Nuo srsf1 priklausomas branduolinio ginklo eksporto slopinimas pakartotinų nuorašų c9orf72 metu apsaugo neurodegeneraciją ir susijusius motorinius trūkumus | gamtos komunikacijos

Nuo srsf1 priklausomas branduolinio ginklo eksporto slopinimas pakartotinų nuorašų c9orf72 metu apsaugo neurodegeneraciją ir susijusius motorinius trūkumus | gamtos komunikacijos

Anonim

Dalykai

  • Amiotrofinė šoninė sklerozė

Anotacija

Heksanukleotidų pakartotinis C9ORF72 geno išplėtimas yra labiausiai paplitusi genetinė amiotrofinės šoninės sklerozės ir frontotemporalinės demencijos priežastis. Pakartotinių nuorašų ir dipeptido pakartotinių baltymų išraiška sukelia įvairius neurotoksiškumo mechanizmus. Kaip pakartotiniai nuorašai bus eksportuojami iš branduolio, nežinoma. Čia parodyta, kad branduolinio eksporto adapterio SRSF1 išeikvojimas apsaugo nuo neurodegeneracijos ir lokomotorinių trūkumų Drosophila modelyje, susijusiame su C9ORF72. Ši intervencija slopina pacientų sukelto motorinio neurono ląstelių žūtį ir astrocitų sukeltą neurotoksiškumą atliekant kultūrų tyrimus. Mes taip pat parodome, kad ardantis SRSF1 arba užkertant kelią jo sąveikai su NXF1, specifiškai slopinamas branduolinis patologinių C9ORF72 nuorašų eksportas, dipeptido kartotinių baltymų gamyba ir palengvinamas neurotoksiškumas Drosophila , iš paciento gaunamų neuronų ir neuronų ląstelių modeliuose. Bendrai paėmus, mes parodome, kad pakartotinis SRSF1 RNR sekvestracija sukelia nuo NXF1 priklausomą C9ORF72 transkriptų branduolinį eksportą, išlaikant išplėstinius heksanukleotidų pakartojimus, ir atskleidžiame naują perspektyvų terapinį taikymą neuroprotekcijai.

Įvadas

Amyotrofinė šoninė sklerozė (ALS) ir frontotemporalinė demencija (FTD) yra mirtinos suaugusiųjų pradėtos neurodegeneracinės ligos, atitinkamai sukeliančios progresuojančią motorinių neuronų mirtį, didėjančią neuromuskulinės sistemos nepakankamumą ir būdingus pažinimo funkcijos bei asmenybės ypatybių pakitimus. Neuroprotekcinio gydymo galimybės šiuo metu yra labai ribotos, o anti-glutamaterginis agentas riluzolis prailgina ALS sergančių pacientų išgyvenamumą tik maždaug 3 mėnesiais. Dažniausiai nustatoma genetinė ALS ir FTD priežastis yra polimorfiniai pakartotiniai išsiplėtimai, sudaryti iš šimtų iki tūkstančių GGGGCC heksanukleotidų pakartojimo sekos (toliau - sutrumpintai G4C2) pirmajame C9ORF72 geno introne , turint autosominį dominuojantį paveldėjimą ir nepilną įsiskverbimą 1, 2, 3, 4 . Pasikartojančios DNR sekos yra perrašomos abipusiai, todėl būdingas G4C2-prasmės ir C4G2-antisense RNR židinių susidarymas tiek ALS, tiek FTD atvejais 5, 6 . Įvairių ląstelių keliuose esančių transkriptų raiškos lygiai ir sujungimai yra paveikti ALS modeliuose ir žmogaus pomirtiniuose audiniuose, dėl kurių RNR metabolizmas yra sutrikęs, vyksta mitochondrijų disfunkcija, oksidacinis stresas, eksitotoksiškumas, apoptozė, pakitę autofagijos mechanizmai, baltymų klirensas, aksonų pernešimas. ir motorinių neuronų-astrocitų kryžminis pokalbis (apžvalgos pateiktos nuorodose 1, 3 ). Atsižvelgiant į tai, neseniai C9ORF72-ALS sergančių pacientų smegenų biosu mėginiuose neseniai buvo nustatyti plačiai paplitę alternatyviųjų susiuvimo pokyčiai (> 8000) ir alternatyvios poliadenilinimo vietos panaudojimas (> 1 000) 5 . Mes taip pat pranešėme, kad susiuvimo konsistencijos pokyčiai koreliuoja su greitesne ligos progresavimu C9ORF72 -ALS atvejais, nepriklausomai nuo DNR pakartotinio išplėtimo ilgio 7 .

C9ORF72 kartojamas patofiziologinis išplėtimas gali apimti tris išsamiai ištirtus mechanizmus, kurie visi gali prisidėti prie neuronų sužalojimo ir ligos progresavimo: (i) RNR toksiškas funkcijos padidėjimas, nustatant RNR jungiančius faktorius 8, 9, 10, 11; 12 ; (ii) baltymų toksiškas funkcijos padidėjimas dėl pakartotinai susijusio ne ATG (RAN) vertimo, kuris vyksta visomis prasmėmis, ir antisense skaitymo rėmų, siekiant gauti penkis dipeptido kartojimo baltymus (DPR) 6, 13, 14, 15, 16 ; (iii) haploinfektyvumas dėl sumažėjusios C9ORF72 baltymo 2, 17, 18 ekspresijos, kuris, kaip neseniai įrodyta, vaidina pagrindinį vaidmenį nuo Rab GTPazės priklausomai autofagijos reguliacijai 19, 20, 21 . Mes remiamės nuorodomis 22, 23, 24, 25, 26 naujausioms apžvalgoms apie C9ORF72 sąlygojamą neurotoksiškumą.

