Sec16a yra labai svarbus tiek įprastiniam, tiek netradiciniam cftr sekrecijai | mokslinės ataskaitos

Sec16a yra labai svarbus tiek įprastiniam, tiek netradiciniam cftr sekrecijai | mokslinės ataskaitos

Anonim

Dalykai

  • Baltymų transportas
  • Sekrecija

Anotacija

CFTR yra transmembraninis baltymas, kuris ląstelės paviršių pasiekia įprastu Golgi tarpininkaujamu sekrecijos keliu. Įdomu tai, kad „ER-to-Golgi“ blokada arba ER stresas skatina alternatyvų GRASP tarpininkavimą, „Golgi“ apeinant netradicinę prekybą laukinio tipo CFTR ir ligą sukeliančią ΔF508-CFTR, turinčią lankstymo ir prekybos defektų. Čia parodome, kad Sec16A, pagrindinis įprasto ER-Golgi transporto reguliatorius, vaidina kritinį vaidmenį per baltymų krovinių išvežimą iš ER netradicinės sekrecijos metu. Pradiniame genų nutildymo ekrane „Sec16A“ numušimas panaikino netradicinį laukinio tipo ir ΔF508-CFTR išsiskyrimą, kurį sukėlė ER-Golgi blokada, o kitų su COPII susijusių komponentų numušimas to nepadarė. Pažymėtina, kad netradicinio sekrecijos metu Sec16A buvo perskirstyta į ląstelių periferiją ir siejama su GRASP55 žinduolių ląstelėse. Molekulinės ir morfologinės analizės atskleidė, kad IRE1α sukelta signalizacija yra Sec16A priešakinis reguliatorius ER-Golgi blokados metu arba su ER stresu susijusi netradicinė sekrecija. Šie atradimai išryškina naują Sec16A, kaip pagrindinio tarpininko su ER su stresu susijusį netradicinį sekreciją, funkciją.

Įvadas

Cistinės fibrozės (CF) transmembraninio laidumo reguliatorius (CFTR) yra N-glikozilintas transmembraninis baltymas, turintis anijonų kanalo aktyvumą, kuris praleidžia chloridą ir bikarbonatą kvėpavimo takų, žarnyno, kasos ir egzokrininių liaukų sekretinio epitelio viršūniniame paviršiuje. Funkcijos praradimas CFTR yra susijęs su CF ir keliomis kitomis epitelio organų žmogaus ligomis, tokiomis kaip bronchektazė ir lėtinis pankreatitas 3, 4 . CFTR sintetinamas endoplazminiame retikulume (ER) ir pernešamas į ląstelės paviršių įprastu Golgi tarpininkaujamu sekrecijos keliu. Taigi, Golgi subrandintas, visiškai N-glikozilintas CFTR yra ekspresuojamas ląstelės paviršiuje 5 . Labiausiai paplitusi CFTR mutacija, sukelianti fenilalanino deleciją 508 padėtyje (ΔF508), sukelia netinkamą baltymo išsisklaidymą ir susilaikymą ER, dėl kurio atsiranda CFTR 6 ląstelių paviršiaus ekspresijos defektai. Dėl to nežymus ΔF508-CFTR kiekis pasiekia plazmos membraną, o ΔF508-CFTR išlieka branduolio glikozilinto nesubrendusio pavidalo ER 5 .

Įdomu tai, kad esant ER-Golgi blokadai ar ER-streso sąlygoms, šerdies glikozilinto laukinio tipo ir ΔF508 CFTR ER gali patekti į ląstelės paviršių netradiciniu Golgi surinkimo baltymų (GRASP) priklausomu keliu, kuris apeina Golgi. 7 Be to, buvo įrodyta, kad padidinus šį netradicinį sekrecijos kelią per GRASP55 per didelę ekspresiją, siekiama ištaisyti defektus, kuriuos sukelia ΔF508-CFTR pelių CF modelyje 7 . Tačiau molekuliniai mechanizmai, kuriais grindžiamas gelbėjimas, ypač iš ER išsaugoto, glikozilinto CFTR eksporto iš ER, išlieka sunkūs.

Normaliomis sąlygomis sekrecinių baltymų eksportą iš ER skatina tarp baltymų komplekso (COP) II dengtos pūslelės, kurios pumpuojasi iš konkrečių vietų ER membranoje, vadinamose ER išėjimo vietomis (ERES) arba pereinamuoju ER 8 . COPII surinkimas prasideda nuo Sec12 katalizuojamos mažos GTPazės Sar1 9 aktyvacijos, po to seka Sec23–24 dimerio ir Sec13–31 dimerio grotelių komplektacija, kad būtų suformuotas vidinis ir išorinis COPII sluoksnio sluoksniai, atitinkamai 10, 11 . Be šių pagrindinių COPII molekulių, Sec16 vaidina svarbų vaidmenį atliekant COPII tarpininkaujant baltymų krovinių išvežimą iš ER organizmuose, pradedant mielėmis ir žinduoliais. „Sec16“ yra didelis, periferinės membranos baltymas, glaudžiai susijęs su ERES. Siūloma tarpininkauti ERES biogenezėje ir veikti kaip atrama COPII surinkimui sąveikaujant su keliais COPII komponentais (Sec23, Sec24, Sec13 ir Sec31), taip pat su Sar1- GTPazė 12, 13, 14 . Du ortologiniai genai koduoja žmogaus Sec16 (Sec16A ir Sec16B), o tarp jų Sec16A yra pagrindinis ortologas, nes jis yra labiausiai panašus į kitų rūšių Sec16 baltymus (~ 240 KDa, dydžio).

Keletas ląstelių signalų reguliuoja COPII tarpininkaujamų baltymų pernešimą ir ERES generavimą moduliuodami Sec16. Pavyzdžiui, ERK-2 reguliuoja ERES skaičių moduliuodamas Sec16 fosforilinimą 15 . Be to, buvo nustatyta, kad inozitoliui būtinas fermentas 1 (IRE1), ER streso signalų keitiklis ir išskleisto baltymo atsakas (UPR) 16, reguliuoja Sec16A 17 . Esant baltymų perkrovai ER liumene, reaguojant į padidėjusią krovinių apkrovą, ERES skaičius padidėja kartu su Sec16A lygiu 17 . Visų pirma, IRE1 tarpininkaujant signalizacijai taip pat reikia netradicinės, su stresu susijusios CFTR 7 sekrecijos. Transporto iš ER į Golgi blokavimas gali būti vykdomas tiesiogiai slopinant COPII tarpininkaujantį vezikulinį transportą (pvz., Transfekcijai su dominuojančia ir neigiama Sar1 forma) arba netiesiogiai slopinant COPI tarpininkaujantį transportą (pvz., Transfekcijai su dominuojanti-neigiama Arf1 forma), suaktyvina ER stresą 18 ir sukelia netradicinį šerdies glikozilinto CFTR sekreciją per GRASP priklausomą mechanizmą žinduolių ląstelėse 7 .

Pradiniame RNR trukdžių (RNR) su COPII susijusių komponentų ekrane mes nustatėme, kad Sec16A numušimas panaikino netradicinį laukinio tipo ir ΔF508 CFTR išsiskyrimą, kurį sukėlė ER-Golgi blokada, o kitų su COPII susijusių komponentų numušimas padarė ne. Tada mes ištyrėme Sec16A vaidmenį netradicinio sekrecijos procese ir nustatėme, kad Sec16A yra kritinis komponentas ER su stresu susijusiose, GRASP tarpininkaujamuose netradiciniuose šerdies glikozilinto CFTR sekrecijose. Be to, mes nustatėme, kad IRE1 tarpininkaujama signalizacija yra Sec16A priešakinis reguliatorius ER streso sukeltos netradicinės sekrecijos metu. Mūsų rezultatai suteikia naujų įžvalgų apie pasaulinį „Sec16A“, kaip bendro tarpininko, įprasto ir netradicinio sekretorinių krovinių eksporto iš ER, vaidmenį.

