„runx1 / eto“ blokuoja selektyvino sukibimą epigenetiniu psgl-1 nutildymu | onkogenezė

„runx1 / eto“ blokuoja selektyvino sukibimą epigenetiniu psgl-1 nutildymu | onkogenezė

Anonim

Dalykai

  • Onkogenai

Anotacija

RUNX1 / ETO (RE), iš t (8; 21) gaunamas leukemijos transkripcijos faktorius, susijęs su ūminės mieloidinės leukemijos (AML) raida, panaikina genų, dalyvaujančių diferenciacijoje, atsinaujinimo ir proliferacijos metu, reguliavimą. Be to, šios ląstelės pasižymi skirtumu ląstelių adheziniame elgesyje, kurio molekulinė bazė nėra gerai suprantama. Čia parodome, kad RE epigenetiniu būdu nutildo geną, koduojantį P-Selectin glikoproteino ligandą-1 (PSGL-1), ir sumažina PSGL-1 ekspresiją žmogaus CD34 + ir pelių lin-hematopoetinėse protėvių ląstelėse. PSGL-1 lygiai atvirkščiai ir nuo dozės priklauso nuo RE onkogeno lygio. Tačiau DNR surišantis mutantas nesugeba sureguliuoti PSGL-1. ChIP eksperimentais parodome , kad PSGL-1 promotorius yra tiesioginis RE taikinys, o jungimąsi lydi aukštas represinio chromatino ženklo histono H3K27me3 lygis. T (8; 21) + kasumi-1 ląstelėse PSGL-1 ekspresija yra visiškai atstatyta tiek mRNR, tiek ląstelių paviršiaus baltymų lygyje po to, kai RE yra sureguliuota trumpa plaukų smeigtuko RNR (shRNR) arba RE slopinimas naudojant tetramerizaciją blokuojančius peptidus. promotorius H3K27me3 yra pakeistas aktyvinančiu chromatino ženklu H3K9ac, taip pat RNR polimeraze II. PSGL-1 reguliavimas atstato ląstelių surišimą su P- ir E-selektinu ir atkuria mieloidui būdingą ląstelių adheziją, tuo tarpu jis neprisijungia prie limfocitams būdingo L-selelino. Apskritai, mūsų duomenys rodo, kad RE onkoproteinas epigenetiniu būdu slopina PSGL-1 , prisijungdamas prie jo promotoriaus srities, ir taip daro įtaką t (8; 21) + AML ląstelių lipniajam elgesiui.

Įvadas

RUNX1 / ETO (RE) - iš t (8; 21) gaunamas sulietas baltymas - 12% de novo ūminės mieloleukemijos (AML) atvejų ir iki 40% M2 potipio AML pagal prancūzų – amerikiečių - Britanijos klasifikacija. 1 Neseniai buvo nustatyta sutrumpinta RE (REtr) forma, kuriai trūksta C-galo N-CoR / SMRT sąveikaujančio domeno, pakartojant natūraliai atsirandantį labai leukemogeninį sandūros variantą RE9a, stebėtą AML sergantiems pacientams. 2, 3 RE turi RUNX1 DNR surišantį domeną, sulietą su beveik visu branduolio bendro represoriaus ETO baltymu. RE heterodimerizuojasi su CBFβ, kad efektyviai prisijungtų prie DNR komplekse su kitais transkripcijos reguliatoriais, sukeliančiais normalios mielopoezės reguliavimo panaikinimą. 1, 4 ETO regionas veikia kaip dominuojantis RUNX1 taikinių genų represorius, įdarbindamas tokius branduolinius represorius kaip N-CoR, SMRT, mSIN3A ir histono deacetilazes. 5, 6, 7, 8 RE tiesiogiai slopina kelis taikinius, tokius kaip PU.1, CEBPα, mikroRNR-223, granulocitų – makrofagų kolonijas stimuliuojantį faktorių ir neutrofilų elastazę. 9, 10, 11, 12, tačiau RE taip pat gali suaktyvinti tam tikrų genų, tokių kaip p21 / WAF / Cip1, ID1 ir EGR1, transkripciją įdarbinant p300. 12 Taip pat RE epigenetiniu būdu panaikina genų, dalyvaujančių kraujodaros kamieninių kamienų ir pirmtakų ląstelių proliferacijoje, atsinaujinimo ir diferenciacijos procese, procesą, dėl kurio mieloblastinėje stadijoje atsiranda diferenciacijos blokas. 13