Panašu, kad heksanukleotidų pakartotiniai išsiplėtimai nepaveikia pirmojo C9ORF72 introno sujungimo, nes neišeksplikuotų nuorašų dalis, išmatuota exon1 – intron1 jungtimi, išlieka panaši kontrolės ir paciento atliekamais neuronais arba pomirtinių smegenų audiniuose. 27 Nedidelė dalis C9ORF72 pasikartojančių nuorašų, išlaikančių patologinius pakartotinius išplėtimus intron -1 pabėgimo branduolio sulaikymo mechanizmuose, buvo aptikti paciento gaunamų limfoblastų citoplazmoje 28, kur jie vėliau gali būti paversti DPR. Įdomu tai, kad baltymų ir RNR nukleocitoplazminiai transportavimo defektai neseniai buvo išryškinti Drosophila , mielių ir žmogaus neuronų modeliuose, susijusiuose su C9ORF72- ALS 29, 30, 31, 32 . Visų pirma, atliekant funkcijos praradimo ekraną Drosophila mieste, buvo nustatyti ALYREF (Aly / REF eksporto faktorius) ir NXF1 (1 branduolio eksporto faktorius), du mRNR branduolinio eksporto mechanizmo komponentai, kaip neurotoksiškumo, kurį sukelia C9ORF72 , modifikatoriai . . Tačiau mechanizmas (-ai), skatinantis (-us) specifinį patologinį introną sulaikančių C9ORF72 pakartotinių nuorašų branduolinį eksportą, dar turi būti išaiškintas. Mes ir kiti pranešėme apie tiesioginį branduolinio eksporto adapterio baltymų ALYREF 33 ir SRSF1 (serino / arginino turinčio splaisingo faktoriaus 1) 34 surišimą ir sekvestraciją ant G4C2 - pakartoti nuorašus 11, 12 . Ankstesni mūsų tyrimai parodė, kad branduolinio eksporto adapteriai, tiesiogiai sąveikaujantys su RNR ir branduolinio eksporto receptoriais NXF1, atkuria NXF1 atviroje struktūroje kartu su TREX (transkripcijos-eksporto) komplekso subvienetais, kad padidintų jo afinitetą subrendusioms mRNR ir suaktyvintų mRNR branduolinio eksporto procesas 35, 36, 37, 38, 39 . NXF1 rekonstravimas siūlo kontrolės mechanizmą, kad būtų išsaugoti neapdoroti nuorašai branduolyje 37, 40 . ALYREF išnaikinimas Caenorhabditis elegans 41 ir Drosophila melanogaster 42 yra būtinas pasauliniam mRNR eksportui ir plėtrai. Pažymėtina, kad tik po dalinio branduolių eksporto blokuojama ALYREF žmogaus ląstelėse 43, o tai rodo, kad egzistuoja kiti baltymai, turintys nereikalingą eksporto funkciją. Remiantis tuo, buvo nustatyta, kad keli konservuoti žmogaus branduolio eksporto adapteriai sąveikauja su NXF1 RNR rišančiu domenu (nuorodos 34, 37, 44, 45) ir kartu gali sąveikauti su tomis pačiomis mRNR molekulėmis 44 . Neseniai atliktas tyrimas taip pat parodė, kad nors kiekvienas iš septynių SR turinčių išplitimo faktorių SRSF1-7 suriša tūkstančius nuorašų, individualus SRSF1 sunaikinimas turi įtakos tik nedidelės dalies nuorašų (<0, 5–2% mRNR) branduoliniam eksportui. -7 baltymai, aiškiai pabrėžiantys perteklių ir (arba) bendradarbiavimą atliekant nuo NXF1 priklausomą branduolio eksporto adapterio funkciją 46 . Mes remiamės nuorodomis 47, 48 naujausioms apžvalgoms apie TREX ir mRNR branduolinį eksportą.

Čia mes iškėlėme hipotezę, kad: (i) per didelis branduolinio eksporto adapterio (-ių) surišimas su C9ORF72 pakartotiniais nuorašais gali priversti sąveiką su NXF1 ir nepaisyti branduolinio sulaikymo mechanizmų; (ii) paskiepytų eksporto veiksnių, galinčių netinkamai išduoti licenciją branduolinį eksportą turinčių pakartotinių nuorašų, išeikvojimas, savo ruožtu, gali būti apsaugotas nuo neuroprotekcijos. Mes panaudojome nusistovėjusį Drosophila su C9ORF72 susijusios ligos modelį, kuris rodo ir neurodegeneraciją, ir lokomotorinius trūkumus 16, kad nustatytų galimą (-us) branduolio eksporto adapterį (-ius), dalyvaujantį C9ORF72 kartotinių nuorašų branduoliniame eksporte. Mes taip pat panaudojome neuronų N2A ląstelių ir iš ALS pacientų gaunamų neuronų ir astrocitų derinį, kad patvirtintume savo in vivo radinius ir išskaidytume molekulinius mechanizmus, skatinančius pakartotinių nuorašų branduolinį eksportą, ir su jais susijusį neurotoksiškumą. Šiame tyrime mes pademonstravome, kad SRSF1 sekvestracija ant C9ORF72 pakartotinių nuorašų suaktyvina su NXF1 susijusį branduolinį eksportą, nepriklausomai nuo susiuvimo, o tai lemia vėlesnį RPR neurotoksinio DPR lygio vertimą. Be to, mes parodome, kad dalinis SRSF1 išeikvojimas nepakeičia laukinio tipo C9ORF72 nuorašų ekspresijos lygio, intron-1 splaisingo ar branduolinio eksporto, tuo tarpu jis ypač apsaugo nuo C9ORF72 tarpininkaujamo neurodegeneracijos ir in vivo susijusių motorinių deficitų.

Rezultatai

ALYREF ir SRSF1 tiesiogiai jungiasi G4C2 ir C4G2 pakartojančiomis RNR

In vitro atlikome kryžminio UV susiejimo tyrimus, naudodami išgrynintus rekombinantinius baltymus ir sintetinius G4C2x5 ir C4G2x5 RNR zondus, kad ištirtume tiesioginę baltymų: RNR sąveiką. Rekombinantinis heksa-histidinu pažymėtas žmogaus ALYREF, SRSF1 aminorūgštys 11–196, kurios išlaiko laukinio tipo sugebėjimą surišti RNR ir NXF1 (nuoroda 36), ir MAGOH, kontrolinis baltymas, nesiejantis RNR 49, buvo išvalytas jonais metalų afiniteto chromatografija, turinti didelę druską, siekiant nutraukti galimą sąveiką su bakterijų RNR. Išgryninti baltymai buvo inkubuoti su 5'-galo galu pažymėtais G4C2x5 (1a pav.) Arba C4G2x5 (1b pav.) RNR zonais, pažymėtais 32 P-gale, prieš švitinimą UV spinduliais, kur nurodyta (+), ir išskaidomi SDS-PAGE. Kaip parodyta „Phosphoimages“ vaizde, denatūravimo elektroforezės metu kovalentiškai surištos RNR molekulės išliko susijusios su ALYREF ir SRSF1, matomomis Coomassie dažytose plokštėse. Šie duomenys rodo tiesioginę ALYREF ir SRSF1 sąveiką tiek su sensacine, tiek su antisensine RNR, suderinus su ankstesniais mūsų tyrimais 12, 50 . Sąveika yra specifinė, nes nebuvo rasta RNR, jei nebūtų švitinamas UV spinduliais arba su neigiamu kontroliniu baltymu MAGOH. Ši tiesioginė sąveika taip pat atitinka mūsų anksčiau nurodytą ALYREF ir RNR židinių lokalizaciją C9ORF72-ALS sergančių pacientų motoriniuose neuronuose 12 . Be to, mes parodome, kad SRSF1 yra lokalizuotas su RNR židiniais motoriniuose neuronuose iš C9ORF72-ALS atvejų žmogaus pomirtinio nugaros smegenų audinio (1c pav.).

Image

( a, b ) Baltymai: RNR UV kryžminio sujungimo tyrimai, naudojant išgrynintus rekombinantinius baltymus ir 32P galo radioaktyviai paženklintus G4C2x5 ( a ) ir C4G2x5 ( b ) pakartotus RNR zondus. Baltymai vizualizuojami SDS – PAGE dažais, dažytais Coomassie mėlyna spalva (kairiajame skydelyje) ir kovalentiškai susietose RNR: baltymų kompleksuose, atliekant autoradiografiją „PhosphoImages“ (dešiniosios plokštės). UV spindulių poveikis žymimas +. c ) Konfokusinės fluorescencinės mikroskopijos vaizdai parodo SRSF1 (pažymėto žalia spalva imunofluorescencija) ir jutimo RNR židinių (pažymėtų raudonai, naudojant fluorescenciją in situ hibridizaciją) lokalizaciją motoriniuose neuronuose iš dviejų žmonių C9ORF72-ALS nugaros smegenų audinių. atvejų. Branduoliai nudažyti mėlyna spalva DAPI. Masto juostos kairiosiose plokštėse: 3 μm; mastelio juostos padidintose plokštėse: 0, 5 μm.