Rezultatai

Sec16A reikalingas tiek įprastiniam, tiek netradiciniam CFTR sekrecijai

Laukinio tipo CFTR atliekamas Golgi tarpininkaujantis kompleksinis glikozilinimas, o kompleksiškai glikozilintas CFTR (1 pav., Juosta C) buvo išreikštas plazmos membranoje atliekant paviršiaus biotinilizacijos tyrimą (1a pav.). Kaip pranešta anksčiau 7, dominuojančio neigiamo Arf1-Q71L mutanto sukelta ER-Golgi blokada paskatino ER šerdies glikozilinto laukinio tipo CFTR ekspresiją ląstelių paviršiuje ir taip pat netradicinio baltymo ΔF508-CFTR trūkumą. sekrecija (1a – d pav., 3 juosta). Norėdami atmesti galimybę, kad šiuos rezultatus lėmė nespecifinis membranų baltymų internalizacijos slopinimas, mes pakartojome eksperimentus su dinaminų inhibitoriumi (dynasore) arba dominuojančiu-neigiamu dinamino mutantu (dinamin2-K44A), kurie, kaip buvo įrodyta, slopina internalizaciją. plazmos membranos baltymų, tokių kaip transferino receptorius ir CFTR 19, 20 . Kaip parodyta S1 paveiksle, nors šie gydymo metodai padidino transferino receptorių ir kompleksinio glikozilinto laukinio tipo CFTR ląstelių paviršiaus išraišką 40–80% (S1a pav., B), dynasoras ir dinamin2-K44A nepaveikė Arf1-Q71L. šerdies glikozilinto CFTR ekspozicija ląstelių paviršiuje ir ΔF508-CFTR indukuota ląstelių paviršiaus ekspozicija (S1b – d pav.).

Image

( a – d ) CFTR paviršiaus biotinilinimas paviršiuje. HEK293 ląstelės buvo transfekuotos plazmidėmis, ekspresuojančiomis laukinio tipo (WT) ( a, b ) arba ΔF508 CFTR ( c, d ), ir paviršiaus biotinizacijos tyrimas buvo atliktas praėjus 24 valandoms po transfekcijos. Kai kurios ląstelės buvo kotransfekuotos Arf1-Q71L plazmidėmis, kad sukeltų ER-Golgi blokadą. Ląstelės buvo iš anksto apdorotos iššifruotomis arba Sec16A specifinėmis siRNR (100 nM) 24 valandas prieš plazmidės transfekciją. Baltymų ląstelių paviršiaus specifinis žymėjimas buvo patvirtintas tuo, kad biotinilintoje frakcijoje nėra citozolinio baltymo aldolazės A. Parodyti tipiniai paviršiaus biotinilizacijos tyrimai ( a, c ), apibendrinti kelių eksperimentų rezultatai (n = 4) ( b, d ). „Sec16A“ numušimas panaikino įprastą „Golgi“ komplekso-glikozilinto WT-CFTR (C juosta) judėjimą ląstelių paviršiumi ir netradicinį „ER“ glikozilinto WT judėjimą ląstelių paviršiaus, taip pat „Arf1“ sukeltus ΔF508 CFTR (B grupė). -Q71L. ( e, f ) COPII sumažėjimo poveikis Arf1-Q71L sukeltai ΔF508-CFTR ląstelių paviršiaus raiškai. Kiekvienos izoformos individualus numušimo poveikis yra parodytas e punkte, o tos pačios genų šeimos kombinatorinio numušimo poveikis - f punkte. Apibendrinti daugelio eksperimentų (n = 3–7) rezultatai ir tipinių paviršiaus biotinilizacijos tyrimų vaizdai parodyti S2 paveiksle. „Sec16B“ ir pagrindinių COPII komponentų („Sec23“, „Sec24“, „Sec13“ ir „Sec31“) numušimas neturėjo įtakos netradiciniam ΔF508-CFTR ląstelių paviršiaus pernešimui. Sec16A ir COPII komponentų išeikvojimas siRNR buvo patvirtintas atlikus imunoblotus arba mRNR kiekybiškai (S3 pav.). Duomenys rodomi kaip vidurkis ± SEM. ns: nereikšmingas, ** P <0, 01.

Visas dydis

Tada mes ištyrėme su COPII susijusių komponentų vaidmenį netradicinėje ER sekrecijoje, naudodami RNAi ekraną HEK293 ląstelėse (1 pav. Ir S2 pav.). Pažymėtina, kad Sec16A išeikvojimas panaikino CFTR raišką ląstelės paviršiuje, kurį sąlygojo įprastiniai ir netradiciniai sekrecijos keliai. „Sec16A“ nutildymas maža trukdančia RNR (siRNR) sumažino kompleksinio glikozilinto CFTR ekspresiją paviršiuje (1a pav., 2 juosta 2). Be to, Sec16A išeikvojimas smarkiai sumažino netradicinį laukinio tipo CFTR raišką (1a pav., B, 4 juosta) ir taip pat trukdė Arf1-Q71L sukeltai ΔF508-CFTR raiškai ląstelių paviršiuje (1c pav. d, 4 juosta). Tačiau Sec16B ir pagrindinių COPII komponentų, tokių kaip Sec23, Sec24, Sec13 ir Sec31, išeikvojimas neturėjo įtakos netradiciniam ΔF508-CFTR ląstelių paviršiaus transportavimui (1 pav., F ir S2. Pav.). Imunoblotai ir mRNR kiekybinis nustatymas patvirtino RNR poveikį Sec16 ir pagrindinių COPII komponentų išeikvojimui (S3 pav.).

„Sec16A“ išeikvojimo poveikis CFTR ekspresijai ląstelių paviršiuje buvo toliau tiriamas naudojant imuninį dažymą žinduolių ląstelėse. Morfologinėms analizėms vietoj HEK293 ląstelių buvo naudojamos „HeLa“ ląstelės, nes jos tvirčiau prisitvirtina prie dangtelių, o tai apsaugo nuo ląstelių praradimo ir ląstelių formos išsidėstymo atliekant imunofluorescencines procedūras 21 . HeLa ląstelės buvo transfekuotos tarpląsteliniu HA pažymėtu laukinio tipo arba ΔF508 CFTR, kad būtų galima nustatyti ląstelės paviršiaus CFTR nepermeabilizuotomis sąlygomis. Kai kurios ląstelės buvo kotransfekuotos naudojant riboto BVP Sar1-T39N mutantą, kad būtų blokuojamas COPII tarpininkaujamas ER-Golgi transportas 22 . Kontrolinėse ląstelėse laukinio tipo CFTR buvo gausiai ekspresuojamas ant plazminės membranos (2a pav.), O sulankstytas-ΔF508-CFTR nepavyko pasiekti ląstelės paviršiaus (2b pav.). Sar1-T39N sukelta ER-Golgi transporto blokada sukėlė ΔF508-CFTR ląstelių paviršiaus išraišką (2c pav.). Pažymėtina, kad Sec16A išeikvojimas panaikino Sar1-T39N sukeltą netradicinę ΔF508-CFTR raiškos ląstelių paviršiaus išraiška (2d pav., E). Apibendrinant, rezultatai rodo, kad netradiciniam CFTR sekrecijai reikalingas Sec16A, bet ne pagrindiniai COPII komponentai.

Image

( a – d ) Tipiniai laukinio tipo (WT) arba ΔF508-CFTR imunofluorescenciniai vaizdai. Tarpląstelinės kilpos HA pažymėti WT ( a ) ir ΔF508 ( b – d ) CFTR buvo ekspresuojami HeLa ląstelėse. Prieš membranos permeabilizaciją (žalias) CFTR ląstelės paviršiuje buvo imuniškai apsaugotas anti-HA antikūnais, o po permeabilizacijos (raudona) bendras CFTR dažytas anti-R4 CFTR antikūnais. Kai kurios ląstelės kartu ekspresuoja „Myc-Sar1-T39N“, kad sukeltų netradicinę ΔF508-CFTR ( c, d ) išraišką. Sar1-T39N mutanto ekspresija buvo patvirtinta dažant anti-Myc. Ląstelės buvo iš anksto apdorotos iššifruotomis ( b, c ) arba Sec16A specifinėmis ( d ) siRNR (100 nM) 24 valandas prieš plazmidės transfekciją. Ląstelės, išreiškiančios Sar1-T39N, yra pažymėtos baltomis punktyrinėmis linijomis. Rodyklės rodo WT arba ΔF508 CFTR paviršiaus išraišką, o rodyklių galvutės nurodo ląsteles, kurios neišreiškia paviršiaus CFTR. e ) paviršiaus CFTR intensyvumo kiekybinis įvertinimas. Duomenys parodomi kaip trijų SEM iš trijų nepriklausomų eksperimentų vidurkis ± SEM (kiekvienas apima 20–30 ląstelių analizę). „Sec16A“ išeikvojimas panaikino Sar1-T39N sukeltą ΔF508-CFTR ląstelių paviršiaus ekspresiją. Masto juosta: 10 μm, ** P <0, 01.