Adhezijos molekulės turi lemiamą reikšmę kraujodaros kamieninių ir progenitorinių ląstelių judėjimui ir pusiausvyrinei kraujodarai. 14 Piktybinėse kraujodaros ląstelėse dažnai panaikinamas kraujodaros kamieninių ir progenitorinių ląstelių homologinių receptorių, tokių kaip VLA-4, LFA-1, P-Selectin glikoproteino ligandas-1 (PSGL-1) ir CD44, ekspresija. 15, 16, 17, 18 Be to, nustatyta, kad RE tiesiogiai reguliuoja CD44, VLA-4 ir LFA-1 išraiškas. 15, 17, 19 Transmembraninis baltymas PSGL-1 yra su 220 kDa disulfidu sujungtas homodimerinis sialomucinas, ekspresuojamas aktyvuotų endotelio ląstelių, mieloidinių ir limfoidinių ląstelių paviršiuje. 20 Tai yra pagrindinis P (trombocitų) -selektino ligadas; tačiau fiziologinės tėkmės sąlygomis jis taip pat jungiasi su E (endotelio) ir L (leukocitų) selektyvu. 21, 22 seleino atpažinimas yra kritiškai priklausomas nuo posttransliacinių modifikacijų, tokių kaip PSGL-1 sializavimas, fukosilinimas ir O-glikozilinimas. 20, 23, 24 PSGL-1 taip pat turi chemokinų CCL19 ir CCL21 rišamąsias vietas ir efektyviai reguliuoja T ląstelių priskyrimą antriniams limfoidiniams organams. 25, 26 psl. PSGL-1 / P-selektino sąveika prisideda prie kraujodaros ląstelių sukimosi ant endotelio ląstelių, po to vykstančia migracija į audinius, tokiu būdu reguliuojant imunitetą ir pusiausvyrinės kraujodaros procesą. 21, 27, 28 PSGL-1 stokojantys leukocitai rodo sutrikusį pririšimą prie P- ir E-selektino in vivo ir jų judėjimą . 29 Be to, PSGL-1 N-galo srities blokavimas monokloniniais antikūnais panaikina leukocitų, esančių ant P- ir L-selelino, judėjimą. 30

Šioje ataskaitoje mes parodome, kad RE tiesiogiai sąveikauja su PSGL-1 promotoriaus regionu ir epigenetiniu būdu slopina PSGL-1 hematopoetinių pirmtakų ląstelėse. Šios represijos yra ląstelių sukibimo kliūtis, kuri visiškai atsistato sunaikinus RE. Tai rodo, kad PSGL-1 ekspresijos ir kitų adhezijos molekulių reguliavimo panaikinimas yra svarbus t (8; 21) + AML požymis.

Rezultatai

PSGL-1 nėra t (8; 21) + AML ląstelėse

Norėdami nustatyti adhezijos molekules, kurias reguliuoja RE, mes išanalizavome Kasumi-1 ląstelių adhezijos molekulių raiškos modelį, palyginti su žmogaus CD34 + ląstelėmis, gautomis iš sveikų donorų periferinio kraujo aferezės (1a pav.). Buvo pranešta, kad integruotas LFA-1 ( CD11a , ITGαL ) yra tiesiogiai represuotas RE tikslinis genas 15 ir nustatyta, kad jis ekspresuojamas žemu kiekiu Kasumi-1 ląstelėse (1a pav.). Taip pat buvo pastebėti skirtumai tarp ITGα5, ITGß1, ICAM-1, CXCR4, CXCR7, ITGß7 ir L-selektino. Įspūdingiausia, kad Kasumi-1 ląstelės išreiškia vos aptinkamą sialomucino PSGL-1 lygį (1a ir b pav.). PSGL-1 taip pat buvo identifikuotas kaip galimas RE taikinys per genomo chromatino imunoprecipitaciją (ChIP), pakeičiančius eksperimentus su Kasumi-1 ląstelėmis ir t (8; 21) + paciento medžiaga. 31 Sutikdamas su mūsų pastebėjimais, viešai prieinama genų rinkinių duomenų bazė atskleidė žemą PSGL-1 ekspresijos lygį t (8; 21) + pirminėse leukemijos ląstelėse, palyginti su sveikomis kolegomis (1c paveikslas). 32 Tolesnė didelio karoliotinių tipų AML genų masyvo duomenų analizė taip pat parodė mažą PSGL-1 raišką t (8; 21) + mėginiuose (1d pav.).

Image

PSGL-1 ekspresijos lygiai t (8; 21) + leukemijos ląstelėse. a ) Kasumi-1 ląstelių ir žmogaus kraujodaros CD34 + ląstelių adhezijos molekulių paviršiaus paviršiaus raiškos modeliai, įvertinti srauto citometrijos metodu ( n = 3). b ) PSGL-1 raiškos paviršiaus histograma t (8; 21) + Kasumi-1 ląstelėse ir sveikų iš donoro gautų žmogaus CD34 + ląstelėse, analizuota srauto citometrijos metodu. c ) PSGL-1 mRNR išraiškos lygiai paciento išvestose pirminėse leukemijos ląstelėse, remiantis mikrotraumos duomenų analize. 32 ( d ) PSGL-1 mRNR išraiška pacientų kilmės pirminėse leukemijos ląstelėse, suskirstytose į kariotipus. Duomenys rodomi kaip vidurkis ± sem