Visas dydis

SRSF1 išeikvojimas gelbsti Drosophila modelį C9ORF72-ALS

Norėdami gauti funkcinį supratimą apie G4C2 kartotinių nuorašų priklausomybę nuo branduolinio eksporto, mes išbandėme, ar konservavusių branduolinio eksporto adapterių ALYREF ir SRSF1 išraiškos lygių sumažinimas gali išgelbėti C9ORF72-ALS Drosophila 16 neurodegeneraciją. Musės, išreiškiančios 36 nepertraukiamus pakartojimus („grynas“ G4C2x36), buvo perbrauktos dviem nepriklausomomis transgeninėmis RNR linijomis, kiekviena nukreipta į SRSF1 arba ALYREF 51 (apverstos pakartojimo sekos pateiktos 1 papildomoje pastaboje). Tikslinė G4C2x36 išraiška sutrikdo junginio akį ir yra minimaliai keičiama kartu kontroliuojamų RNR ekspresijos būdu (2a pav.). Atvirkščiai, dviejų skirtingų SRSF1- RNR sekų (dar vadinamų SF2 / ASF ) bendra ekspresija visiškai užkerta kelią neurodegeneracijai, o dvi ALYREF (dar vadinamos Ref1 ) numušimo linijos parodė tik nedidelį neurodegeneracinio fenotipo išsaugojimą . Mes patvirtinome sėkmingą SRSF1 ir ALYREF numušimą atitinkamose musėse , parodydami 70–80% mRNR raiškos lygio sumažėjimą (2b pav.). Be to, buvo įrodyta, kad G4C2x36 pakartotinis išsiplėtimas neuronine išraiška lemia lervų ir suaugusiųjų lokomotorinius trūkumus 16 . Atsižvelgiant į patogeninį SRSF1 vaidmenį, jo dalinis išeikvojimas atstatė lervų (2c pav.) Ir suaugusių musių (2d pav.) Lokomotorinę funkciją. Šis poveikis būdingas SRSF1, nes ALYREF išeikvojimas neturėjo jokio poveikio, kuris sutinka su šiurkščių akių fenotipais. Drosophila modelyje G4C2x36 C9ORF72-ALS pastebėtas neurotoksiškumo poveikis visų pirma buvo susijęs su DPR 16 ekspresija. Atitinkamai, mes dabar parodome, kad SRSF1 išeikvojimas smarkiai sumažina tiek senso, tiek antisense poli-GP DPR gamybą (2e pav.).

Image

a ) Reprezentatyviuose šviesos ir skenuojančiuose elektronų mikrografuose yra normalūs akių (GAL4 / luciferazės-RNRi) ir G4C2x3 musių fenotipai. G4C2x36 ekspresija sukelia grubų akių fenotipą, kurį visiškai išgelbėjo SRSF1 numušimas. Mastelio juostos: 100 μm mažam padidinimui ir 50 μm padidintiems mikrografams. ( b ) SRSF1 (raudona) ir ALYREF (mėlyna) transkripto lygiai buvo kiekybiškai įvertinti qRT – PCR analizės būdu nepriklausomose „G4C2x36“ musių numušimo linijose. Tub84b transkripto lygiai buvo naudojami normalizacijai atliekant tris biologinius pakartojimų eksperimentus (vidurkis ± sem; dvipusė ANOVA su Tukey korekcija keliems palyginimams; N (qRT – PGR reakcijos) = 6). ( c, d ) Neuroninė G4C2x36 išraiška sukelia lervų nuskaitymą ( c ) ir suaugusiųjų laipiojimą ( d ), kurie abu atstatomi SRSF1 išeikvojus (vidutinis ± 95% CI, normalizuotas kontroliuoti; Kruskal – Wallis neparametrinis testas su Dunno pataisa) daugybiniai palyginimai; N (lervos) = 10; N (suaugusieji) = kontrolė (GAL4 / luciferazės-RNR): 93, G4C2x3: 26, G4C2x36 + Ctrl-RNR: 62, G4C2x36 + SRSF1-RNR: 50, G4C2x36 + ALYREF- RNR: 36). ( e ) Visi baltymų ekstraktai iš G4C2x3 + Ctrl-RNR, G4C2x36 + Ctrl RNR ir G4C2x36 + SRSF1-RNR Drosophila lervų buvo analizuojami taškiniais blotomis, naudojant poli-GP ir pakraunant kontrolinius α-tubulino antikūnus. Svarstyklės, 6 mm. f ) SRSF1 išeikvojimas Drosophila modeliuose, išreiškiančiuose DPR, nepriklausomai nuo G4C2 pakartotinių išplėtimų ir RAN transliacijos16. g ) Poli-Gly-Arg DPRs (GR36) ir poly-Pro-Arg DPRs (PR36) neuronų ekspresija sukelia suaugusiųjų laipiojimo deficitą, kurio neatstato SRSF1 išeikvojimas (vidutinis ± 95% CI, normalizuotas kontrolei; Kruskal – Wallis nėra). -parametrinis testas su Dunn'o korekcija daugybiniams palyginimams; N = kontrolė (GAL4 / luciferazės-RNR): 239, GR36 + Ctrl-RNR: 12, GR36 + SRSF1-RNR: 7, PR36 + Ctrl-RNR: 125, PR36 + SRSF1. -RNR: 119). Statistinis duomenų reikšmingumas nurodomas taip: NS: nereikšmingas, P ≥0, 05; * P <0, 05; ** P <0, 01; *** P <0, 001; **** P <0, 0001.

Visas dydis

Norėdami ištirti SRSF1-RNRi išgelbėtų fenotipų heksanukleotidų pakartotinio išsiplėtimo specifiką, mes panaudojome anksčiau nustatytus GR36 ir PR36 muselius 16, kurie atitinkamai ekspresuoja 36 kartotinius poli-Gly-Arg ir poly-Pro-Arg DPR, naudodami alternatyvius kodonus. Kaip pranešta pradiniame tyrime 16, GR36 musių mirtingumas yra didelis ir tik kelios GR36 musės, sukryžiuotos su Ctrl arba SRSF1 -RNAi, išgyveno iki pilnametystės. Nepaisant to, dalinis SRSF1 išeikvojimas nepalengvino grubių akių fenotipų (2f pav.) Ar lokomotorinių trūkumų (2 g pav.), Kuriuos sukėlė nuo G4C2 nepriklausoma DPR raiška tiek GR36, tiek PR36 išreiškiančiose musėse. Šie rezultatai rodo, kad dalinis SRSF1 sunaikinimas daro tiesioginį poveikį C9ORF72 heksanukleotido pakartotiniam ekspansijai, o ne netiesioginis poveikis genų ekspresijos pokyčiams ar DPR kaupimui pasroviui.

SRSF1 sumažėjimas mažina astrocitų sukeliamą neurotoksiškumą

Norėdami pritaikyti savo in vivo duomenis su žmogaus C9ORF72 susijusiu ALS, mes stengėmės sunaikinti SRSF1 paciento ląstelių modeliuose. Žmogaus SRSF1 numušimo plazmidės, kurios kartu išreiškia GFP reporterį, ir pre-miRNR kasetę, buvo sukurtos gaminti rekombinantinį SRSF1- RNAi lentivirusą (LV- SRSF1- RNAi) (papildomas 1a pav.). HEK293T ląstelės, kartu transfekuotos su SRSF1- RNAi konstruktais ir su FLAG pažymėta SRSF1 ekspresijos plazmidė, parodė veiksmingą ir specifinį SRSF1 išeikvojimą (3a pav.). C9ORF72-ALS iš paciento gaunamų neuronų išgyvenamumas ir morfologija nesiskiria nuo 9, 10 kontrolinių neuronų. Taigi mes įvertinome motorinių neuronų išgyvenamumą kultūrose su paciento išvestais astrocitais, naudodamiesi mūsų neseniai sukurtu tyrimu, kuriame pakartojamas astrocitų sukeliamas neurotoksiškumas, stebėtas ALS, tiek pirminiams pelių, tiek žmogaus gaunamiems neuronams 52 .