Visas dydis

Atsižvelgiant į išvadą, kad vien GRASP55 per didelis ekspresas buvo pakankamas, kad suaktyvintų ΔF508-CFTR 7 transportą ant paviršiaus, mes paklausėme, ar Sec16A dalyvauja GRASP padidintos ekspresijos sukeltoje netradicinio sekrecijos kelyje. Mes kotransfekavome HEK293 ląsteles trimis skirtingais plazmidėmis, ekspresuojančiomis GRASP55 (Myc-GRASP55, Myc žymėjimas NAS gale GRASP55; GRASP55-Myc, Myc žymėjimas GRASP55 C gale; ir GRASP55 be jokios žymės), kurios buvo parodyta, kad gelbsti ΔF508-CFTR 21 ląstelės paviršiaus išraišką. „Sec16A“ išeikvojimas siRNR reikšmingai sumažino ΔF508-CFTR srautą paviršiuje, kurį sukėlė visų trijų GRASP55 formų per didelis ekspresas (S4 paveikslas), ir tai rodo, kad „Sec16A“ reikalingas GRASP tarpininkaujant netradiciniam ΔF508-CFTR sekrecijai.

„Sec16A“ kolokalizuojasi ir asocijuojasi su GRASP su ER su stresu susijusios netradicinės sekrecijos metu

Toliau mes ištyrėme ryšį tarp Sec16A ir ląstelės paviršiaus CFTR ekspresijos, sukeltos ER-Golgi blokados, kad toliau nustatytume Sec16A vaidmenį netradiciniame sekrecijoje. Arf1-Q71L sukelta ER-Golgi pernešimo blokada paskatino ΔF508-CFTR ekspresiją ląstelės paviršiuje HeLa ląstelėse (3a, b pav.). Įdomu tai, kad Arf1-Q71L pakeitė Sec16A viduląstelinę lokalizaciją. Kontrolinėse ląstelėse Sec16A buvo būdinga ERES lokalizacija, kurioje Sec16A puncta daugiausia buvo sukoncentruota juxtanuclear srityje (3a pav. Ir HA neigiamos ląstelės 3c pav.; Rodyklių galvutės). Tačiau kai Arf1-Q71L blokavo ER-Golgi transportą, Sec16A išsisklaidė į periferinius regionus, o Sec16A puncta pasirodė> 80% citoplazmos srities (3b – d pav., Rodyklės). Šie rezultatai yra palyginami su naujausiu atradimu, kad GRASP ER perkėlimas yra būtina sąlyga netradiciniam CFTR 21 sekrecijai.

Image

( a, b ) Intraląstelinė Sec16A lokalizacija buvo analizuojama naudojant imunocitochemiją. HeLa ląstelės buvo transfekuotos plazmidėmis, ekspresuojančiomis tarpląstelinę kilpą, pažymėtą HA-pažymėtu ΔF508-CFTR, su Arf1-Q71L arba be jo. Prieš membranos permeabilizaciją (žalias) CFTR ląstelės paviršiuje buvo imuniškai apsaugotas anti-HA antikūnais. Tada visas CFTR buvo nudažytas anti-M3A7 CFTR antikūnais (pilkaisiais), o Sec16A nudažytas anti-KIAA0310 Sec16A antikūnais (raudona spalva). Kontrolinėse ląstelėse ( a ) Sec16A puncta dažniausiai buvo lokalizuota juxtanuclear srityje (rodyklės galvutė). ( b ) Arf1-Q71L sukelta ER-Golgi blokada sukėlė ΔF508-CFTR (žalia) raiškos paviršiaus išraišką ir Sec16A persiskirstymą visame ląstelės plote (rodyklės, raudonos). ( c, d ) Sec16A perskirstymas ląstelėse, kurios ekspresuoja HA-Arf1-Q71L (balta punktyrinė linija), buvo palygintas su ląstelėmis, kurios neišreiškė HA-Arf1-Q71L. Parodyti reprezentatyvūs imunofluorescenciniai vaizdai ( c ) ir apibendrinti daugelio eksperimentų (n = 5, kiekviename analizuojant 5–10 ląstelių, ** P <0, 01) rezultatai ( d ). Masto juosta: 5 μm, ** P <0, 01.

Visas dydis

Todėl norėdami ištirti Sec16A ir GRASP55 ryšį, mes ištyrėme GRASP55 ir Sec16A ląstelių lokalizaciją. Endogeninis GRASP55 ir žemas GRASP55-Myc lygis, kuris nesukelia netradicinės sekrecijos (S5a pav.), Buvo išreikšti tipiniame perinukleariniame Golgi aparate, o Sec16A teigiamas ERES buvo praturtintas aplink tą regioną, kad būtų lengviau pernešti ER-Golgi ( 4a, b pav. Pažymėtina, kad „HeLa“ ląstelėse, kuriose yra aukštas GRASP55-Myc ekspresijos lygis, kuris sukelia netradicinį ΔF508-CFTR sekreciją (S5b pav.), „Sec16A puncta“ ir GRASP55 buvo žymiai perskirstytos į visą ląstelės plotą (4c pav., Rodyklės). Vėlesnės imunofluorescencinės kolokalizacijos analizės, įvertinančios tiek persidengiančio ploto procentą, tiek pikselių kolokalizacijos koreliaciją tarp Sec16A ir ER žymeklių, parodė, kad perkeltos Sec16A puncta buvo labai colocalized su ER žymeklio baltymais, kas rodo, kad Sec16A persikėlė į periferinę ER sritį (5 pav. ). Periferinis Sec16A lokalizavimas padidino Manderso kolokalizacijos koeficientą (MCC) dėl padidėjusio bendro incidento koeficiento tarp Sec16A frakcijų ir ER žymenų baltymų (5c pav., G).

Image

( a – c ) Sec16A pasiskirstymas ląstelėse buvo tiriamas naudojant imunocitochemiją. HeLa ląstelės buvo transfekuotos maketais arba GRASP55-Myc plazmidėmis. Parodyti reprezentatyvūs imunofluorescenciniai vaizdai. Perinukleariniame Golgi aparate buvo išreikštas endogeninis GRASP55 ( a ) ir žemas GRASP55-Myc ( b ) lygis, kuris nesukelia netradicinės sekrecijos (S5a pav.), O Sec16A buvo praturtintas aplink tą regioną. Priešingai, „Sec16A puncta“ ir „GRASP55“ buvo perskirstytos į visą ląstelių plotą ląstelėse, turinčiose aukštą GRASP55-Myc išraiškos lygį ( c ), o tai sukelia netradicinį ΔF508-CFTR sekreciją (S5b paveikslas). d ) Apibendrinamas Sec16A (+) ploto ir viso ląstelių ploto santykio kiekybinis įvertinimas keliuose eksperimentuose (vidurkis ± SEM, n = 5, kiekviename iš jų yra 5–10 ląstelių analizė). Masto juosta: 10 μm, ** P <0, 01: skirtumas nuo kontrolinės.