Visas dydis

RE sumažina PSGL-1 ekspresiją kraujodaros progenitorinėse ląstelėse

Norėdami suprasti, ar RE tiesiogiai reguliuoja PSGL-1, mes padidinome REtr reikšmę įvairiose hematopoetinėse progenitorinėse ląstelėse, pernešdami lentivirusinius vektorius. 4 dieną po transdukcijos PSGL-1 ekspresijos lygiai hematopoetinėse progenitorinėse ląstelėse buvo analizuojami naudojant srauto citometriją. REtr sumažino PSGL-1 ląstelių paviršiaus ekspresiją mobilizuotose žmogaus kraujodaros CD34 + pirmtakose, palyginti su makiažo būdu perduodamomis kontrolinėmis ląstelėmis (2a pav.). REtr taip pat sumažino PSGL-1 reguliavimą pelių, gautų iš neigiamos kaulų čiulpų, pirminės kraujodaros progenitoriaus (lin-mBM) ląstelėse ir nuo faktoriaus priklausomoje multipotencinėje FDCP-mix progenitorių ląstelių linijoje, esančioje neigiamose ląstelėse (2b ir c pav.) Panašiai, pilno ilgio RE slopino PSGL-1 ekspresiją lin-mBM ląstelėse (2d pav.). Šie duomenys kartu rodo, kad RE yra stiprus PSGL-1 ekspresijos hematopoetinėse progenitorinėse ląstelėse represorius. Mes kartu išreiškėme sustiprintą žalią fluorescencinį baltymą (eGFP) iš to paties konstrukto ir atidarėme ląsteles, ekspresuojančias eGFP žemu, vidutiniu ir aukštu lygiais, kad išaiškintume REtr dozės priklausomybę nuo PSGL-1 reguliavimo. Palyginti su tuščiomis vektorių perduotomis ląstelėmis, REtr išraiškos lygiai atvirkščiai koreliavo su PSGL-1 lygiais (2e paveikslas). Panašiai, nuo dozės priklausantis PSGL-1 sureguliavimas pagal REtr buvo stebimas ir pirminėse žmogaus CD34 + pirmtakose (papildomas 1 paveikslas). Toliau mes ištyrėme, ar RE reikalinga jos DNR surišimo funkcija PSGL-1 ekspresijai reguliuoti. Su DNR surišančiu-trūkusiu mutantu REtr (L148D) 33, 34 visiškai nepavyko sureguliuoti PSGL-1 FDCP-mišinio ląstelėse (2f pav.). Apskritai, mes nustatėme, kad RE sumažina PSGL-1 ekspresiją kraujodaros progenitorinėse ląstelėse priklausomai nuo DNR ir nuo dozės.

Image

PSGL-1 ekspresijos reguliavimas praturtintose kraujodaros progenitorinėse ląstelėse. PSGL-1 ekspresija a ) žmogaus pirminėse kraujodaros CD34 + progenitorinėse ląstelėse, b ) lin-mBM ląstelėse ir c ) FDCP mišinio ląstelėse, analizuota srauto citometrijos būdu 4 dieną po transdukcijos. d ) REG ir REtr ekspresuojančių lin-mBM ląstelių PSGL-1 lygiai 4 dieną po transdukcijos. ( e ) Po transdukcijos buvo nustatyti skirtingi eGFP ekspresijos lygiai FDCP-mišinio ląstelėse kaip 1, 2 ir 3 populiacijos. Išmatuoti PSGL-1 ekspresijos lygiai atitinkamose suvaržytose ląstelėse. Duomenys rodo reprezentatyvius rezultatus, gautus iš trijų eksperimentų. ( f ) Reprezentatyvi PSGL-1 ekspresijos histograma REtr (L148D) transdukuotų ląstelių su DNR rišančioje mutantinėje formoje. * P <0, 05. n = 3.

Visas dydis

RE sumažėjimas ir slopinimas sukelia visišką PSGL-1 pakartotinę ekspresiją t (8; 21) + Kasumi-1 ląstelėse.

Norint ištirti, ar RE slopinimas taip pat turi įtakos PSGL-1 ekspresijai transformuotoje nuo RE priklausomoje žmogaus leukemijos ląstelių linijoje, iš RE priklausomos ląstelių linijos Kasumi buvo išreikšta trumpa plaukų smeigtuko RNR (shRNR), palyginti su RE (shRE) 19 lūžio tašku . –1. Palyginti su kontrolinėmis ląstelėmis, išreiškiančiomis neatitinkančią kontrolinę RNR (scr), RE išeikvojimas visiškai atkūrė PSGL-1 lygį Kasumi-1 ląstelėse 4-ą dieną po transdukcijos, kaip pastebėta mobilizuotose CD34 + ląstelėse (3a pav.). PSGL-1 atnaujinimas įvyko per 24 valandas po lentivirusinio tarpininkavimo sukelto RE numušimo, laikui bėgant didėjant ląstelių paviršiaus ekspresijos lygiui (3b pav.). Kadangi RE tetramerizacija yra būtina jo onkogeninei funkcijai, mes panaudojome peptidų sukeltą RE tetramerizacijos pertraukimą. 34, 36 NLS pažymėtos NHR2 sekos buvo lentiškai antivirusinės. Siūloma, kad NHR2 peptidai prisijungtų prie RE NHR2 domeno, taip blokuodami RE molekulių oligomerizaciją ir slopindami jų transkripcines bei transformuojančias savybes. 34, 37 Iš tiesų, RE oligomerizacijos nutraukimas naudojant N89 peptidus taip pat panašiu mastu suaktyvino PSGL-1 ekspresiją Kasumi-1 ląstelių paviršiuje (3c ir d pav.), Taip dar labiau patvirtindamas supratimą, kad PSGL-1 yra tikslinis genas. iš RE.

Image

RE slopinimo poveikis PSGL-1 ekspresijai Kasumi-1 ląstelėse. a ) Teigiamų ląstelių, demonstruojančių ląstelių paviršiaus PSGL-1 raišką, histograma ir procentinė dalis, išanalizuota srauto citometrijos būdu Kasumi-1 ląstelėse, transduotuose su scramble kontrole (scr) ir shRNR, palyginti su RE lūžio taško regionu (shRE). ( b ) PSGL-1 ekspresijos ląstelių paviršiaus lygis laikui bėgant po shRE transdukcijos Kasumi-1 ląstelėse. ( c, d ) PSGL-1 ląstelių paviršiaus ekspresijos lygis Kasumi-1 ląstelėse, perduotuose lentivirusiniais vektoriais, išreiškiančiais kontrolinius peptidus (CP), N89 peptidus ir eGFP kaip žymeklį. Duomenys rodomi kaip vidurkis ± sem *** P <0, 001. n = 3.