Image

( a ) Neransfekuotos HEK293T (UT), kontrolinės (Ctrl) -RNR, SRSF1-RNR arba LV-SRSF1-RNR ir FLAG pažymėtos SRSF1 transfekuotos ląstelės buvo ištirtos praėjus 72 val. po transfekavimo, naudojant imunoblotus, naudojant anti-FLAG, anti-ALYREF ir pakrovimo kontroliniai anti-α-tubulino antikūnai. ( b ) SRSF1 ir ALYREF transkripto lygiai buvo kiekybiškai įvertinti atliekant qRT – PGR analizę, normalizavus U1 snRNR lygius trijuose biologinių pakartojimų eksperimentuose (vidurkis ± sem; dvipusė ANOVA su Tukey korekcija keliems palyginimams; N (qRT – PGR reakcijos) = 6). Buvo naudojamos trys kontrolinės (Ctrl-pat) ir trys C9ORF72-ALS (C9-ALS-pat) spalvotos pacientų linijos. c ) reprezentatyvūs imunofluorescencinės mikroskopijos vaizdai iš iAstrocitų ir motorinių neuronų kultūrų. iAstrocitai, gauti iš kontrolinių (vaizdas iš kairės pusės) ir C9ORF72-ALS pacientų (vaizdas iš apačios kairėje), buvo perduoti naudojant Ad-RFP kaip viruso kontrolę ir kultivuojami Hb9GFP + motoriniais neuronais (žalia). Kaip buvo pranešta anksčiau, C9ORF72-ALS iAstrocitai pasižymi toksiškumu motoriniams neuronams. Kontrolinių Ad-RFP iAstrocitų perdavimas kartu su LV-SRSF1-RNRi, išreiškiančiais GFP, sąlygojo nuoseklų Hb9GFP motorinių neuronų išgyvenimą kontroliniuose astrocituose (vaizdas iš dešinės pusės) ir motorinių neuronų išgyvenamumo padidėjimą C9ORF72-ALS astrocituose (vaizdas apačioje dešinėje). . Rodyklės rodo motorinių neuronų aksonų pavyzdžius. Mastelio juosta, 50 μm. ( d ) Ta pati kontrolinė (Ctrl-pat) ir C9ORF72-ALS (C9-ALS-pat) spalvomis pažymėtos pacientų eilutės (kaip ir b punkte) naudojamos Hb9-GFP + motorinių neuronų skaičiui kiekybiškai įvertinti keturiuose biologiniuose kultūrų pakartojimuose. astrocitų ir motorinių neuronų 3 dieną (vidurkis ± sem; ANOVA vienpusis su Tukey pataisa daugybiniams palyginimams; N (Hb9-MNs) = Ctrl-pat154: 567/589/582/500, Ctrl-pat154 + SRSF1-RNAi : 620/543/504/349, Ctrl-pat155: 602/610/553/571, Ctrl-pat155 + SRSF1-RNAi: 554/584/532/516, Ctrl-pat209: 519/599/584/535, Ctrl -pat209 + SRSF1-RNAi: 617/486/425/572, C9-ALS-pat78: 352/279/294/258, C9-ALS-pat78 + SRSF1-RNAi: 569/451/398/583, C9-ALS -pat183: 200/188/154/145, C9-ALS-pat183 + SRSF1-RNAi: 480/420/380/399, C9-ALS-pat201: 201/243/261/224, C9-ALS-pat201 + SRSF1 -RNR: 486/463/444/485). e ) Branduolinės ir citoplazminės RNR židinių kiekybinis įvertinimas SRSF1-RNRi perduotuose iAstrocituose (vidurkis ± pusė; dvipusis ANOVA; N (ląstelės su 1-5 RNR židiniais) = C9-ALS-pat78 + MOI0: 21, C9) -ALS-pat78 + MOI5: 20, C9-ALS-pat78 + MOI7: 22, C9-ALS-pat183 + MOI0: 21, C9-ALS-pat183 + MOI5: 24, C9-ALS-pat183 + MOI7: 22, C9 -ALS-pat201 + MOI0: 24, C9-ALS-pat201 + MOI5: 23, C9-ALS-pat201 + MOI7: 22). > 95% ląstelių, turinčių RNR židinius, iš viso sudarė 5 ar mažiau. Statistinis duomenų reikšmingumas nurodomas taip: NS: nereikšmingas, P ≥0, 05; * P <0, 05; ** P <0, 01; *** P <0, 001; **** P <0, 0001.

Visas dydis

Žmogaus iNPC (sukeltų nervinių progenitorinių ląstelių) diferencijuotų astrocitų (iAstrocitų) perdavimas naudojant virusinę daugybinę infekciją (MOI) iš 5 lemia efektyvų transkripto numušimą, palyginamą su lygiais, pasiektais in vivo neuroprotektuotose G4C2x36 + SRSF1- RNAi, Drosoparyla. ). Pelės GFP-Hb9 + motoriniai neuronai buvo pasodinti į LV- SRSF1-RNAi perduotus astrocitus, gautus iš trijų kontrolinių ir trijų C9ORF72-ALS paciento fibroblastų linijų (1 lentelė), ir automatiškai skaičiuojami kiekvieną dieną tris dienas, naudojant didelio pralaidumo vaizdo gavimo sistemą (papildomas pav. 2b, Metodai). Kiekybiškai įvertinus SRSF1 ir ALYREF mRNR lygius, buvo patvirtintas specifinis ir dalinis SRSF1 nuorašų sunaikinimas tiek kontroliniame, tiek C9ORF72-ALS iAstrocituose (3b pav.). Kontroliniai iAstrocitai, perduoti su RFP-adenovirusu (raudona), efektyviai palaikė GFP-Hb9 + motorinių neuronų augimą (žali), tuo tarpu mažiau motorinių neuronų išgyveno, kai buvo auginami kartu su astrocitais, gautais iš C9ORF72-ALS paciento fibroblastų 52 (3c pav.). Išgyvenusių motorinių neuronų kiekybinis įvertinimas iš keturių pakartotų eksperimentų parodė, kad nors SRSF1 išeikvojimas nepakenkia kontrolinėms kultūroms, tačiau motorinių neuronų žūtį užkirto kelią SRSF1 išeikvojimas kultūrose, gautose iš trijų atskirų C9ORF72-ALS atvejų (3d pav.) .

Pilno dydžio lentelė

Norėdami ištirti galimus G4C2 pakartotinių nuorašų branduolinio eksporto pokyčius, aklinuose eksperimentuose kiekybiškai įvertinome branduolinės ir citoplazminės RNR židinius C9ORF72-ALS iAstrocituose. Reprezentatyvūs vaizdai ir pavienių asmenų skaičius atitinkamai pateikiami papildomame 3 pav. Ir 1 papildomoje lentelėje. Ištirpus SRSF1, vidutinis židinių skaičius ląstelėse išliko panašus. Tačiau sumažėjus SRSF1 išeikvojimui (3e pav.), Citoplazminės RNR židinių skaičius sumažėjo, o branduolinės RNR židiniai tuo pačiu padidėjo (3e pav.), Atsižvelgiant į galimą G4C2 pakartotinių nuorašų branduolinio eksporto slopinimą.