Visas dydis

Image

( a – c ) Sec16A pasiskirstymas ląstelėse buvo tiriamas naudojant imunocitochemiją HeLa ląstelėse. Ląstelės buvo transfekuotos plazmidėmis, koduojančiomis ER žymens baltymą ER-geltonai fluorescenciniu baltymu (ER-YFP) su Arf1-Q71L arba be jo. Parodyti reprezentatyvūs imunofluorescenciniai vaizdai ( a, b ) ir apibendrinti kelių eksperimentų rezultatai ( c ). Analizės naudojant Manderso kolokalizacijos koeficientą (MCC) rodo, kad Arf1-Q71L sukelta ER-Golgi blokada padidino koreliacijos laipsnį tarp ER-YFP ir Sec16A ( c ; vidurkis ± SEM, n = 6, kiekviena apima 5–10 analizę). ląstelės). ( d – g ) Ląstelės buvo transfekuotos modeliu ( d ), GRASP55-Myc ( e ) arba Myc-Sar1-T39N plazmidais ( f ), o ER žymens baltymas kalnexinas buvo ištirpintas kartu su Sec16A. GRASP55-Myc ir Myc-Sar1-T39N buvo imunizuoti su anti-Myc antikūnais. Parodyti reprezentatyvūs imunofluorescenciniai vaizdai ( d – f ), apibendrinti kelių eksperimentų rezultatai ( g ). Balta punktyrinė linija rodo GRASP55-Myc arba Sar1-T39N ekspresuojančių ląstelių periferiją. Rodyklės rodė Sec16A persiskirstymą visame ląstelių plote ER-Golgi blokada arba GRASP55 perdėta ekspresija. MCC analizė rodo, kad GRASP55 per didelis ekspresas ir Sar1-T39N blokada ER-Golgi padidino koreliacijos laipsnį tarp kalneksino ir Sec16A ( g ; vidurkis ± SEM, n = 6, kiekviena apima 5–10 ląstelių analizę). Masto juosta: 10 μm. ** P <0, 01: skirtumas tarp kiekvienos kontrolės.

Visas dydis

Kadangi Sec16A ir GRASP55 parodė panašią ląstelių lokalizaciją, mes toliau nagrinėjome jų tarpląstelinę lokalizaciją, sukėlę netradicinę sekreciją. Endogeniniai GRASP55 ir Sec16A HeLa ląstelėse buvo pažymėti antikūnais, pažymėtais fluoroforu. Kontrolinėse ląstelėse, nors ir GRASP55, ir Sec16A buvo praturtinti juxtanuclear regionuose, atlikus didesnius padidinimus, paaiškėjo, kad GRASP55 ir Sec16A dažniausiai buvo atskiruose regionuose (6a pav.). Be to, ląstelių periferijoje esančioje „Sec16A puncta“ visiškai nebuvo GRASP55 (6a pav.). Stimulai, sukeliantys netradicinį sekreciją, tokie kaip ER stresas ir ER-Golgi blokada, reikšmingai perskirstė ir kolokalizavo Sec16A ir GRASP55. Gydymas thapsigarginu, kuris sukelia ER stresą, sunaikindamas Ca 2+ atsargas ER liumenyje, ir kartu su Arf1-Q71L ar Sar1-T39N, sukeliančiu ER-Golgi blokadą, kartu pasiskirsto GRASP55 iš juxtanuclear srities į visą ląstelių plotą, žymiai padidindamas bendrą GRASP55 kolokalizaciją su Sec16A puncta, ypač periferiniuose regionuose (6b – e pav.). Elektronų mikroskopija taip pat patvirtino išvadą, kad Arf1-Q71L sukelta ER-Golgi blokada perskirstė Golgi baltymą GRASP55 iš Golgi į ER, kur lokalizuota Sec16A (S6 pav.).

Image

( a – d ) Sec16A ir GRASP55 ląstelių lokalizacija buvo išanalizuota naudojant imunocitochemiją HeLa ląstelėse. Parodyti reprezentatyvūs imunofluorescenciniai vaizdai. Endogeninis GRASP55 buvo pažymėtas antikūnais, pažymėtais fluoroforu (žaliaisiais), o Sec16A - etikūnais, pažymėtais fluoroforu (raudonais). Kai kurios ląstelės buvo kotransfekuotos Arf1-Q71L ( c ) arba Sar1-T39N ( d ), kad būtų sukelta ER-Golgi blokada. ER streso (thapsigargin) ( b ) arba ER-Golgi blokados (Arf1-Q71L arba Sar1-T39N) indukcija padidino Sec16A ir GRASP55 kolokalizaciją perinukleariniame (žaliojoje dėžutėje) ir periferiniame (raudoname langelyje) regionuose. . ( e ) Manderso kolokalizacijos koeficiento (MCC) analizė parodė, kad ER stresas (thapsigarginas) ir ER-Golgi blokada (Arf1-Q71L arba Sar1-T39N) reikšmingai padidino koreliacijos laipsnį tarp Sec16A ir GRASP55 tiek perinukleariniame, tiek branduoliniame. periferiniai regionai (vidurkis ± SEM, n = 5, kiekviena apima 5–10 ląstelių analizę). ( f, g ) HEK293 ląstelėse buvo atlikti ko-imunoprecipitacijos eksperimentai su Sec16A ir GRASP55. Parodytas reprezentatyvus koimunoprecipitacijos tyrimas ( f ), apibendrinti kelių eksperimentų rezultatai (n = 3) ( g ). Baltymų mėginiai buvo nusodinti anti-Sec16A (KIAA0310) ir užpūsti anti-GRASP55. Arf1-Q71L sukelta ER-Golgi blokada padidino ryšį tarp Sec16A ir GRASP55. Mastelio juosta: 10 μm, ** P <0, 01: skirtumas tarp kiekvienos valdiklio.

Visas dydis

Norėdami išsiaiškinti platformos Sec16A vaidmenį GRASP tarpininkaujant netradicinės prekybos kelyje, mes atlikome imunoprecipitacijos testą, kad įvertintume baltymų ir baltymų sąveiką tarp GRASP55 ir Sec16A. HEK293 ląstelėse, perkeltose į veidą plazmidėmis, endogeninės GRASP55 ir Sec16A sąveika kontrolės sąlygomis buvo minimali. Pažymėtina, kad sąveika tapo daug stipresnė, kai Arf1-Q71L sukėlė ER-Golgi blokadą (6f pav., G). Apibendrinant, rezultatai rodo, kad ER stresas ir ER-Golgi blokada palengvina didelių kompleksų, turinčių GRASP55 ir Sec16A, surinkimą.

„ER-to-Golgi“ blokada ir GRASP55 perdėta raiška neperkelia Sec31A, pagrindinio COPII komponento.

Norėdami nustatyti, ar Sec16A perkėlimas per GRASP perraišką ar ER-Golgi blokada yra apibendrintas COPII mechanizmų reiškinys, mes ištyrėme subsekuliarinę Sec31A, reprezentuojančio COPII subvienetą, lokalizaciją (7 pav.). Vėlgi, didelis GRASP55 ekspresijos lygis arba Sar1-T39N sukelta ER-Golgi blokada pakeitė Sec16A puncta į> 80% viso HeLa ląstelių paviršiaus, tuo tarpu tik ~ 20% ląstelių ploto buvo Sec16A teigiamas. kontrolinės ląstelės. Priešingai, nei GRASP55 raiška, nei Arf1 ir Sar1 mutantų blokada ER-Golgi reikšmingai nepakeitė Sec31A pasiskirstymo. Morfometrinis kiekybinis įvertinimas parodė, kad Sec31A liko ~ 15% viso ląstelių ploto, turinčio GRASP55 perraišką arba Sar1-T39N (7 pav.). Įdomu tai, kad Sec31A pasiskirstymą ląstelėse, atrodo, sumažino ER-Golgi blokada, ypač Sar1-T39N, nors pokytis nebuvo statistiškai reikšmingas (7c – e pav.). Derinant su γ-tubulinu, paaiškėjo, kad Sec31A labai susikoncentravo mikrotubulų minusiniuose galuose, vadinamuose centrosoma arba mikrotubulus organizuojančiu centru (MTOC; S7 pav.). Be to, Sec24, kito pagrindinio COPII komponento, pasiskirstymui taip pat nepaveikė ER-Golgi blokada (S8 pav.). Rezultatai rodo, kad GRASP tarpininkaujant netradicinėms pūslelėms susidaro kartu su ERES organizatoriaus / reguliatoriaus baltymu Sec16A, tačiau jis nepriklauso nuo pagrindinių COPII komponentų.

