalone (Te). Grindų plokštė b rodyklės rodykle pažymėta. Kommisuraliniai aksonų augimo kūgiai (rodyklė) matomi artėjant prie vidurinės linijos ( c ). Lygiaverčiais vystymosi etapais fazanų ( d – f ), ančių ( g – i ), balandžių ( j – l ) ir zebrinių pelekų ( m – o ) embrionų erdviniai modeliai yra panašūs kaip Robo3 + komisinės. Mastelio juostos, 300 μm ( a, d, g, j, m ); 150 μm, ( b, e, h, k, n) ; 100 μm ( c, f, i, l, o ).

Visas dydis

Diskusija

Mes nustatėme DCC genus tipinėse saurians, chelonians, krokodilų rūšyse, taip pat daugelyje paukščių rūšių, įskaitant paleognathes, anseriformes ir daugybę neoaves. Priešingai, DCC geno trūksta vištienoje, sutinkant su ankstesniais stebėjimais 18, taip pat kituose tulžies dariniuose, kalakutoje ir putpelėse. Be to, DCC nėra ir praeiviuose, tokiuose kaip varna, muselių gaudytojas ir zebrinis pelekas. DCC genas taip pat nerastas kai kurių paukščių genomuose, esančiuose ne iš praeivių ir galiforminių formų (S1 lentelė), tačiau šie paukščių genomai priklauso mažo aprėpties genomo sekos grupėms 42 . Be to, šiais atvejais kiti tų pačių grupių paukščiai turi DCC geną, kas rodo, kad jo nebuvimas labiau tikėtinas dėl neišsamių genomo sekų, nei dėl tikro DCC nebuvimo šiose rūšyse. Filogenijos analizė aiškiai suklasifikavo paukščių DCC sekas su kitų sauropsidų DCC ir kartu su žinduolių ir aktinoterpijos sekomis viename DCC apvalkale. NEOGENIN, DCC paralogas, atvirkščiai, egzistuoja visiems paukščiams.

Tai patvirtina, kad paukščių protėviuose buvo DCC genas, užsikrėtęs įvairiose paukščių grupėse, tačiau jis prarastas dviejose skirtingose ​​grupėse - tulžies formos ir praeivių. Remiantis dabartine paukščių filogenija, šios dvi grupės nėra glaudžiai susijusios 26, 43, tai rodo, kad paukščių radiacijos metu įvyko du nepriklausomi DCC nuostolių atvejai. Yra žinoma, kad kai kurių genų nebuvimas dabartiniuose paukščių genomuose gali būti susijęs su nepilna kai kurių genomo sričių seka 44 . Čia parodyta, kad DCC mRNR ir DCC baltymų buvimas ar nebuvimas smegenyse atitiko DCC geno buvimą ar nebuvimą atitinkamuose paukščių genuose. Filogenijos medyje trumpi paukščių DCC šakų ilgiai parodė, kad paukščių DCC sekos nesiskyrė, palyginti su kitomis amniono sekomis. Be to, DCC raiškos modelis, kai jo yra, yra panašus į aprašytą pelėje 14, 45 . Tai rodo, kad DCC praradimas kai kuriose paukščių grupėse nebuvo susijęs su dideliais DCC struktūros ir funkcijos pokyčiais paukščių linijoje. Be to, sintezės analizė parodė, kad tiek tulžies forma, tiek praeivių forma kartu su DCC prarandama daugybė genų. Tai rodo, kad šių paukščių DCC praradimas nėra nukreiptas konkrečiai į DCC geną, bet yra susijęs su visu genomo regionu. Tai skiriasi nuo kitų neseniai paskelbtų paukščių genų praradimų, tokių kaip KISS geno 46 praradimas. Šiuo atveju galima pastebėti išsigimusią KISS seką kai kuriose paukščių rūšyse, tokiose kaip antis, zebrinis pelekas ir uolinis balandis, ir specifinis šio geno praradimas daugelyje kitų paukščių, įskaitant falšą ir viščiuką, ir tai rodo, kad mutacijos kaupiasi. ir funkcijos pakitimas įvyko prieš 46 geno praradimą. Čia DCC trūkumas atsirastų dėl nepriklausomų atsitiktinių praradimų tiek galutiniame formavimo forma, tiek praeivių formavimo metu Z chromosomos rekombinacijos metu. Šis rezultatas buvo patvirtintas nepriklausomame tyrime, kurį atliko Patthey ir kt. 47