Visas dydis

RE sąveikauja su PSGL-1 promotoriaus regionu ir sukelia epigenetines modifikacijas

Kadangi lentivirusinė RE slopinančių peptidų ekspresija sukėlė aukštą PSGL-1 mRNR lygį (4a paveikslas), mes toliau tyrėme ryšį tarp RE surišimo ir PSGL-1 ekspresijos ir ištyrėme PSGL-1 genomines sekas, ar nėra potencialaus RUNX1- rišimo motyvai (TGT / CGGT) silikone . Prie promotoriaus ir vidinėse srityse buvo identifikuotos keturios RUNX1 surišančių motyvų grupės (4b paveikslas; papildomas 3a paveikslas) kartu su Sp1 ir ETS transkripcijos faktorių surišančiais motyvais numatomame promotoriaus regione. ChIP sekos eksperimentai, naudojant ETO antikūną 31, patvirtino keletą RE jungimosi vietų, taip pat RUNX1 vietų, esančių prieš PSGL-1 genomo sekų 1 egzoną, kurios išnyko po RE numušimo (4c paveikslas). Šie duomenys buvo patikrinti rankomis ChIP, nustatant RE-surišimo motyvą PSGL-1 promotoriaus srityje esant –619 bp (1 klasteris; 4d paveikslas; papildomi 2 ir 3b paveikslai). Tarp kitų adhezijos molekulių PSGL-1 buvo nustatytas ir pirminiuose žmogaus t (8; 21) + AML pacientų mėginiuose (žr. Papildomą 4 paveikslą). 31, 35 Kadangi buvo įrodyta, kad RE sukelia epigenetinius pokyčius reprezentuojant tikslinius genus, 31 mes ištyrėme RE jungimosi vietas, ar nėra kelių aktyvių ir represinių histono žymių, įskaitant represinį H3K27me3 chromatino ženklą. Tai atskleidė H3K27 PSGL-1 promotoriaus trimetilinimą prieš 1 egzoną (4e pav.). SiRNR sąlygotas RE išeikvojimas padidino RUNX1 jungimąsiose RE jungimosi vietose kartu su histono acetiliacijos ir RNR POLII padidėjimu numatomame PSGL-1 promotoriaus regione (4c paveikslas; papildomas 3b paveikslas). Apskritai, mūsų duomenys rodo, kad RE jungiantis epigenetiškai slopina PSGL-1 raišką.

Image

Transkripcinis PSGL-1 ekspresijos reguliavimas Kasumi-1 ląstelėse. a ) PSGL-1 mRNR ekspresijos lygiai Kasumi-1 ląstelėse, perkeltose kontroliniais ir N89 peptidais, įvertinti kiekybine PGR. ( b ) Silico analizė rodo RUNX1 atpažinimo motyvus įvairiuose PSGL-1 geno sekų regionuose ir SP1 bei ETS transkripcijos faktorių atpažinimo motyvų buvimą PSGL-1 promotoriaus regione. ( b, viršuje) RUNX1 atpažinimo motyvo (TG T / c GGT) suderinimas su PSGL-1 geno promotoriaus sekomis. c ) ChIP sekos duomenys, rodantys RUNX1 ir RE sąveiką su PSGL-1 promotoriaus regionu. SiRNR tarpininkaujantis RE sureguliavimas palengvino RNRIIII jungimąsi ir H3K9ac ženklus PSGL-1 geno aukštupio srityje. ( d ) RE sąveika su numatomomis RUNX1 rišančiomis PSGL-1 geno grupėmis, išanalizuotos naudojant kiekybinę PGR, kuri amplifikavo gautą ChIP DNR, palyginti su RE jungiančia sritimi. ( e ) PS3L27 promotoriaus H3K27me3 modifikacija ištirta atliekant ChIP analizę. GAPDH promotoriaus sritis buvo naudojama kaip neigiama kontrolė, o 18 chromosomos heterochromatino sritis (hetero chr 18) kaip teigiama kontrolė. Duomenys rodomi kaip vidurkis ± sem * P <0, 05, *** P <0, 001.

Visas dydis

RE-išeikvotos Kasumi-1 ląstelės įgyja potencialą jungtis prie P- ir E-selektino esant šlyties įtampai

PSGL-1 yra pagrindinis P-selekto ligandas ir, mažesniu mastu, E-selektinas 20, bet ne L-selektas. Todėl mes ištyrėme RE inaktyvacijos pasekmes ląstelių adhezijai. N89 inhibitoriaus peptido transdukcija sąlygojo gilų Kasumi-1 ląstelių surišimo su P-selektinu dengtomis granulėmis ir, mažesniu mastu, E-selektinu, išmatuoto srauto citometrijos būdu, reguliavimą. Tačiau jokio jungimosi prie L-selelino nepastebėta (5a ir b pav.). Panašiai N89 ekspresuojančių Kasumi-1 ląstelių adhezija buvo labai padidinta ant P-selektino ir, mažesniu mastu, su E-selekinu dengtų paviršių (5c ir d pav.). Be to, esant šlyties įtempiui buvo įvertintas shRE ekspresuojančių Kasumi-1 ląstelių gebėjimas sąveikauti su P-selekinu padengtais paviršiais. Prieš pradedant eksperimentus, buvo patvirtinta tinkama PSGL-1 pakartotinė ekspresija ant shRE perduotų Kasumi-1 ląstelių paviršiaus (5e pav.). Iš tiesų, shRE apdorotų Kasumi-1 ląstelių valcavimo efektyvumas P-selekinu dengtame paviršiuje taip pat padidėjo esant šlyties įtempiui, esant 2 dynams / cm2, tuo tarpu kontrolinės ląstelės parodė tik silpną sąveiką arba jos visai neturėjo (5f pav.). Be to, shRE ekspresuojančios Kasumi-1 ląstelės buvo tvirtai sulaikytos po valcavimo ant P-selekinu dengtų paviršių (5g paveikslas), kas rodo stiprią shRE apdorotų Kasumi-1 ląstelių ir P-selektino sąveiką.