Image

( a – d ) Sec31A, pagrindinio COPII komponento, ląstelių lokalizacija buvo palyginta su Sec16A lokalizavimu, naudojant imunocitochemiją HeLa ląstelėse. Parodyti reprezentatyvūs imunofluorescenciniai vaizdai. Kai kurios ląstelės buvo kotransfekuotos GRASP55-Myc ( b ), Arf1-Q71L ( c ) arba Sar1-T39N ( d ), kad sukeltų Sec16A perskirstymą. e ) Apibendrinamas Sec16A (+) arba Sec31A (+) ploto santykis su visu ląstelių plotu, atliktu keliuose eksperimentuose (vidurkis ± SEM, n ≥ 5, kiekvienas apima 5–10 ląstelių analizę). GRASP55 per didelė ekspresija, Arf1-Q71L arba Sar1-T39N sukelta ER-Golgi blokada reikšmingų Sec31A lokalizacijos pokyčių nepadarė. Mastelio juosta: 10 μm, ** P <0, 01: skirtumas tarp kiekvienos valdiklio.

Visas dydis

IRE1α reguliuoja netradicinį ΔF508-CFTR sekreciją per Sec16A moduliaciją

Įrodyta, kad IRE1 perduodamas signalizavimas, reikalingas netradiciniam ΔF508-CFTR 7 sekrecijai su ER streso ir GRASP tarpininkavimu, skatina Sec16A negeneraciją ir padidina ERES skaičių ir dydį, kad palengvintų baltymą. našta ER metu lėtinio sekretorinių krovinių perkrovos metu 17 . Todėl mes toliau ištyrėme IRE1 vaidmenį Sec16A tarpininkaujant netradicinei sekrecijai. Kaip parodyta 8a, b pav., IRE1α sunaikinimas siRNR stipriai slopino Arf1-Q71L sukeltą ΔF508-CFTR paviršiaus ekspresiją HEK293 ląstelėse, tačiau papildymas egzogenine Sec16A išgelbėjo mutanto Arf1, kuris sukėlė ląstelės paviršiaus ekspresiją, poveikį. ΔF508-CFTR. Be to, atsižvelgiant į mutanto Arf1 rezultatus, GRASP55 sukeltas ΔF508-CFTR gelbėjimas buvo slopinamas IRE1 nutildymu ir atsigavo papildžius Sec16A (8c pav., D). Imunocitochemijos rezultatai dar labiau patvirtino nuostatą, kad IRE1 yra priešakinis Sec16A ekspresijos ir lokalizacijos reguliatorius netradicinės sekrecijos metu. IRE1α išeikvojimas sumažino bendrą Sec16A ekspresijos lygį HeLa ląstelėse, o padidėjęs Sec16A teigiamas plotas, atsirandantis dėl Arf1-Q71L ar GRASP55 perkaitimo, buvo sumažintas nuo 91% iki 19% (9 pav.).

Image

( a, c ) CFTR paviršiaus biotinilinimas buvo atliktas HEK293 ląstelėse po to, kai Arf1-Q71L ( a ) sukėlė netradicinę ΔF508-CFTR sekreciją, arba naudojant GRASP55 per didelę ekspresiją. ( c ) Ląstelės buvo iš anksto apdorotos suplaktomis arba IRE1α specifinėmis siRNR (100 nM) 24 valandas prieš plazmidės transfekciją. ( b, d ) Apibendrinti daugelio eksperimentų rezultatai (n = 3). IRE1α sunaikinimas siRNR slopino Arf1-Q71L sukeltą arba GRASP55 sukeltą ΔF508-CFTR paviršiaus ekspresiją. Papildymas išoriniu Sec16A išgelbėjo Arf1-Q71L ir GRASP55, kurie sukėlė ΔF508-CFTR ląstelių paviršiaus ekspresiją, poveikį. ** P <0, 01.

Visas dydis

Image

( a – d ) Sec16A ląstelių lokalizacija buvo išanalizuota naudojant imunocitochemiją kontroliuojamose HeLa ląstelėse ( a, b ) ir ląstelėse po to, kai Arf1-Q71L sukėlė netradicinį ΔF508-CFTR sekreciją ( c, d ). Ląstelės buvo iš anksto apdorotos suplaktomis arba IRE1α specifinėmis siRNR (100 nM) 24 valandas prieš plazmidės transfekciją. Tarpląstelinis Sec16A pasiskirstymas ląstelėse, kuriose trūko IRE1α, buvo analizuojamas naudojant konfokalinius vaizdus, ​​padarytus su penkis kartus didesniu gavimo padidėjimu (Gain X5), nes IRE1α sumažėjimas sumažino bendrą Sec16A ekspresijos lygį ( b, d ). e ) Apibendrinami kelių eksperimentų (n ≥ 5, kurių kiekvienas apima 5–10 ląstelių analizę) rezultatai. IRE1α išeikvojimas slopino Arf1-Q71L sukeltą Sec16A perskirstymą. Masto juosta: 10 μm, ** P <0, 01: skirtumas nuo kontrolinės.

Visas dydis

Diskusija

Dauguma membranų ir sekrecinių baltymų išeina iš ER, rūšiuodami krovinius ir formuodami COPII padengtas pūsleles konkrečiose ER membranos vietose, vadinamose ERES, ir nukreipia į Golgi kompleksą, o vėliau - į plazmos membraną 8, 23 . Be šio gerai apibrėžto įprastinio prekybos keliu, naujausi įrodymai rodo, kad daugelis citozolinių, branduolinių, sekrecinių ir membraninių baltymų pasiekia ląstelės paviršių netradiciniais sekrecijos keliais, kurie apeina „Golgi 24“ . Apskritai, netradiciniai sekrecijos atvejai nėra pagrindiniai, o sukelia stresą. Ląstelinio streso signalai, tokie kaip uždegimas, badas, mechaninis stresas vystymosi metu ir ER stresas, gali sukelti netradicinį citoplazmos ir membranos baltymų sekreciją 7, 25, 26 . Tačiau vis dar nėra iki galo išaiškinti netradicinių kelių mechanizmai ir molekuliniai komponentai, ypač tai, kaip sekretoriniai kroviniai išeina iš ER. Pateikiame įrodymų, kad Sec16A dalyvauja ER išstūmime iš ER su stresu susijusios netradicinės sekrecijos žinduolių ląstelėse.

„Sec16A“ reikalavimas netradicinei CFTR ekspresijai paviršiuje yra gana stebinantis, nes „Sec16A“ yra laikoma viena iš kritinių molekulių įprastame ER – Golgi pernešime, o ER – Golgi pernešimo slopinimas apskritai suaktyvina netradicinį sekreciją. Žinduose esantis Sec16A yra didelis hidrofilinis baltymas, glaudžiai susijęs su ERES ir yra būtinas indėlis organizuojant ERES 27 ir COPII tarpininkaujantį ER eksportą 28, 29 . CO1II funkcijos slopinimas Sar1-T39N sukelia netradicinį CFTR sekreciją, o ne slopina (2c pav.). Skirtingai nuo Sar1 (2c pav.) Ir pagrindinių COPII komponentų (1e pav. Ir S2 pav.), „Sec16A“ nutildymas slopino netradicinį CFTR sekreciją, kurią sukėlė ER – Golgi blokada arba GRASP55 perdėta ekspresija (1, 2 pav. ir S2 ir S4 paveikslai). Šie rezultatai rodo, kad „Sec16A“ yra pasaulinis ER eksporto organizatorius arba reguliatorius, kurio vaidmuo neapsiriboja įprastiniu COPII tarpininkavimo keliu.