Nuo RAN priklausomas DPR transliacija neuronų ląstelių modeliuose

Norėdami ištirti, ar SRSF1 surišimas su G4C2-prasmės ir C4G2-antisense pakartotinėmis RNR sekomis gali sukelti pakartotinių nuorašų branduolinį eksportą, mes sukūrėme sintetines žinduolių ekspresijos konstrukcijas, turinčias didėjantį grynų kartotinių sekų ilgį, jei nėra ATG ar Kozako. elementai, skirti konkrečiai tirti nuo RAN priklausomą dipeptido kartotinių baltymų vertimą. Atkaitindami sintetinius G4C2 arba C4G2 pakartotinius oligonukleotidus, kaip aprašyta Metodose ir papildomame 4a – d pav., Mes sukūrėme plazmides, išreiškiančias nuorašus, turinčius 15 arba 38 nenutrūkstamus juslių pakartojimus (G4C2x15 arba G4C2x38) ir 15 arba 39 nenutrūkstamus antisensex pakartojimus (G4C2xx39). kiekviename iš trijų rėmų su 3′-galo sustojimo kodonais (4a pav.). Kartojimų ilgis buvo patvirtintas sekvenavimu ir poliakrilamido gelio elektroforeze. Nukleotidų sekos pateiktos papildomame 4e pav. Žinduoliuose didžiulis branduolinis mRNR eksportas daugiausia susijęs su TREX komplekso įdarbinimu splaisingo metu 53 . Iš C9ORF72 geno yra perrašomi trys C9ORF72 nuorašai, kiekviename iš kurių yra 4 arba 10 intronų. Norint ištirti G4C2 ir C4G2 pakartotinių RNR sekų pakartotiniuose nuorašuose branduolinio eksporto potencialą, nepriklausomai nuo funkcinio susiejimo su pre-mRNR susiejimu, sintetinės kartotinės konstrukcijos buvo suprojektuotos be sujungimų elementų ar vidinių sekų. Pelių neuronų N2A ląstelių transfekcijos su sensaciniais ar antisense kartotiniais konstruktais sąlygojo RNR židinių susidarymą visiems pakartotiniams nuorašams (4b pav., Duomenys parodyti G4C2x38 konstruktui) ir specifinei DPR gamybai poli-Gly-Pro (išreikštam iš abiejų). senso ir antisense nuorašai) ir poli-Gly-Ala (išreikšta po juslių nuorašais) pakartotiniams nuorašams, turintiems 38 senso ar 39 antisenso pakartojimus (4c pav.). Įdomu tai, kad DPR ekspresija koreliuoja su neurotoksiniu poveikiu MTT ląstelių proliferacijos tyrimuose, tuo tarpu kontrolinė plazmidė arba konstruktai, išreiškiantys 15 senso ar antisense, kartojasi, bet nė vienas DPR neparodė reikšmingo citotoksiškumo neuronų ląstelėse (4d pav.). Mes darome išvadą, kad minimalūs G4C2x38 prasmės ir C4G2x39 antisenso pakartotiniai RNR nuorašai gali būti eksportuojami į citoplazmą nepriklausomai nuo funkcinio sujungimo su pre-mRNR splaisingais ir yra substratai vėlesniam RPR vertimui iš DPRs.

Image

a ) Konstrukcijų atvaizdai diagramoje. ( b ) S4 G2C2 RNR židiniai, dažyti Cy3 pažymėtu antisense C4G2 zondu. DAPI buvo naudojamas dažyti neuronų N2A ląstelių branduolius mėlynai. Svarstyklės, 5 μm. c ) Western blot iš N2A ląstelių, perkeltų kontroline stuburo plazmidė (be DPR Ctrl) arba tos pačios plazmidės, išreiškiančios arba 15 nenutrūkstamų G4C2-jutimo pakartojimų (G4C2x15), 38 nepertraukiamus G4C2-jutimo pakartojimus (G4C2x38), 15 nenutrūkstamų C4G2-. antisense pakartojimas (C4G2x15) arba 39 nenutrūkstamas C4G2-antisense pakartojimas (C4G2x39). Membranos buvo tiriamos antikūnais prieš poli-Gly-Pro DPR, poly-Gly-Ala DPR arba kontrolinį α-tubuliną. ( d ) MTT ląstelių proliferacijos tyrimas, atliktas su N2A ląstelėmis, perkeltomis kontrolinio stuburo plazmidėmis (be DPR Ctrl) arba ta pačia plazmidė, išreiškiančia įvairaus ilgio nenutrūkstamus heksanukleotidų pakartotinius nuorašus trijuose biologinių pakartojimų eksperimentuose (vidurkis ± pus; vienpusis ANOVA su Tukey pataisa keliems palyginimams; N (OD650 reikšmės) = 12). Statistinis duomenų reikšmingumas nurodomas taip: NS: nereikšmingas, P ≥0, 05; * P <0, 05; ** P <0, 01; *** P <0, 001; **** P <0, 0001.

Visas dydis

SRSF1 sumažėjimas slopina DPR gamybą neuronų ląstelėse

Pelės SRSF1 numušimo plazmidė, kartu išreiškianti GFP reporterį ir pre-miRNR kasetę, buvo sukurta panašiai kaip anksčiau aprašytas žmogaus SRSF1- RNAi (papildomas 1b pav.). Pelių neuronų N2A ląstelių transfekcija G4C2x38 arba C4G2x39 kartotinėmis konstrukcijomis ir pelės SRSF1- RNAi plazmidėmis žymiai sumažino tiek jutimo, tiek antisense DPR RAN vertimą (5a pav., Kairiosios plokštės ir 5b pav. Kiekybiškai įvertinti). SRSF1- RNAi priklausomas DPR produkcijos slopinimas nepriklauso nuo SRSF1 splaisingo aktyvumo, nes RAN konstrukcijose nėra susiuvimo vietų. Be to, SRSF1 išeikvojimas būdingas heksanukleotidų kartojimo sekoms, nes sintetiniai 36-pakartotiniai poli-Gly-Pro (GP36) arba 36-pakartotiniai poli-Gly-Ala (GA36) DPR yra ekspresuojami naudojant alternatyvius kodonus (sekos pateikiamos papildomame pav. 5) nekeičiamas, kai SRSF1 išeikvojama (5a pav., Dešiniosios plokštės ir 5c – d pav., Jei reikia GP36 ir GA36 kiekybinių įvertinimų). Šie rezultatai patvirtina mūsų ankstesnes išvadas, kad SRSF1 išeikvojimas nepagerino grubių akių fenotipų (2f pav.) Ar lokomotorinių trūkumų (2 g pav.), Kuriuos sąlygojo nuo G4C2 nepriklausomos GR36 ir PR36 DPR išraiškos Drosophila .