Image

Atkurto PSGL-1 funkcionalumas SHRE ir N89 apdorotose Kasumi-1 ląstelėse. a ) Kasumi-1 ląstelių, perkeltų CP arba N89 peptidais, jungimosi į P-, E- ir L-selektiną, histogramos, analizuojamos srauto citometrijos būdu ir ( b ) atitinkamų teigiamų ląstelių procentinė dalis. c ) CP ir N89 perkeltų Kasumi-1 ląstelių adhezija ant P, E ir L selekinu padengtų paviršių ir ( d ) atitinkamos kiekybinės vertės. ( e ) PSGL-1 ląstelių paviršiaus išraiškos lygiai skrambant (scr) - ir shRE perduodamose Kasumi-1 ląstelėse, analizuojami srauto citometrijos metodu. ( f ) shRE perduotų Kasumi-1 ląstelių valcavimo efektyvumas, po kurio g ) ląstelės sulaikomos ant P-selekino dengto paviršiaus, esant šlyties įtempiui (2 dynai / cm 2 ).

Visas dydis

Diskusija

Mūsų tyrimas prideda svarbių molekulinių detalių prie ankstesnių tyrimų, įrodančių, kad RE ekspresija kenkia adhezijos geno šeimos 17, 19 narių reguliavimui, aprašydama RE jungimosi pasekmes PSGL-1 reguliavimui , koduojantį į muciną panašų glikoproteiną. labai svarbus ląstelių sukibimui. Kartu su išvadomis, kad RE-ekspresuojančiose ląstelėse CD44 ir VLA-4 yra padidintas, o CD11a - sumažintas, tai rodo, kad adhezijos molekulės yra svarbūs taikiniai nustatant (8; 21) specifinį ląstelių fenotipą. Panašus adhezijos molekulės modelis yra labai mobiliuose ankstyvuosiuose kraujodaros mieloblastuose, normaliuose kaulų čiulpuose. CD44 yra plačiai reguliuojamas AML ir prisideda prie gydymo atkryčio, todėl buvo pasiūlytas kaip galimas terapinis taikinys. 17, 38 CD11a yra labai ekspresuojamas M4 ir M5 leukemijose, tuo tarpu nuo M0 iki M3 leukemijos išreiškia baltymą nuo žemo iki vidutinio lygio. 39 Panašiai buvo pasiūlyta PSGL-1 naudoti kaip žymeklį, skirtą atskirti įvairius AML tipus. 40 PSGL-1 taip pat yra susijęs su užkrūčio liaukų kraujodaros protėvių 41, 42 sureguliavimu , nes atrodo, kad RE raiška ir PSGL- 1 žeminimas yra nesuderinami su T-ląstelių pirmtakų prigimtimi prie užkrūčio ląstos, nepaisant to, kad mieloidinėse ląstelėse yra sulietas baltymas ir B ląstelės iš AML sergančių pacientų, turinčių t (8; 21), 43, rodančios, kad šio geno sumažėjęs reguliavimas turi dramatiškų padarinių ląstelių elgesiui, greičiausiai padidėjęs leukemijos ląstelių mobilumas. Laikantis šios idėjos, PSGL-1 yra nuolatos sureguliuojamas didelėje pirminių žmogaus AML M2 t (8; 21) + leukemijos ląstelių grupėje, palyginti su sveikų asmenų kaulų čiulpų ląstelėmis. Atliekant nepriklausomą genų ekspresijos analizę, PSGL-1 buvo ryškiausiai represuotas t (8; 21) + AML leukemijose, palyginti su įvairiais AML pogrupiais, suskirstytais pagal kariotipus, ir tai rodo, kad šio geno slopinimas gali būti pagrindinis šerdį rišančio faktoriaus leukemijų bruožas. . Iš tiesų nustatyta, kad PSGL-1 mRNR yra sureguliuota t (12; 21) + AML, išreiškiančiame sulietą baltymą TEL / RUNX1, kuris taip pat buvo apibūdinamas kaip dominuojantis RUNX1 taikomų genų transkripcijos represorius 44, kas rodo, kad šis sulieti baltymas tie patys cis- reguliavimo elementai.

Norėdami surišti P- ir E-selektinus, PSGL-1 reikalingi su šerdimi 2 O-sujungti glikanai, kurie yra sialinti ir fukosilinti. Įdomu tai, kad vienintelis PSGL-1 depresija buvo pakankamas jos sukibimo funkcijai, taigi, galima daryti prielaidą, kad PSGL-1 modifikuojantys komponentai buvo suaktyvinti RE-išeikvotų Kasumi-1 ir kraujodaros progenitorių ląstelėse. P- ir E-selektinai yra atsakingi už kraujodaros ląstelių adheziją prie endotelio ląstelių. 45 Įdomu tai, kad L-selektinas, kuris yra geriau ekspresuojamas ant leukocitų, nebuvo slopinamas sureguliuoto PSGL-1, slopinant RE. Šie stebėjimai rodo, kad RE + pirmtakai gali turėti mažesnį afinitetą kraujagyslių nišai kaulų čiulpuose.