Stuburiniuose gyvūnuose DCC jungiasi prie NETRIN-1 12, 48, NETRIN2 / 3 34, NETRIN-4 33 ir galbūt NETRIN-5 35 . Mūsų filogenijos analizė parodė, kad visi paukščiai turi NETRIN-1, 2/3 ir 4, kaip ir kiti osteichtijai, be ypatingo nukrypimo. Įdomu tai, kad nepavyko atkurti paukščių NETRIN-5 sekos, o šio geno yra kitose amnionuose, taip pat teleostinėse žuvyse. Tai rodo ankstyvą NETRIN-5 praradimą paukščių linijoje. Žinduoliams NETRIN-5 yra ekspresuojamas besivystančiose smegenyse, ypač neurogeniniuose regionuose 32, tačiau jo funkcija vis dar nežinoma. Be to, kad DCC netenka galiūnų ir praeivių, jie NETRIN-5 trūkumas egzistuojančiose paukščių rūšyse rodo ir dar vieną ryškų DCC / NETRIN sistemos ypatumą paukščiams.

Buvo pranešta, kad pelėje DCC yra būtinas NETRIN-1 tarpininkavimui pritraukti daugelyje skirtingų sistemų 15, o DCC nokautai nėra gyvybingi 14 . Ankstesni in vitro tyrimai parodė, kad ir jauniklis NETRIN-1 pritraukia jutimo ir motorinius neuronus, nugaros smegenų ir užpakalinių smegenų internetinius neuronus, GnRH neuronus, žarnyno žarnos žarnos apvalkalo ląsteles ir oligodendrocitų pirmtakus 20, 21, 23, 49, 50, 51, 52, 53 . Vis dėlto kelių anksčiau paskelbtų tyrimų išvadą verta persvarstyti atsižvelgiant į mūsų rezultatus. Pavyzdžiui, anti-DCC antikūnų, naudojamų blokuoti NETRIN-1 aktyvumą viščiukų ląstelėse 19, 20, specifiškumas yra labai abejotinas, nes viščiukų genome nėra DCC. Panašiai, aksonų nukreipimo defektai, pastebėti po apipjaustytų ar mutavusių žmogaus DCC receptorių ar viščiuko nugaros smegenų ROBO1 ektodomeno elektroporacijos, negali būti priskiriami dominuojančiam neigiamam poveikiui, tokiam kaip dimerizacija su endogeniniu DCC 22, 23 . Šiems rezultatams paaiškinti turėtų būti pasiūlyti kiti modeliai, kuriems nereikia DCC. Pavyzdžiui, egzogeniniai DCC receptoriai gali jungtis su Robo1 / Robo2 / Robo3 receptoriais ir juos trikdyti, kuriuos visus išreiškia viščiukų komisiniai papildomi aksonai 54, 55 ir kurie yra žinomi DCC partneriai pelių neuronuose 56, 57 . Jie taip pat gali įstrigti NETRIN-1 ir taip titruoti jį iš kitų receptorių.

Ankstyvųjų paukščių embrionų analizei nepavyko atskleisti jokių didelių kommisuralinių traktatų vystymosi skirtumų, nepaisant DCC. Nors tokie kommisuralinių sistemų skirtumai gali egzistuoti vėlesniuose vystymosi etapuose, išlieka mįslingas klausimas, kaip kai kurios paukščių rūšys susidorojo su atsitiktiniais DCC nuostoliais, ypač dėl receptorių (-ų), tarpininkaujančių NETRIN-1 cheminio patrauklumo veiklai šiose rūšyse. .

Pirmasis akivaizdus kandidatas yra DCC paralogas NEOGENIN, kaip buvo pasiūlyta anksčiau 18 . Pelėse DCC ir NEOGENIN bendradarbiauja, kad nugaros smegenų komisiniai aksonai pritrauktų prie grindų plokštės, o NEOGENIN gali iš dalies kompensuoti DCC nebuvimą graužikams 58 . Filogenijos analizė atskleidžia NEOGENIN sekų skirtumus praeivių formose, o tai rodo NEOGENIN neofunkcionalizavimą šioje grupėje. Kadangi ši paukščių grupė neteko DCC, galime kelti hipotezę, kad šis neofunkcionalizavimas gali būti susijęs su NEOGENIN, atliekančiu DCC funkciją. Tačiau tokio NEOGENIN sekos skirtumo nepastebėta tulžies formose, kurios taip pat prarado DCC. Todėl toks NEOGENIN nefunkcionalizacijos scenarijus šioje vėlesnėje grupėje negalėjo būti taikomas. Nors NEOGENIN yra bent kai kuriuose viščiukų nugaros smegenų komisiniuose neuronuose 18, dar neįrodyta, kad jį ekspresuoja visi NETRIN-1 reaguojantys šios rūšies neuronai, ir skirtingai nuo DCC, NEOGENIN turi kitų ligandų 59 .