Image

a ) Western blotai iš N2A ląstelių, kartu transfekuotų su Ctrl arba SRSF1-RNRi vektoriu ir kontrolinio stuburo plazmidė (be DPR Ctrl) arba tos pačios plazmidės, išreiškiančios 38 nenutrūkstamus G4C2 jutimo pakartojimus (G4C2x38) arba 39 nenutrūkstamus C4G2-antisensus. - kartojasi (C4G2x39). Sense / antisense poly-Gly-Pro ir sense poli-Gly-Ala DPR baltymai gaminami atliekant vidinį pakartotinį RAN vertimą, jei nėra pradinio kodono (nukleotidų sekos papildomame 4 pav.). Heksanukleotidų kartojimo specifiškumo kontrolė buvo atlikta kartu transfekcija plazmidės, ekspresuojančios poli-Gly-Ala (GA36) arba poli-Gly-Pro (GP36), nepriklausomai nuo G4C2 / C4G2 pakartojimų (nukleotidų sekos papildomame 5 pav.) Ir arba Ctrl, arba SRSF1-RNRi vektoriai. ( b ) Vakarų blotai, parodyti ne DPR Ctrl, G4C2x38 ir C4G2x39 eksperimentams, buvo kiekybiškai įvertinti per tris biologinius pakartojimo eksperimentus (vidurkis ± sem; dvipusė ANOVA su Tukey korekcija keliems palyginimams; N = 3). ( c, d ) Vakarų blotai, parodyti GP36 ( c ) ir GA36 ( d ) skydeliuose, buvo kiekybiškai įvertinti per tris biologinius pakartojimo eksperimentus (vidurkis ± sem; dvipusis ANOVA su Tukey korekcija daugybiniams palyginimams; N = 3). e ) Visi N2A ląstelių ekstraktai, transfekuoti naudojant FLAG kontrolę (FLAG ctrl) ir FLAG pažymėtą SRSF1 aa11-196 laukinio tipo (SRSF1), SRSF1-m2 arba SRSF1-m4, yra imunoforecipituoti. Bendras endogeninio NXF1 nusėdimas įvertinamas naudojant α-NXF1 antikūnus. ( f ) Western blotai iš N2A ląstelių, kartu transfekuotų su G4C2x38 arba C4G2x39 plazmidėmis ir kontrolinėmis (FLAG Ctrl), arba su FLAG pažymėtomis SRSF1 aa11-196 laukinio tipo (SRSF1), SRSF1-m2 ar SRSF1-m4. ( g, h ) „Western“ blotai, parodyti f, nurodant G4C2-prasmės ( g ) ir C4G2-antisenzės ( h ) kartojimo plokštes, buvo kiekybiškai įvertinti trimis biologinio kartojimo eksperimentais (vidurkis ± sem; dvipusė ANOVA su Tukey pataisa daugybiniams palyginimams); N = 3). ( i ) MTT ląstelių proliferacijos tyrimas, atliktas su N2A ląstelėmis, perkeltomis G4C2x38 arba C4G2x39 plazmidėmis ir Ctrl-RNR, SRSF1-RNR, FLAG Ctrl, SRSF1 arba SRSF1-m4 trimis biologinių replikacijų eksperimentais (vidurkis ± sem; vienpusis ANOVA su Tukey pataisa keliems palyginimams; N (OD650 reikšmės) = 12). Statistinis duomenų reikšmingumas nurodomas taip: NS: nereikšmingas, P ≥0, 05; * P <0, 05; ** P <0, 01; *** P <0, 001; **** P <0, 0001.

Visas dydis

SRSF1 tarpininkauja mRNR branduolio eksportui, prisijungdamas prie NXF1 (nuorodos 34, 54). Anksčiau mes parodėme, kad tiek RNR branduolio eksportui, tiek sąveikai su NXF1 reikalingi keturi arginino liekanos, esančios nestruktūruotame ryšyje tarp dviejų SRSF1 RNR atpažinimo motyvų (11–196 aminorūgštys), tuo tarpu tik dviejų arginino liekanų mutacijos šiek tiek sumažina prisijungimas prie NXF1 žmogaus embrioninių inkstų ląstelėse 36 . Panašiai, endogeninis NXF1 yra specialiai imunoprecipituojamas neuronų N2A ląstelėse, perkeltose su FLAG pažymėtu SRSF1 11-196 laukinio tipo arba dvigubu R117, 118A mutantu (SRSF1-m2). Priešingai, NXF1 bendras imuninis nusėdimas yra smarkiai pablogėjęs dėl keturių SRSF1 (SRSF1-m4) R93, 94, 117, 118A mutacijų (5e pav.). Bendras keturkojo SRSF1-m4 dominuojančio mutanto transfekcija dar labiau sumažino tiek senso, tiek antisense DPR gamybą, o laukinio tipo seka arba variantas, turintis atitinkamai dvi arginino mutacijas (SRSF1-m2), neturėjo jokio poveikio arba turėjo mažai įtakos. (5f pav.). Tai buvo statistiškai įvertinta tiek poli-GP, tiek poli-GA DPR, gautų iš sensacinių pakartojimų nuorašų (5g pav.), Ir poli-GP DPR, gautų iš antisenzinių pakartotinių nuorašų (5h pav.). Visi mūsų duomenys rodo, kad C9ORF72 pakartotinių nuorašų išraiška priklauso nuo mechanizmo, kuriam reikalinga SRSF1 sąveika su branduolio eksporto receptoriu NXF1. Atitinkamai, tiek SRSF1 išeikvojimas, tiek dominuojančio neigiamo mutanto SRSF1-m4 ekspresija slopina neurotoksiškumą, kurį sukelia C9ORF72 pakartotinių nuorašų ekspresija neuronų N2A ląstelėse (5i pav.). Remdamasis tuo, RNAi sukeliamas Drosophila NXF1 homologo, sbr, išeikvojimas galėtų išgelbėti lokomotorinių trūkumų lervose ir suaugusiose musėse, išreiškiančiose G4C2x36 (papildomas 6 pav.).

Pakartotinis SRSF1 sekvestracija skatina RNR branduolinį eksportą

Mūsų rezultatas, rodantis, kad SRSF1-m4 mutanto baltymo raiška veikia kaip dominuojantis neigiamas mutantas DPR gamyboje, rodo, kad SRSF1-m4 baltymas yra sekvestruojamas heksanukleotidų pakartotiniuose nuorašuose, o ne endogeniniame SRSF1 baltyme, užkertant kelią savo ruožtu pakartotinių nuorašų sąveikai su NXF1 ir branduolinis eksportas. Naudodami in vitro UV kryžminio sujungimo testus, mes patvirtinome, kad išgrynintas rekombinantinis heksa-histidinu pažymėtas SRSF1-m4 baltymas išlaiko galimybę tiesiogiai sąveikauti su sintetiniu 5'-galo 32P-radioaktyviu ženklu G4C2x5 (6a pav.) Ir antisense C4G2x5. (6b pav.) Pakartokite RNR. Ši sąveika yra specifinė, nes nebuvo rasta RNR, jei nebūtų švitinamas UV spinduliais arba su neigiamu kontroliniu baltymu MAGOH. Toliau mes siekėme ištirti, ar tai taip pat tinka gyvoms N2A ląstelėms, naudojant RNR imunoprecipitacijos (RIP) tyrimus. N2A ląstelės buvo transfekuotos naudojant FLAG kontrolę, FLAG pažymėtą SRSF1 arba FLAG pažymėtą SRSF1-m4 ir įvairaus ilgio sensacinius ar antisensinius pakartotinius nuorašo konstruktus prieš fiksuojant ribonukleoproteinų kompleksus. Tada ląstelių ekstraktams buvo atliekamas imuninis nusėdimas anti-FLAG tomis pačiomis sąlygomis, kurios buvo naudojamos kartu imunoprecipimentuojant NXF1 (5e pav.), Prieš atliekant SRSF1 susietų RNR molekulių qRT – PCR analizę. Patvirtinus mūsų RIP analizę, imuninis Scipf1 arba SRSF1-m4 nusėdimas sąlygojo specifinį SMN , žinomo SRSF1 rišiklio 55, bet ne JUN , nusodinimą. Tai neintronuojamas kontrolės stenograma, kurios, kaip tikimasi, SRSF1 neįpareigoja (nuoroda 56)., N2A ląstelėse, išreiškiančiose arba jutimą (6c pav.), arba antisense (6d pav.), pakartokite nuorašus. Atliekant staigų kontrastą, imunoprecipifikuotų G4C2-prasmės arba C4G2-antisenso pakartotinių nuorašų lygis žymiai padidėjo, kai buvo pakartota heksanukleotidų pakartojimų (6c pav., D), rodančių SRSF1 ir SRSF1-m4 pakartojimų RNR sekvestraciją neuronų ląstelėse.