Azabas ir kt. 18 pacientų nustatė padidėjusį PSGL-1 kiekį piktybinėse kraujodaros ląstelėse, gautose iš daugybinės mielomos pacientų, ir parodė, kad PSGL-1 vaidina lemiamą reikšmę daugybinių mielomos ląstelių išgyvenimui ir vystymuisi kaulų čiulpuose. Ši stromos sąveika lėmė ligos progresavimą ir atsparumą vaistams. Žemo lygio PSGL-1 ekspresija daro įtaką ankstyvųjų kraujodaros kamieninių ląstelių proliferacijos gebėjimams, nes adhezija P-selektinu slopina žmogaus hematopoetinių kamieninių ląstelių proliferaciją in vitro , kurią sukelia ankstyvieji veiksniai. 47 Be to, PSGL-1 turi įtakos kamieninių ląstelių tvirtinimui kaulų čiulpų nišoje. 48 Todėl REG sukelta PSGL-1 represija gali turėti įtakos kamieninių ląstelių ramumui, taip pat leukemijos įsiskolinimui. Tai rodo tyrimai su PSGL-1 trūkumu turinčiomis BCR / ABL ląstelėmis, kurių pelių persodinimo modelyje sutrinka įsisavinimo galimybė. 49 PSGL-1 trūkumas taip pat padidina kraujodaros progenitorinių ląstelių mobilizaciją į periferinį kraują 50, taigi galima teigti, kad RE sukeliamos PSGL-1 represijos sumažina ląstelių adheziją t (8; 21) + kraujodaros progenitorinėse ląstelėse kaulų čiulpuose. Tai iš dalies gali paaiškinti teigiamą pagrindą rišančių faktorių leukemijų reakciją į chemoterapinį gydymą.

Apibendrinant, mūsų duomenys rodo tiesioginį ryšį tarp RE jungimosi ir adhezijos molekulių raiškos modelio leukemijos ląstelėse, kurie turės diagnostinę reikšmę ir kaip biomarkeriai, ir taip pat vertinant šiuo metu kuriamus RE inhibitorius.

medžiagos ir metodai

Ląstelės, ląstelių kultūra, virusų gamyba ir virusų perdavimas

FDCP-mišinio ląstelės buvo kultivuojamos IMDM terpėje (PAA Lab, Colbe, Vokietija), papildytoje arklio serumu (Gibco, Darmštatas, Vokietija) ir pelių IL3 (10 ng / ml; R&D Systems, Wiesbaden, Vokietija). Kasumi-1 ląstelės buvo kultivuojamos RPMI terpėje (Gibco), papildytoje 20% FCS (blauzdos vaisiaus serumas; PAN Biotech, Aidenbach, Vokietija). Lin-mBM ląstelės buvo kultivuojamos „StemSpan“ terpėje („StemCell Tech“, Kelnas, Vokietija), papildytos pelių IL3 (10 ng / ml), pelių IL6 (50 ng / ml) ir pelių kamieninių ląstelių faktorių (50 ng / ml). Žmogaus CD34 + ląstelės buvo kultivuojamos „StemSpan“ terpėje, papildytoje žmogaus IL3 (10 ng / ml), žmogaus SCF (20 ng / ml), žmogaus IL6 (20 ng / ml), žmogaus FLT3L (20 ng / ml), žmogaus trombopoetino (20). ng / ml) ir žmogaus granulocitų – makrofagų kolonijas stimuliuojantis faktorius (20 ng / ml). Lentivirusinės dalelės buvo pagamintos naudojant kalcio fosfato bendrojo nusodinimo metodą. Trumpai tariant, 5, 8 × 106 HEK-293 T ląstelės buvo pasėtos į 10 cm2 audinių kultūros indą (Cellstar, Frickenhausen, Vokietija) ir inkubuotos 37 ° C temperatūroje sudrėkintame CO 2 inkubatoriuje. Kitą dieną buvo paruoštas ko-transfekcijos mišinys ir paskirstytas ląstelėms. Šviežia terpė buvo papildyta praėjus 6 valandoms po transfekcijos. Galiausiai viruso supernatantai buvo surinkti 48 valandas po transfekcijos. Tada viruso dalelės buvo perkeltos į ląsteles ant retronektino (50 μg / ml) dengtų ne audinių kultūros plokštelių.

Retrovirusiniai vektoriai ir shRNR prieš RE

Lentiviral LeGO vektoriai (//www.lentigo-vectors.de/vectors.htm), kurie kartu išreiškia eGFP kaip žymeklio geną, buvo aprašyti ankstesniame leidinyje. 19 Peptidų sukelta RE tetramerizacijos pertrauka buvo atlikta naudojant anksčiau aprašytą NHR2 inhibitoriaus peptidą. Neseniai buvo pademonstruotas shRNR veiksmingumas prieš RE lūžio taškų sekas. 19

Žmogaus CD34 + ir lin-mBM ląstelių išskyrimas

Bendros pelių kaulų čiulpų hematopoetinės ląstelės buvo surinktos iš 6-8 savaičių Bl6 pelių, kai jos buvo nužudytos per gimdos kaklelio dislokaciją anestezijos sąlygomis (izoflurano inhaliacija). Lin-mBM ląstelės buvo praturtintos naudojant pelių linijų išeikvojimo rinkinį (Miltenyi Biotec, Kelnas, Vokietija). Mobilizuotos žmogaus CD34 + kaulų čiulpų ląstelės buvo gautos iš sveikų donorų gavus jų informuotą sutikimą pagal institucinės peržiūros tarybos patvirtintą protokolą (DRK kraujo donorų tarnyba, Frankfurtas prie Maino, Vokietija). Be to, periferinio kraujo mononuklearinės ląstelės buvo išskirtos biocoll atskyrimu (Biochrom, Berlynas, Vokietija). Po to žmogaus CD34 + ląstelės buvo praturtintos naudojant MACS CD34 + ląstelių išskyrimo rinkinį (Miltenyi Biotec).