Iš pradžių Sec16 buvo nustatytas kaip potencialus veiksnys, lemiantis COPII pūslelių pumpuravimą mielėse 14 . Vėliau sekos Sec16 analogai buvo rasti kitose rūšyse ir įrodyta, kad jie gali dalyvauti COPII tarpininkaujant tų organizmų krovinių baltymų ER išėjimui. Tačiau vis dar nėra iki galo nustatytas konkretus ir tikslus Sec16 vaidmuo COPII tarpininkaujamame transporte. Pavyzdžiui, Stephens et al . pasiūlė, kad „Sec16“ yra pagrindinis COPII pūslelių organizatorius, kuris nustato ERES lokalizaciją ir stechiometriniu būdu įdarbina pagrindinius COPII komponentus 27, 30. Priešingai, Glickas ir kt . pasiūlė, kad Sec16A reguliuoja COPII apyvartą ir atitinkamai daro įtaką ERES stabilumui, užuot organizavęs COPII pūslelių formavimąsi 31 . Nors vyksta diskusijos dėl to, ar „Sec16“ įdarbina COPII į ERES, ar atvirkščiai, tačiau visuotinai sutariama, kad „Sec16“ asocijuojasi su pagrindiniais COPII komponentais ir yra reikalingas eksporto vietos surinkimui ir funkcijai 32 . Mūsų rezultatai rodo, kad Sec16 taip pat reikalingas COPII nepriklausančiam ER sekrecinių krovinių išėjimui. Atsižvelgiant į „Sec16“ pastolių vaidmenį, bus įdomu nustatyti „Sec16A“ jungiančius partnerius ER streso arba „ER-to-Golgi“ blokados metu. Tokie tyrimai turėtų padėti mums suprasti molekulinius komponentus ir bendrą netradicinio baltymo sekrecijos ERES vaizdą.

Svarbus šio tyrimo pastebėjimas yra „Sec16A“ perkėlimas. Buvo pranešta, kad Drosophila lervos raumenų ląstelėse dGRASP dalys kolokalizuojasi su Sec16 ir dalyvauja integrino subvieneto αPS2 ER išeityje. Tačiau neaišku, ar dGRASP ir Sec16 tarpininkauja netradiciniame αPS2 sekrecijoje Drosophila. Be to, dGRASP ir Sec16 yra praturtinti aplink branduolį Drosophila raumenų ląstelėse αPS2 sekrecijos metu 33 . GRASP55 ir Sec16A, priešingai, persikelia į ląstelių periferiją ir tarpininkauja netradiciniame CFTR sekrecijoje, kai žinduolių ląstelėse atsiranda ER stresas arba ER-Golgi blokada (3, 4, 5, 6 ir 9 pav.). Pabrėžtina, kad pagrindinis COPII komponentas Sec31 tokiomis sąlygomis nepersikėlė (7 pav.). Vietoj to, kad išskaidytų Sec31, Sar1-T39N, atrodo, sukėlė Sec31 perėjimą prie labiau centrinio pasiskirstymo, palyginti su MTOC (S7 pav.). Tai rodo, kad yra signalas, kuris skatina Sec31 persikėlimą į minusinius mikrotubulų galus stiprių ER-to-Golgi blokada. ER-Golgi sąsaja ir ERES yra sukoncentruotos juxtanuclear regione, greta MTOC. Iš ERES nutolę COPII pūsleliai iš pradžių keliauja link minusinių mikrotubulų galų, kurie perveža krovininius baltymus į tarpinį ER-Golgi skyrių, o galiausiai į Golgi 32 . Po perdirbimo Golgi mieste, sekreciniai kroviniai palieka trans-Golgi tinklą ir vezikulinio judėjimo būdu keliauja link mikrotubulų viršutinių galų, kad pasiektų ląstelės paviršių. Periferinis Sec16 puncta judėjimas kelia galimybę, kad ER streso signalai atskiria Sec16A nuo pagrindinių COPII komponentų, gabendami Sec16A link mikrotubulų pliusinių galų. Netradicinis CFTR sekretas, kurį sukelia ER stresas ir ER-Golgi blokada, yra jautrus N-etilmaleimidui (NEM) ir nokodazolui 7, tai rodo, kad jam reikalingas vezikulinis judėjimas per mikrotubules. Periferinis Sec16A ir ERES lokalizavimas dėl netradicinės sekrecijos galėtų palengvinti tiesioginį sekrecinių pūslelių srautą į ląstelės paviršių per trumpą atstumą, plius galas pervežant mikrotubules, apeinančius Golgi.

Šiame tyrime ER-Golgi pernešimo slopinimas (1, 2, 3 pav.) Arba GRASP55 reguliavimas (S4 pav.) Sukėlė šerdies glikozilinto CFTR ekspresiją ląstelių paviršiuje. Alternatyvus šios išvados paaiškinimas būtų tas, kad Arf1-Q71L ar kiti galimi citotoksiniai vaistai gali nespecifiškai padidinti membraninių baltymų ekspresiją ląstelių paviršiuje, nes jie slopina paviršiaus baltymų internalizavimą, o ne sekrecijos įvykio suaktyvinimą. Kaip parodyta S1 paveiksle, membraninio baltymo internalizacijos slopinimas dynasore ir dinamin2-K44A nesukėlė šerdies glikozilinto CFTR ekspresijos ląstelės paviršiuje, o tai rodo, kad baltymo internalizacijos slopinimas negali lemti šerdies ir ląstelės paviršiaus ekspresijos. glikozilintas CFTR ER streso metu ir ER-Golgi blokada. Įdomus pastebėjimas yra tas, kad ląstelių paviršiaus baltymų internalizacijos slopinimas nedaro reikšmingos įtakos CFTR, netradiciškai gabenamiems į ląstelės paviršių Arf1-Q71L (S1b – d pav.), Tuo tarpu tai padidino tradiciškai pernešamos membranos ląstelių paviršiaus išraišką. baltymų 40–80% (S1a, b pav.). Šie rezultatai rodo, kad Arf1-Q71L slopino paviršiaus baltymų internalizaciją. Atsižvelgiant į tai, kad sulankstomieji membraniniai baltymai, kurie yra pernešami į ląstelės paviršių, išlieka kontroliuojami periferinių baltymų kokybės kontrolės 34, internalizacijos slopinimas būtų papildomas pranašumas, padidinantis jų sulaikymo laiką plazmos membranoje, nors internalizacijos slopinimas vienas pats negali sukelti ląstelės paviršiaus išraiškos.

Stuburinių gyvūnų modeliuose buvo įrodyta, kad GRASP dalyvauja netradiciniame CFTR ir trombopoetino receptoriaus Mpl (mieloproliferacinio leukemijos viruso onkogenas) pernešime, kurio metu ER šerdies glikozilintos membranos baltymų formos tiesiogiai transportuojamos į ląstelės paviršių 7, 35, 36 . „Sec16A“ taip pat buvo reikalingas GRASP55 perdėtos ekspresijos sukeltai ΔF508-CFTR ląstelių paviršiaus ekspresijai (S4 pav.), O „Sec16A“ buvo kolokalizuotas ir susijęs su GRASP55 ER streso sukeltos netradicinės sekrecijos metu (6 pav.). Kaip pastangą organizuoti ERES 37, „Sec16A“, išsklaidytas per ER streso signalus, gali įdarbinti GRASP55, kuris vėliau gali nešti CFTR į naujai įsteigtą ERES netradiciniam sekrecijai. Tačiau atrodo, kad atvirkščiai, nes per didelis GRASP55 ekspresija, sukelianti netradicinį ΔF508-CFTR, bet ne ER streso signalų 7 platinimą, sukėlė Sec16A kolokalizaciją ir periferinę dispersiją (4e pav.). Bet kokiu atveju asociacija tarp SecESA, ERES organizatorių, ir GRASP, krovinių įdarbinimo faktorių, bus kritinis įvykis netradicinio CFTR sekrecijos inicijavimui.