Viščiukų embrionuose NETRIN-1 taip pat surišo Dauno sindromo ląstelių adhezijos molekulę (DSCAM), o tylinti DSCAM raiška viščiuko nugaros smegenų neuronuose pablogina NETRIN-1 trauką 60 . Graužikams neseniai atlikti in vivo tyrimai, naudojant pelių išmušimą, sukėlė iššūkį šiam modeliui ir rodo, kad DSCAM 61 yra būtinas NETRIN-1 pritraukti komizsuralinius aksonus. Belieka patvirtinti, kad taip yra ir su praeiviais ir galviniais.

Įdomu tai, kad DCC taip pat surišo nugaros atstumiamąjį aksonų orientacinį baltymą (DRAXIN), išskiriamą molekulę, kuri atstumia įvairių klasių kommisuralinius aksonus 62 . DRAXIN ir NETRIN-1 jungiasi vienas su kitu ir konkuruoja dėl DCC surišimo 63 . Paslaptis yra ir tai, kaip DRAXIN, kuris pirmą kartą buvo išskirtas jauniklių embrione 62, gali veikti paukščiams, kurie neturi DCC, bet taip pat gali būti NEOGENIN. Svarbu tai, kad išankstinė paukščių genomų analizė rodo, kad DSCAM, UNC5A-D ir DRAXIN genai egzistuoja visuose paukščiuose (duomenys nepateikti).

Žinduoliams DCC vaidina svarbų vaidmenį ne tik dėl aksonų, bet ir dėl nervų keteros ląstelių bei GnRH neuronų migracijos iš uoslės epitelio. 20, 64 . DCC įtakoja arterijų autonominės inervacijos vystymąsi 65 . Be to, DCC yra priklausomybės receptorius, galintis sukelti apoptozę, kai nėra NETRIN-1 66 - mechanizmo, kuris galėtų paaiškinti jo priešnavikines savybes 17 . Todėl galima tikėtis, kad DCC netekimas turės svarbių padarinių daugelio atitinkamų paukščių rūšių organų vystymuisi ar funkcijai, jei jie nebus visiškai kompensuoti kitų receptorių.

Galimas SMAD4, taip pat esančio DCC genominiame regione, praradimas yra ypač įdomus, nes SMAD4 išmuštos pelės yra embrioninės mirtinos 67 . Vis dėlto mes galime rasti į SMAD4 panašų geną ant vištos 25 chromosomos. Šis genas yra išsaugotas ir jo lokusas nesikeičia visiems paukščiams ir daugeliui stuburinių gyvūnų, išskyrus žinduolius, ir jau buvo apibūdintas 68 ksenopuse. Svarbu suprasti, kaip kai kurie paukščiai gali susitvarkyti, jei nėra SMAD4, ar SMAD4 panašūs galėtų pakeisti SMAD4.

Svarbu tai, kad vėžys buvo aprašytas visiems stuburiniams gyvūnams, įskaitant paukščius, o dauguma trūkstamų genų, tokių kaip SMAD4 67, SKA1 69, MEX3C 70 ir DCC, buvo susieti su navikogeneze. Įdomu tai, kad viščiukuose yra didelis spontaninio kiaušidžių vėžio dažnis, o paplitimas siekia 3, 5% po 3, 5 metų amžiaus - 71, 72 . Tai gerai koreliuoja su DCC ekspresijos sumažėjimu, aprašytu žmogaus kiaušidžių navikuose 73, 74 .

Apibendrinant, mūsų rezultatai rodo, kad kommisuraliniai aksonų nukreipimo mechanizmai tarp paukščių rūšių nėra išsaugoti, tačiau, atrodo, kad tai neturi didelės įtakos smegenų struktūrai. Tai parodo didelį aksonų nukreipimo mechanizmo plastiškumą ir tai, kokia įvairi ši sistema gali būti tarp stuburinių. Neseniai buvo pranešta apie kitą šios įvairovės pavyzdį žinduoliuose, kai kelių aminorūgščių mutacijos žinduolių ROBO3 receptoriuose visiškai pakeitė jo veikimo mechanizmą komisinių neuronuose 56 . Norint visapusiškai įvertinti šią įvairovę, bus svarbu rekonstruoti stuburinių gyvūnų komiso orientacinių receptorių ir ligandų filogeninę istoriją.