Image

( a, b ) Baltymai: RNR UV kryžminio sujungimo tyrimai, naudojant išgrynintus rekombinantinius baltymus ir 32P galo radioaktyviai paženklintus G4C2x5 ( a ) ir C4G2x5 ( b ) pakartotus RNR zondus. Baltymai vizualizuojami SDS-PAGE dažais, dažytais Coomassie mėlyna spalva (kairiajame skydelyje) ir kovalentiškai susietose RNR: baltymų kompleksuose, atliekant autoradiografiją „PhosphoImages“ (dešiniosios plokštės). ( c, d ) RNR imunoprecipitacijos (RIP) tyrimai. Formaldehidas buvo pridėtas prie terpės gyvų N2A ląstelių, kartu transfekuotų su G4C2x15, G4C2x38 ( c ), C4G2x15 arba C4G2x39 ( d ), ir su FLAG kontrole (FLAG Ctrl), FLAG pažymėtu SRSF1 aa11-196 laukinio tipo (SRSF1) arba SRSF1-m4 buvo nusodintas anti-FLAG. Išgryninta RNR buvo analizuojama qRT – PGR, normalizavus U1 snRNR lygius, atliekant tris biologinius pakartojimų eksperimentus (vidurkis ± sem; dvipusė ANOVA su Tukey korekcija keliems palyginimams; N (qRT – PGR reakcijos = 6). e ) N2A ląstelių, gautų kartu su G4C2x38 ir Ctrl arba SRSF1-RNAi plazmidėmis arba su G4C2x38, ir su FLAG pažymėtu SRSF1 aa11-196 laukinio tipo (SRSF1), arba SRSF1-m4, vakarų blotai, kuriems atlikta hipotoninė ląstelių frakcija. lizė, norint gauti citoplazmines frakcijas. Chromatino rekonstravimo SSRP1 faktorius yra naudojamas norint patikrinti galimą branduolio užterštumą. ( f ) Citoplazminio ir bendrojo G4C2 pakartotinio pojūčio transkripto lygiai buvo normalizuoti iki U1 snRNR lygio per tris biologinius pakartojimų eksperimentus prieš brėžinį kaip santykį, siekiant atsižvelgti į galimus mRNR transkripcijos / stabilumo pokyčius (vidurkis ± sem; vienpusė ANOVA su Tukey'u). korekcija keliems palyginimams; N (qRT – PGR reakcijos) = 6). g ) Drosophila, išskiriančio G4C2x36 ir Ctrl arba SRSF1-RNRi, Western blotai, ląstelių frakcionavimas naudojant hipotoninę lizę, kad būtų gautos citoplazminės frakcijos. Histonas H3 naudojamas norint patikrinti galimą branduolio užteršimą. ( h ) Citoplazminio ir bendrojo G4C2 pakartotinio pojūčio transkripto lygiai buvo normalizuoti iki Tub84b lygio trijuose biologinių pakartojimų eksperimentuose prieš brėžinį kaip santykį, siekiant atsižvelgti į galimus mRNR transkripcijos / stabilumo pokyčius (vidurkis ± pusė; suporuotas dvipusis t- testas) ; N (qRT – PGR reakcijos) = 3). Priešingai nei citoplazminiame lygyje, bendras heksanukleotidų pakartotinių nuorašų lygis reikšmingai nepakito išrašant SRSF1-m4 ar išeikvojus SRSF1 ląstelėse ar musėse (papildomas 7 pav.). Statistinis duomenų reikšmingumas nurodomas taip: NS: nereikšmingas, P ≥0, 05; * P <0, 05; ** P <0, 01; *** P <0, 001; **** P <0, 0001.

Visas dydis

Norėdami įvertinti SRSF1 išeikvojimo ar SRSF1-m4 ekspresijos poveikį branduoliniam C9ORF72 pakartotinių nuorašų eksportui, išmatuojome bendrą ir citoplazminį G4C2x38 nuorašų lygį, esant Ctrl ar SRSF1- RNAi ir SRSF1 ar SRSF1-m4 transfekuotose N2A ląstelėse. . Ląstelių frakcionavimo kokybė buvo patikrinta atlikus imunoblotus, naudojant antikūnus prieš chromatiną rekonstruojantį SSRP1 faktorių (6e pav.), Rodantį, kad citoplazmos frakcijose nėra reikšmingo branduolinio užteršimo. Bendras G4C2x38 nuorašų lygis reikšmingai nepakinta dėl SRSF1- RNAi ar SRSF1-m4 ekspresijos, tuo tarpu citoplazmos G4C2x38 nuorašų lygis abiem sąlygomis yra ženkliai sumažėjęs (papildomas 7a pav.). Citoplazmos pakartotinio stenogramos lygiai taip pat buvo normalizuoti iki bendro lygio, kad būtų galima konkrečiai įvertinti branduolio eksporto procesą, kaip ir ankstesniuose mūsų tyrimuose 39, 44 . Citoplazmos / bendro mRNR lygio santykiai pastebimai sumažėja veikiant SRSF1- RNR (6f pav., Ctrl-RNR palyginti su SRSF1 -RNR). Panašiai SRSF1-m4 mutanto, kuris nesąveikauja su NXF1, bendras transfekcija žymiai sumažino normalizuotą citoplazmos pakartotinio stenogramos lygį (6f pav., SRSF1, palyginti su SRSF1-m4). To extend this analysis in vivo , Drosophila larvae expressing G4C2x36 and either Ctrl or SRSF1 -RNAi were subjected to the same fractionation (Fig. 6g) and transcript analysis. As with cells, total levels of G4C2x36 transcripts are not significantly altered upon SRSF1 -RNAi while the cytoplasmic levels of G4C2x36 transcripts are markedly reduced (Supplementary Fig. 7b). Consequently, the cytoplasmic/total mRNA level ratio is significantly reduced upon exposure to SRSF1 -RNAi (Fig. 6h). Together these data demonstrate that depleting SRSF1 or preventing its repeat RNA-sequestration and interaction with NXF1 specifically inhibit the nuclear export of hexanucleotide repeat transcripts in vitro and in vivo .

Antagonizing SRSF1 alters DPRs production in primary neurons

We next sought to validate our findings in primary neurons. Due to high background staining obtained with poly-GP and poly-GA antibodies, we expressed V5 tags in all three frames downstream of the G4C2x38 repeat sequence (Supplementary Fig. 8) to simultaneously detect all DPR species using the more specific and sensitive anti-V5 antibody. Cultured rat cortical neurons were transfected with the G4C2x38-3xV5 construct and either the Ctrl-RNAi, SRSF1 -RNAi, SRSF1 or SRSF1-m4 expression plasmids prior to immunofluorescence studies. The nucleotide sequence targeted by the SRSF1 -RNAi miRNA hairpin-1 is identical in human, mouse and rat SRSF1 (Methods, Supplementary Fig. 1b). Microscopy image examples of DPR-negative and DPR-positive neurons are presented in Fig. 7a. The proportion of DPR-positive neurons in approximately 100 successfully transfected neurons from two independent experiments was quantified in each group and all counts were performed blinded. Depletion of SRSF1 led to a significant reduction (25%) in the proportion of neurons with RAN-translated DPR-staining compared to neurons transfected with Ctrl-RNAi (Fig. 7b). Inhibiting the sequestration of endogenous SRSF1 and the interaction with NXF1 by recruitment of the SRSF1-m4 dominant mutant also led to a similar and significant reduction of neurons expressing DPRs compared to neurons transfected with wild-type SRSF1 (Fig. 7c). Only cells showing absence of DPRs were counted DPR-negative. It is very likely that the effects of the SRSF1 -RNAi or SRSF1-m4 expression have been under-estimated since neurons expressing reduced amounts of DPRs would still have been scored as DPR-positive. We concluded that our findings in N2A cells were corroborated in cultures of primary neurons.