Kitas svarbus mūsų tyrimo išvada yra tas, kad IRE1α reguliuoja netradicinį sekreciją, moduliuodamas Sec16A. Norėdami palaikyti homeostazę ER liumenyje, ER reaguoja į sulankstytų baltymų perteklių ir palengvina ER stresą, sukeldama UPR signalizacijos kelius 38 . Paprastai UPR sumažina baltymų krūvį ER, sumažindami sekrecinių baltymų transkripciją ir transliaciją bei nukreipdami klaidingai sulankstytus baltymus į ER susietą skilimo kelią 39 . Be to, UPR gali suaktyvinti klaidingai sulankstytų baltymų sekreciją netradiciniu būdu, kad sumažintų ER krūvį 7 . Įrodyta, kad IRE1, viena iš trijų pagrindinių UPR signalizacijos 16 atšakų, yra atsakinga už naujos ERES generavimą ir „Sec16A“ reguliavimo atnaujinimą lėtinio sekretorinio krovinio perkrovos metu 17 . Anksčiau taip pat buvo parodyta, kad IRE1 tarpininkauja ER streso sukeltai netradicinei CFTR 7 sekrecijai. Dabartiniai mūsų duomenys rodo, kad IRE1 tarpininkaujamas UPR yra pagrindinis aukščiau esantis signalas, kuris reguliuoja Sec16A generavimą ir įtvirtinimą ERES, dalyvaujančioje ER streso sukeltoje ir GRASP perduotoje nekonvencinėje sekrecijoje (8 pav.).

IRE1α išeikvojimas sumažino bendrą Sec16A raišką ir, atrodo, slopino periferinę Sec16A puncta sklaidą (9 pav.). Tačiau įmanoma, kad paprasčiausias Sec16A lygio sumažinimas IRE1 numušimu, o ne tikras Sec16A perskirstymo slopinimas sumažintų Sec16A imunofluorescencijos lygį iki subtruktūrinio lygio giliau periferiniuose regionuose nei perinukleariniame regione. Nors mes analizavome imunofluorescencinius vaizdus su padidintu lazerio stiprumu, kad sumažintume problemą (9 pav.), Mūsų rezultatai negali visiškai atmesti šios galimybės. Bet kokiu atveju gilus periferinio Sec16A lygio sumažėjimas yra susijęs su netradicinio CFTR sekrecijos sumažėjimu. Atsižvelgiant į tai, kad periferinis GRASP55 perskirstymas yra labai svarbus netradiciniam CFTR 21 sekrecijai ir kad GRASP55 asocijuojasi su Sec16A ER-to-Golgi blokados metu (6 pav.), Periferiškai lokalizuotas Sec16A vaidins svarbų vaidmenį ER išeinant iš krovinių. ER-to-Golgi blokada. Taigi sukaupti įrodymai rodo, kad 1) GRASP yra perskirstoma iš Golgi į ER ER metu ir atpažįsta kai kuriuos krovinius, kuriems taikoma netradicinė sekrecija, ypač membraninius baltymus, tokius kaip CFTR, kurių C-gale yra PDZ surišimo motyvas, ir 2. ) GRASP asocijuojasi su „Sec16A“ turinčiu baltymų kompleksu, kuris gabena krovinius į pūsleles, kurios netradicinio sekrecijos metu išsiskiria iš ER membranos.

ER stress signals induce the phosphorylation of the GRASP55 C-terminus, which is essential for ER stress-induced unconventional secretion of ΔF508-CFTR 7, and several kinases are known to regulate Sec16A function 15, 40 . Recently, Joo et al . reported that ATG1/ULK-mediated phosphorylation at the Ser846 residue of Sec16A is essential for the COPII-mediated ER-to-Golgi trafficking under basal physiologic conditions 41 . Considering the finding that ATG1 is also involved in the ER stress-induced, unconventional trafficking of CFTR 7, it will be an interesting task to investigate whether phosphorylation(s) at specific Sec16A loci is required for unconventional secretion. Increasing evidence indicates that autophagy components are involved in various kinds of unconventional trafficking. For instance, coronaviruses use nonlipidated, ATG8/LC3-positive vesicles for replication, which emerge from the ER by a COPII-independent mechanism 42 . However, this pathway is not dependent on ATG7 42, whereas the ER stress-induced, unconventional trafficking of CFTR is dependent on both ATG7 and ATG8 7 . Therefore, it appears that diverse cargos, from viral particles to mammalian membrane proteins, employ several combinations of autophagy components for their travel to the cell surface after ER exit.

In conclusion, we demonstrated the role of Sec16A in ER exit during unconventional secretion. In addition, we showed that IRE1α acts as an upstream signal for ER stress-associated unconventional secretion by modulating Sec16A. These results provide new insights into the global role of Sec16A as a common mediator of ER export. Furthermore, the identification of Sec16A as a platform for the exit of folding-deficient proteins from the ER will contribute to therapeutic strategies for diseases resulting from defects in the transport of misfolded proteins.

Medžiagos ir metodai

Cell culture, plasmids, transfection, gene-silencing, antibodies, and chemicals

HEK293 and HeLa cells were maintained in Dulbecco's modified Eagle's medium (DMEM high glucose) containing 10% fetal bovine serum (FBS) and penicillin (50 IU/mL)/streptomycin (50 μg/mL; all from Invitrogen) in a 5% CO 2 incubator at 37 °C. The mammalian expression plasmid Sec16A-Myc/DDK was purchased from OriGene (plasmid # RC223625). The plasmids encoding human ΔF508-CFTR, extracellular tagged HA-CFTR, HA-ΔF508-CFTR, Myc-GRASP55, Myc-Transferrin receptor, HA-Arf1-Q71L, and Myc-Sar1-T39N were described previously 7 . The plasmids encoding HA-GRASP55 and untagged GRASP55 were generated by cDNA subcloning into pCMV-SPORT6. The plasmid encoding Flag-tagged dynamin2-K44A was generated by a PCR-based site directed mutagenesis after constructing pcDNA3.1(+)-hDynamin2 using a cDNA fragment amplified from HEK293 cells (gene ID:1785, 2613 bp). pEYFP-ER plasmid was purchased from BD Biosciences (San Jose, CA, USA). Plasmid DNA transfection into HEK293 or HeLa cells was performed using the TransIT-X2 Dynamic Delivery System (Mirus Bio LLC). ON-TARGETplus human Sec16B-siRNA, Sec23A-siRNA, Sec23B-siRNA, Sec24A-siRNA, Sec24B-siRNA, Sec24C-siRNA, Sec24D-siRNA, Sec31B-siRNA and IRE1α-siRNA were purchased commercially (SMARTpool; Dharmacon, Lafayette, CO, USA). Double-stranded siRNAs against human Sec16A (targeting sequence: CCAGGTGTTTAAGTTCATCTA), against human Sec13 (targeting sequence: GCACTCATGTTACGAGGAA), and against human Sec31A (targeting sequence: AACAGACAAGTTCAGCATATT) were custom synthesized by Bioneer (Daejeon, Korea). Transfection of siRNA duplexes into the HEK293 cells was performed using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's protocol. Plasmid DNA delivery was performed 24 h after siRNA transfection.

The following antibodies were acquired commercially: anti-Sec16A (KIAA0310, Bethyl Laboratories, INC); anti-Sec31A (BD Transduction Laboratories); anti-Sec24B and anti-Sec24D (Bethyl Laboratories, INC); anti-IRE1α, anti-Myc and anti-HA, (Cell Signaling Technology, Danvers, MA); anti-γ-tubulin (Sigma); anti-Flag (Sigma); anti-GRASP55 rabbit polyclonal and anti-Calnexin mouse monoclonal (Abcam, Cambridge, MA); anti-GRASP55 monoclonal (Novus Biologicals, LLC); anti-Aldolase A and anti-ß-actin (Santa Cruz Biotechnology, SantaCruz, CA); and anti-CFTR M3A7 (Millipore, Billerica, MA). The anti-R4 polyclonal antibody raised against peptides corresponding to amino acids 1458–1471 of human CFTR was previously reported 43 . Thapsigargin and dynasore were commercially purchased (Sigma Aldrich).