Metodai

Genomo duomenų bazių analizė

Baltymų sekos iš anotuotų genų buvo išgautos iš Ensembl arba NCBI genomo naršyklių (//www.ensembl.org/index.html ir //www.ncbi.nlm.nih.gov/nuccore/). NCBI tinklalapio TBLASTN algoritmas (//blast.ncbi.nlm.nih.gov/Blast.cgi) buvo naudojamas turimose genomo duomenų bazėse, kai genai nebuvo anotuojami anksčiau. Norėdami gauti išsamią informaciją apie genomą ir sekas, žiūrėkite papildomas S1 ir S2 lenteles.

Filogenetinė analizė

DCC-NEOGENIN analizė

47 sekos, sudarytos iš numatomo subrendusio netrin receptoriaus (DCC-NEOGENIN) su N-galo signalo peptidu, pirmiausia buvo sulygiuotos naudojant „ClustalW 75“, po to rankiniu būdu sureguliuojamos. Gautos derinimo JTT (Jones, Taylor ir Thornton) baltymų pakeitimo matrica buvo nustatyta naudojant „ProTest“ programinę įrangą 76 . NEOGENIN-DCC receptorių suderinimo filogenetinė analizė buvo atlikta naudojant „Maximum Likelihood“ metodą su 1000 įkrovos replikų („RaxML“ programinė įranga, //www.phylo.org/portal2). Kaip pogrupis buvo naudojamas DCC-NEOGENIN homologinis Drosophila melanogaster FRAZZLED receptorius.

NETRIN-1/2/3/5 ir NETRIN-4 analizė

52 sekos NETRIN-1/2/3/5 ir 19 sekos NETRIN-4, kiekviena iš jų sudaryta iš numatomo subrendusio NETRIN baltymo su N-galiniu signalo peptidu, buvo sulygintos naudojant „ClustalW“. Gauto derinio JTT baltymų pakeitimo matrica buvo nustatyta naudojant „ProTest“ programinę įrangą. Phylogenetic analysis of the NETRIN sequences alignment was performed using the Maximum Likelihood method with 1, 000 bootstrap replicates (RaxML software) using Branchiostoma floridae NETRIN-1 and NETRIN-4 as outgroups, respectively.

DCC synteny analysis

Synteny maps of the DCC conserved genomic region were reconstructed for mammals (human, mouse, platypus), chelonian (painted turtle), crocodilians (alligator) and birds: paleognathae (ostrich), galloansers (duck, goose, chicken, turkey), and neoaves (falcon, bald eagle, royal eagle, adeli penguin, emperor penguin, pigeon, ibis, egret, cuckoo, chimney swift, hoatzin, zebra finch, sparrow, flycatcher and crow). Analyses of DCC neighbouring genes were performed manually using complete or preliminary annotated genome sequences from NCBI genome browser (//www.ncbi.nlm.nih.gov/gene/), including numerous unplaced genomic scaffolds (see Supplementary Table S3 for references and locations of the genes used in the synteny analysis, Table S4 for a complete list of the genes used in this analysis, and Table S5 for a complete list of species used in the analysis). To complete this analysis we used TBLASTN algorithm on NCBI database to identify non-annotated DCC neighbouring genes and confirm gene absence (//blast.ncbi.nlm.nih.gov/Blast.cgi).

Animal sampling

Eggs from chicken Gallus gallus , duck Anas platyrhynchos , zebra finch Taenopygia guttata , pigeon Columba livia , quail Coturnix japonica , pheasant Phasianus colchicus and partridge Perdrix perdrix were incubated at 37 °C in humid conditions. Embryos were collected at different time points depending on their embryological stage. All procedures were performed in accordance to the guidelines approved by French Ministry of Agriculture and UPMC University ethic committee. Stage determination was done according to literature 77, 78, 79 . Exact number of embryos collected per stage is presented in Supplementary Table S6. Embryos were first transferred to ice-cold PBS 1X; from E8, the nervous system were dissected and all embryos were then fixed by immersion in 4% paraformaldehyde overnight at 4 °C. Samples were transferred to PBS 1X and kept at 4 °C until use.

For whole-mount immunostaining, samples were dehydrated in methanol (MeOH 50%in PBS 1X - MeOH 80% in PBS 1X - MeOH 100%) and incubated overnight in MeOH with 5%H 2 O 2 to suppress blood auto-fluorescence. Samples were then rehydrated (MeOH 100%- MeOH 80% in PBS 1X - MeOH 50%in PBS 1X - PBS 1X) and kept in PBS 1X at 4 °C until use.