Srauto citometrija

Ląstelių paviršiaus adhezijos molekulių ekspresijai išanalizuoti buvo paruoštos 1 × 105 ląstelės 0, 5% galvijų serumo albumino (100 μl) ir inkubuotos su FcR bloku (2 μl) 10 minučių kambario temperatūroje. Po to ląstelės buvo du kartus plaunamos 1x PBS. Vėliau ląstelės buvo dažytos fluorescenciniais antikūnais (1 μl antikūno / 100 μl ląstelių suspensijos) ir inkubuojamos 30 min 4 ° C temperatūroje. Tada ląstelės buvo išplautos ir išmatuotos daugiaspalvio srauto citometrijos metodu. Duomenys buvo analizuojami naudojant FCS express ir „FlowJo“ programinę įrangą („Flowjo LLC“, Ashland OR) pagal instituto licenciją.

Kiekybinis PGR (qPCR)

PSGL-1 ekspresija mRNR lygiu buvo analizuojama naudojant kiekybinę PGR. Trumpai tariant, 105–106 ląstelių du kartus buvo plaunamos ledo šaltu 1x PBS ir centrifuguojamos esant 2000 aps./min., 4 ° C 5 minutes. Ląstelių granulės buvo surinktos ir perdirbtos, kad būtų galima visiškai išskirti RNR naudojant „RNasy“ rinkinį (Qiagen, Hilden, Vokietija). Vėliau gauta visa RNR 30 minučių buvo apdorota DNaze I 37 ° C temperatūroje. Po to fermentinė reakcija buvo inaktyvuota 10 minučių 65 ° C temperatūroje. Be to, 500 nR RNR buvo atvirkščiai perrašyta į cDNR 1 valandą 50 ° C temperatūroje, naudojant oligo-dT pradmenis ir viršesnį III atvirkštinę transkriptazę. Galiausiai, 5% transkribuotos cDNR buvo panaudota genų ekspresijos analizei per qPCR naudojant TaqMan reakcijos mišinius. Kiekvienam mėginiui buvo apskaičiuoti santykiniai mRNR ekspresijos lygiai: PSGL-1 ekspresijos lygių vidurkis, padalytas iš GAPDH ekspresijos lygių vidurkio.

Seleniną surišantis tyrimas, ląstelių sukimasis ir sulaikymas esant šlyties įtampai

Rekombinantinės P-, E- ir L-selektino žmogaus chimeros (3 μg / ml) buvo konjuguotos su biotinu (eBioscience, Frankfurtas, Vokietija), po to streptavidinu (BD Pharmingen, Frankfurtas, Vokietija). Transdukuotos Kasumi-1 ląstelės buvo inkubuotos su biotinu / streptavidinu konjuguotais selektais ir išanalizuotos dėl seleino jungimosi naudojant standartinį srauto citometrijos protokolą. Ląstelių adhezijai transdukuotos Kasumi-1 ląstelės buvo pasėtos ant P-, E- ir L-selektino (3 μg / ml) dengtų ne audinių kultūros plokštelių. Po 2 valandų inkubacijos 37 ° C temperatūroje, mes švelniai nuplauname ląsteles tris kartus 1x PBS. Tada priklijuotos ląstelės buvo kiekybiškai įvertintos. Transdukuotų Kasumi-1 ląstelių, susijusių su jos ligandu P-selektinu, valcavimo ir tvirto sulaikymo efektyvumas buvo įvertintas esant šlyties įtampai. Trumpai tariant, srauto kameros stikleliai buvo uždengti P-selektinu (5 μg / ml) 30 minučių kambario temperatūroje. Po to P-selekinu padengtas paviršius 10 minučių buvo inkubuotas su 2% galvijų serumo albuminu. Toliau 105 ląstelės buvo įšvirkštos į HBSS ++ terpę, kuri teka padengtu paviršiumi esant 2 dydžių / cm2 šlyties įtempiui tuo pačiu metu. Galiausiai buvo įvertintos valcavimo ir sulaikytų ląstelių, padengtų P-selekinu, paviršius.