Immunoprecipitation, immunoblotting, and surface biotinylation

Immunoblotting and immunoprecipitation were performed as described previously 7 . Briefly, HEK293 cells, transfected with the appropriate plasmids, were homogenized in lysis buffer containing 25 mM Tris (pH 7.4), 1% (v/v) NP40, 150 mM NaCl, 5% glycerol, and 1 mM EDTA supplemented with protease inhibitor mixture (Roche, Applied Science, Mannheim, Germany). For co-immunoprecipitation, cell lysates (1, 000 μg protein) were diluted to a final volume of 500 μL in lysis buffer and pre-cleared with control Agarose Resin (crosslinked 4% beaded agarose) for 2 h at 4 °C. To avoid co-elution of the antibody heavy and light chains that may have co-migrated with the GRASP55 bands, we immobilized 10 μg affinity-purified rabbit anti-Sec16A (KIAA0310) antibody or normal rabbit IgG (Santa Cruz Biotechnology, SantaCruz, CA) to AminoLink Plus Coupling Resin (Pierce Co-Immunoprecipitation Kit, Pierce, Rockford, IL, USA) at room temperature for 2 h. To precipitate endogenous Sec16A, pre-cleared protein complexes were collected with antibody-coupled resin overnight at 4 °C and then washed five times with the lysis buffer; the immune complexes were eluted with 30 μL elution buffer (pH 2.8) containing primary amine and 5× lane-marker sample buffer (0.3 M Tris•HCl, 5% SDS, 50% glycerol, lane-marker tracking dye; pH 6.8) containing 100 mM DTT. Protein bands were detected by enhanced chemiluminescence, and the densities of the bands were quantified using imaging software (Multi Gauge ver. 3.0; Fujifilm, Tokyo, Japan).

The surface biotinylation assay was performed as previously described 7 . Briefly, HEK293 cells were washed with PBS containing 0.1 mM CaCl 2 and MgCl 2 (PBS-CM plus) 24 h after the transfection with the appropriate plasmids, and then incubated in 1 mL biotin solution (0.3 mg/mL Sulfo-NHS-SS-Biotin in cold PBS-CM plus, Thermo Pierce) for 30 min at 4 °C. The cells were then incubated with quenching buffer containing 0.5% bovine serum albumin (BSA) for 10 min and washed three times with PBS. After cell lysis, the lysates were centrifuged at 16, 000 g for 20 min at 4 °C. The resulting supernatants containing equal amounts of total protein were incubated with 200 μL 10% streptavidin agarose (Thermo Fisher Scientific). The streptavidin-bound, biotinylated proteins were centrifuged, washed five times with lysis buffer, and eluted in 2× SDS sample buffer. The subsequent steps of the biotinylation assay were the same as those of the immunoblotting procedure.

Immunocytochemistry, confocal microscopic image acquisition, and morphometric analysis

Immunocytochemistry was performed as previously reported 7 . HeLa cells were cultured on 18 mm round coverslips and fixed and permeabilized with cold methanol (−20 °C) for 6 min. The fixed cells were washed three times with PBS and then incubated with blocking solution containing 5% serum from the species from which the secondary antibody was raised in (horse/donkey/goat serum), 1% BSA, and 0.1% gelatin in PBS for 1 h at room temperature. After the blocking step, the cells were stained by incubation with the appropriate primary antibodies, followed by fluorophore-conjugated secondary antibodies. In the case of surface-specific immunostaining, cells were fixed with 4% formaldehyde for 6 min at room temperature without permeabilization and then stained with primary and secondary antibodies. Fluorescence images were captured using a laser scanning confocal microscope (LSM 780; Carl Zeiss, Berlin, Germany) with a 63 × 1.4 numerical aperture oil objective lens.

Morphometric analysis of the captured confocal images was performed using the MetaMorph microscopy analysis software (version 7.1; Molecular Devices, Sunnyvale, USA). For the quantification of the images under each condition, 24-bit confocal images containing red, green, and blue components were converted into three 8-bit mono-channel images. For the quantification of surface CFTR intensity, pixels above the threshold level of 60 were defined as CFTR. The intensity profile of each single cell was presented as the standard deviation around the mean of the average intensity value for the entire region. For the analyses of the Sec16A distribution, the high-resolution images of Sec16A punctates were smoothed using a low-pass filter in MetaMorph, and pixels above the threshold level of 30 were defined as Sec16A (+). The regions of the total cell area were determined by the trace region tools of MetaMorph using the differential interference-contrast images of the cells, then the ratio of the Sec16A (+) area versus the total cell area was calculated.

The degree of colocalization between Sec16A and ER markers (or GRASP55) was quantified based on MCC (Manders' Colocalization Coefficients) 44 using the colocalization module of the ZEN 2012 software (black edition; Carl Zeiss, Berlin, Germany). For the measurement of MCC under each condition, pixels above the fluorescence threshold level of both channels (red and green) 50 were defined as the overlapping signals. Then, the average of MCC obtained from the regions of interest was calculated. For two target proteins, represented as Sec16A and ER, two different MCC values were calculated as:

Image

Immunogold labeling and transmission electron microscopy

HeLa cells were fixed and subjected to cryoimmuno-EM labeling, as reported previously 45 . HeLa cells transfected with HA-Arf1-Q71L or empty plasmids were fixed with 4% paraformaldehyde and 0.1% glutaraldehyde in PBS buffer (pH 7.4) at 4 °C for 20 min. The fixed cells were embedded in 10% gelatin and cut into small blocks under a surgical microscope. The gelatin blocks were infused overnight with 2.3 M sucrose and frozen in liquid nitrogen. The frozen blocks were cut into 50 nm ultrathin cryosections at −120 °C using a Leica UCT7 cryo-ultramicrotome (Leica, Vienna, Austria). Ultrathin sections were transferred from the diamond knife onto Formvar-coated copper slot grids using a 2.3 M sucrose: 2% methylcellulose (1:1) solution. Rabbit polyclonal GRASP55 antibody (Abcam, diluted 1:50) was used as the primary antibody, and Protein A-10 nm gold conjugate (from Dept. of Cell Biology, University Medical Center Utrecht, Utrecht, Netherlands) was used to detect the primary antibody. Both the GRASP55 antibody and the Protein A-gold were diluted in 0.1% BSA-c (Aurion, Netherlands). For the immunogold labeling experiments, the ultrathin cryosections were first blocked with 0.1% cold fish gelatin and 5% BSA for 10 min, then incubated with GRASP55 antibody for 30 min, and continually with Protein A-gold for 30 min. The grids were stained in 4% neutral uranyl acetate and embedded in 2% methylcellulose containing 0.3% uranyl acetate, as previously described 46 . Transmission electron microscopy was conducted by examining the grids at 120 kV using a Tecnai G 2 Spirit Twin Transmission Electron Microscope (FEI Company, USA).

Quantitative real-time PCR (qPCR)

Purified RNA samples from HEK293 cells were reverse-transcribed using RNA to cDNA EcoDry Premixes (Takara Bio Inc.). The total reaction volume was adjusted to 20 μL with RNase-free water after mixing with 100 ng cDNA, 2 μL primer sets, 10 μL 2× SYBR premix Ex Taq, and 0.4 μL 50× ROX reference dye (Takara Bio Inc.). Amplification was performed under the following cycling conditions: 95 °C for 15 min, followed by 40 cycles of 95 °C for 15 s, and 60 °C for 40 s. Analyses were performed in triplicate for each cDNA. The relative mRNA expression levels were calculated using the comparative threshold cycle (C t ) method with GAPDH as a control, as follows: ΔC t = C t (GAPDH) − C t (target gene). The fold-change in gene expression normalized to GAPDH and relative to the control sample was calculated as 2 −ΔΔCt .

Statistinė analizė

The results of multiple experiments are presented as the means ± SEM. Statistical analysis was performed using Student's t-tests or with analysis of variance followed by Dunnet's multiple comparison tests as appropriate; P <0, 05 buvo laikomas statistiškai reikšmingu. Calculations were performed using GraphPad Prism5 (GraphPad Software, Inc., La Jolla, CA).

Papildoma informacija

How to cite this article : Piao, H. et al . Sec16A is critical for both conventional and unconventional secretion of CFTR. Mokslas. Rep. 7, 39887; doi: 10.1038/srep39887 (2017).

Leidėjo pastaba: „ Springer Nature“ išlieka neutralus paskelbtų žemėlapių jurisdikcijos reikalavimų ir institucinių ryšių atžvilgiu.

Papildoma informacija

PDF failai

  1. 1.

    Papildoma informacija

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.