Histochemistry

Hibridizacija in situ

Tissue sectioning and in situ hybridization were performed as previously described 37 . Pigeon DCC probe was designed in highly conserved domain of DCC gene coding from Fibronectin 5 to P1 domain. The sequence was amplified from pigeon embryos cDNA using following primers (Forward: 5′- CAGTAGGTGTCCAGGCTGTTG - 3′; Reverse: 5′- CCCGTTGGCTTCTCCATGTTC - 3′) and cloned into pCRII-TOPO plasmid (ThermoFisher). The Duck DCC cDNA was kindly provided by Dr Sara Wilson.

Sections immunostaining

Immunostaining were performed as previously described 37 . The following primary antibodies were used: mouse anti-βIII Tubulin (1:1000, MMS435P-Covance), goat anti-ROBO3 (1:500, AF3076-R&D), goat anti-DCC (1:400, Sc-6535-Santacruz, raised against intracellular C-terminal domain of human DCC), mouse anti-DCC (1:300, AF-OP45-Calbiochem, raised against extracellular domain of human DCC). Corresponding secondary antibodies were used: donkey anti-rabbit Alexa488 (1:500, 711-545-152-Jackson), bovine anti-goat Cy3 (1:500, 805-165-180, Jackson), donkey anti-mouse cy3 (1:500, 715-165-150-Jackson), goat anti-mouse DL649 (1:500, 115-495-205-Jackson). Sections were counterstained with Hoechst and examined with a fluorescent microscope (DM6000, Leica) coupled to a CoolSnapHQ camera (Roper Scientific).

Whole-mount Immunostaining

Samples were incubated at room temperature (RT) in a solution (PBSGT) of PBS 1X containing 0.2% gelatin (Prolabo), 0.5% Triton X-100 (Sigma-Aldrich) and 0.01% thimerosal (Sigma-Aldrich) for 3 h (E4-E6) or 8 h. Samples were next transferred to PBSGT containing the primary antibodies and placed at 37 °C, with rotation at 70 rpm, for 4 days (E4-E6) or 7 days. Primary antibodies used were the following: mouse anti-βIII Tubulin (1:1000, MMS435P-Covance), goat anti-ROBO3 (1:400, AF3076 R&D), goat anti-DCC (1:400, Sc-6535 Santacruz) and mouse anti-DCC (1:300, AF-OP45-Calbiochem). Samples were then washed 3 times in PBSGT for 2 h at RT and incubated for 24 h at 37 °C in secondary antibody diluted in PBSGT. Secondary antibodies used were the following: donkey anti-rabbit Alexa647 (1:500, 711-605-152-Jackson), bovine anti-goat Cy3 (1:500, 805-165-180, Jackson) and donkey anti-mouse Alexa488 (1:500, A21202-Lifetechnolgie). After 4 washes of 2 h in PBSGT at RT, samples were stored at 4 °C in PBS until clearing.

Small samples (E4) were included in agarose 1.5% prior tissue clearing for better positioning in the ultramicroscope chamber.

Tissue clearing was performed using 3DISCO-clearing procedure as previously described 80 . Samples are stored in dibenzylether (DBE) in light protected glass vials at RT.

Ultramicroscopy

3D imaging was performed with an ultramicroscope (LaVision BioTec) using ImspectorPro software (LaVision BioTec). The light sheet was generated by a laser (wavelength 488 and 561 nm, Coherent Sapphire Laser and 640 nm, Coherent OBIS 640–100LX laser, LaVision BioTec) and two cylindrical lenses. A binocular stereomicroscope (MXV10, Olympus) with a 2X objective (MVPLAPO, Olympus) was used at different magnifications (1.25×, 1.6×, 2×, 2.5×, 3.2× and 4×). Samples were placed in an imaging reservoir made of 100% quartz (LaVision BioTec) filled with DBE and illuminated from the side by the laser light. Images were acquired with a PCO Edge SCMOS CCD camera (LaVision BioTec).

Image processing was performed using Imaris software (Bitmap), as described previously 80 .

Papildoma informacija

How to cite this article : Friocourt, F. et al . Recurrent DCC gene losses during bird evolution. Mokslas. Rep. 7, 37569; doi: 10.1038/srep37569 (2017).

Leidėjo pastaba: „ Springer Nature“ išlieka neutralus paskelbtų žemėlapių jurisdikcijos reikalavimų ir institucinių ryšių atžvilgiu.

Papildoma informacija

Vaizdo įrašai

  1. 1.

    Papildomas filmas S1

  2. 2.

    Papildomas filmas S2

  3. 3.

    Papildomas filmas S3

PDF failai

  1. 1.

    Papildoma informacija

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.