ChIP ir ChIP sekos tyrimas

RE gebėjimas surišti DNR su PSGL-1 genu buvo įvertintas atliekant ChIP analizę. Trumpai tariant, buvo fiksuotos 107 Kasumi-1 ląstelės. Baltymų / DNR kompleksai buvo kryžminami, pridedant 0, 75% paraformaldehido. Po to sukryžiavimo reakcija buvo nutraukta naudojant 125 mM glicino. Vėliau ląstelės buvo lizuotos naudojant ChIP lizės buferį 45 minutes 4 ° C temperatūroje, po to, kai ląstelės buvo išplautos lediniame 1x PBS. Tuo tarpu 50 μl baltymo G granulių buvo užblokuotos 100x lašišos spermos vienos grandies DNR (1%) RIPA buferyje, esant 4 ° C, 30 min. Po ląstelių lizės ląstelės 2 minutes buvo ultragarsu apdorotos, kad chromatinas pasiskirtų iki mažesnio nei 1 kb dydžio. Tada 20–25 μg nukirpto chromatino buvo inkubuojami be rutuliukų kaip įvesties kontrolė arba su iš anksto užblokuotais G baltymo granulėmis, turinčiomis izotipą (3 μg), ETO (5 μg), RNR polimerazės II (2, 5 μg) arba H3K27me3 ( 2, 5 μg) antikūnai. Po vienos nakties inkubacijos 4 ° C temperatūroje granulės buvo surinktos po magnetiniu lauku. Tada ChIP DNR buvo eluuojama po chromatino grįžtamojo sukryžiavimo, naudojant ChIP eliuavimo buferį. RNR buvo skaidoma RNaze, o baltymai skaidomi proteinaze K. DNR buvo išskirta naudojant ChIP DNR išskyrimo rinkinį („Zymo research corp“, Freiburgas, Vokietija). Galiausiai, naudojant qPCR, išskirta DNR buvo amplifikuota PSGL-1 geno sekoms. Ct vertės buvo apskaičiuotos praturtinant raukšlę, palyginti su izotipo kontrolės arba įvesties vertėmis. Pirmyn (F) ir atvirkščiai (R) pradmenų sekos yra šios: 1 klasteris: ACCCTCACTTCTCTGGGTTCT (F), CACTCCATCCAGGTGTCACT (R); 2 klasteris: GCAACATGGTGAAACCTCGT (F), GAGTGCAGTGGCACAATCTC (R); 3 klasteris: ATAACTTGAGGCCAGGAGTTTG (F), CCGGGTTCAAGTGATTCTCC (R) ir 4 klasteris: CCCAGACCACATCTCTGTGA (F), GGTACATGTGGCCCTTGC (R). GAPDH ir heterochromatino 18 pradmenų sekos buvo aprašytos anksčiau. 31 ChIP-seq eksperimentams buvo naudojami anti-ETO antikūnai (Santa Cruz, sc-9737X, Santa Cruz Biotechnology, Wembley, UK). 31 RUNX1 antikūnas (Abcam, ab23980, Kembridžas, JK) atpažįsta RUNX1 C-galinį domeną, kurio nėra suliejimo baltyme. RE numušimas buvo archyvuotas naudojant siRNA. 32

AML mikro matricų rinkinio charakteristikos

Iš viso AMLCG-99 tyrimo (NCT00266136) metu buvo gydyti 533 pacientai, o M3-AMLCG tyrimo metu - 29 pacientai. 562 mikropaveikslėliai: 140 Affymetrix HGU 133 2.0 plus ir 422 A&B rinkinys. Buvo ištirta mažiausiai 20 metafazinių ląstelių, norint nustatyti normalaus kariotipo (CN-AML) diagnozę. Sudėtingas kariotipas buvo apibrėžtas kaip trijų ar daugiau chromosomų anomalijų buvimas nesant t (8; 21), inv (16), t (16; 16), t (15; 17), t (9; 11)., t (v; 11) (v; q23); inv (3), t (3; 3) arba t (6; 9). Išankstinio apdorojimo kaulų čiulpų mėginiai buvo paruošti po Ficoll gradiento centrifugavimo. Bendra RNR buvo ekstrahuota iš 562 kaulų čiulpų mėginių, kaip aprašyta anksčiau 51, ir išanalizuota naudojant Affymetrix HG-U133 A / B ir 2.0 bei oligonukleotidinius mikrotraumus (Affymetrix, Santa Clara, CA, JAV). Hibridizacija ir vaizdo gavimas vyko pagal oficialius „Affymetrix“ protokolus. Ląstelių rūšiavimas nebuvo atliekamas. Norėdami, kad zondai nustatytų anotaciją, mes naudojome pasirinktinius lustų apibrėžimo failus (CDF), pagrįstus „GeneAnnot 2.0“ versija, sinchronizuotą su „GeneCards“ 3.04 versija (galima rasti //www.xlab.unimo.it/GA_CDF/). Šie CDF sumažina bendrą zondo rinkinių (vienas zondo rinkinys kiekvienam genui) skaičių ir gali padidinti analizių specifiškumą pašalindami kryžminius hibridizuojančius zondus (zondus riboja sekos specifiškumas). Duomenų normalizavimas buvo atliktas naudojant tvirtą daugialypės terpės vidurkio metodą, kaip aprašyta anksčiau. 53 Į analizę buvo įtraukti tik 17 389 zondo rinkiniai, esantys tiek A, B, tiek 2.0 plus mikroschemose. Kai kurie zondo rinkiniai A, B mikroschemose paprastai turi mažesnį vidutinį signalo lygį ir aukštesnius sd nei atitinkami zondo rinkiniai „Plus 2.0“ mikroschemose. Norėdami pašalinti šį paketo efektą, atsirandantį dėl skirtingų mikroschemų konstrukcijų, mes atlikome antrą normalizavimą, naudodami empirinį Bajeso metodą.

Papildoma informacija

Vaizdo failai

  1. 1.

    1 papildomas paveikslas

  2. 2.

    2 papildomas paveikslas

  3. 3.

    3 papildomas paveikslas

  4. 4.

    Papildomas 4 paveikslas

    Papildoma informacija pridedama prie šio straipsnio „Oncogenesis“ tinklalapyje (//www.nature.com/oncsis)