Image

( a ) Immunofluorescence microscopy of cultured rat cortical neurons. DPRs were detected in the red channel using anti-V5 and anti-mouse ALEXA594 antibodies. The Ctrl-RNAi and SRSF1-RNAi constructs co-express GFP while the FLAG-tagged SRSF1 proteins were stained using an anti-FLAG antibody conjugated to FITC allowing detection and quantification of transfected neurons in the green channel. Masto juosta: 5 μm. ( b, c ) Statistical assessment of the cortical neuron counts was performed from approximately 100 transfected neurons for each group (Fisher's exact test; N (transfected neurons)=Ctrl-RNAi: 95, SRSF1-RNAi: 112, SRSF1: 106, SRSF1-m4: 121).

Visas dydis

SRSF1 depletion targets human C9ORF72 repeat transcripts

In order to investigate the nuclear export of C9ORF72 transcripts in the context of wild-type and repeat-expanded C9ORF72 genes, we differentiated motor neurons from established induced-neural progenitor cells (iNPCs) derived from sex/age matched control and C9ORF72-ALS patient fibroblasts 52 . Both control and C9ORF72-ALS induced iNeurons express the neuronal lineage marker Tuj1 and exhibit the propensity to form complex branching (Supplementary Fig. 9). High content imaging analysis of axonal length (Fig. 8a) and soma cell size (Fig. 8b) did not show any significant differences between control and C9ORF72-ALS differentiated iNeurons under basal culture conditions, in agreement with previous reports 9, 10 . To test a potential neuroprotective effect of SRSF1 depletion in disease relevant cells, we next differentiated iNPCs into motor neurons (iMNs), transduced them with an adenoviral vector expressing RFP under the Hb9 promoter and cultured them either in monoculture or in co-culture with control or ALS-derived iAstrocytes. We did not observe increased cell death or morphological abnormalities when the C9ORF72-ALS iMNs were cultured without astrocytes (data not shown). Remarkably, however, the transduction of SRSF1 -RNAi lentivirus in iMNs prior to co-cultures with C9ORF72-ALS iAstrocytes resulted in significantly higher survival of iMNs against the astrocytic-derived toxicity (Fig. 8c) indicating a neuroprotective effect of SRSF1 depletion in motor neurons derived from C9ORF72-ALS patients. Consistent with our previous data presented in Drosophila and neuronal cells models, we also found that depletion of SRSF1 in C9ORF72-ALS patient-derived iMNs leads to specific reduction in the expression levels of poly-GP DPRs although it appears less efficient in C9ORF72-ALS patient 78 (Fig. 8d).

Image

( a ) The axonal length of patient-derived iMNs treated or not with SRSF1-RNAi was assessed by high content imaging in three biological replicate experiments (mean±sem; one-way ANOVA with Tukey's correction for multiple comparisons, NS: non-significant; N (average axon length/well)=9). ( b ) The cell body area of patient-derived iMNs treated or not with SRSF1-RNAi was assessed by high content imaging in three biological replicate experiments (mean±sem; one-way ANOVA with Tukey's correction for multiple comparisons; N (average cell body area/well)=9). ( c ) The survival of patient-derived Ctrl or C9ORF72-ALS iMNs treated or not with SRSF1-RNAi was quantified in co-cultures with patient-derived Ctrl or C9ORF72-ALS iAstrocytes in six biological replicate experiments at day 4 (mean±sem; one-way ANOVA with Tukey's correction for multiple comparisons; N (iMNs)=Ctrl-pat209: 142/165/174/117/122/168, C9-ALS-pat78: 77/65/41/68/71/70; C9-ALS-pat78+SRSF1-RNAi: 106/84/81/97/113/83; C9-ALS-pat201: 68/69/68/62/66/74; C9-ALS-pat201+SRSF1-RNAi: 131/104/96/82/111/104). ( d ) Total protein extracts from HEK cells transfected with either Ctrl or GP36 plasmids and patient-derived iMNs transduced (MOI=5) or not (MOI=0) with LV-SRSF1-RNAi viruses are analysed by dot blots using poly-GP DPRs and loading control α-tubulin antibodies. Scale bar: 6 mm. ( e ) Western blots of iNeurons differentiated from control (Ctrl-pat 154, Ctrl-pat155) and C9ORF72-ALS (C9-ALS-pat78, C9-ALS-pat183) patients treated or not with LV-SRSF1-RNAi (MOI 0 or 5) were subjected to cellular fractionation using hypotonic lysis to yield cytoplasmic fractions. The chromatin remodelling SSRP1 factor is used to check for potential nuclear contamination in cytoplasmic fractions. Depletion of actin in nuclear fractions was used to check for quality of the nuclear fractions. The efficacy of SRSF1-RNAi was also validated by qRT–PCR achieving ∼ 80% SRSF1 mRNA knockdown (Supplementary Fig. 10). ( f ) Total, nuclear and cytoplasmic levels of intron1-spliced C9ORF72 transcripts (as measured by the exon1-exon3 junction) were quantified in two technical replicates for each of two biological replicate experiments by qRT–PCR following normalization to U1 snRNA levels and to 100% in control patients at MOI0 (mean±sem; one-way ANOVA with Tukey's correction for multiple comparisons, NS: non-significant; N (qRT–PCR reactions)=8). ( g ) Intron1-spliced C9ORF72 transcripts levels normalized to U1 snRNA levels ( d ) were plotted as a ratio SRSF1-RNAi MOI5 over MOI0 to evaluate the specific effect due to the SRSF1-RNAi (mean±sem; one-way ANOVA with Tukey's correction for multiple comparisons; N (qRT–PCR reactions)=8). ( h ) Total, nuclear and cytoplasmic levels of unspliced C9ORF72 transcripts retaining intron1 (as measured by the exon1–intron1 junction) were quantified in two technical replicates for each of two biological replicate experiments by qRT–PCR following normalization to U1 snRNA levels and to 100% for control patients at MOI0 (mean±sem; one-way ANOVA with Tukey's correction for multiple comparisons, NS: non-significant; N (qRT–PCR reactions)=8). ( i ) Unspliced C9ORF72 transcripts retaining intron1 levels normalized to U1 snRNA levels ( f ) were plotted as a ratio SRSF1-RNAi MOI5 over MOI0 to evaluate the specific effect due to the SRSF1-RNAi (mean±sem; one-way ANOVA with Tukey's correction for multiple comparisons; N (qRT–PCR reactions)=8). Statistical significance of data is indicated as follows: NS: non-significant, P ≥0.05; * P <0, 05; ** P <0, 01; *** P <0, 001; **** P <0, 0001.

Visas dydis

We next quantified the total, nuclear and cytoplasmic levels of intron-1-spliced C9ORF72 transcripts (using qPCR primers annealing in exon-1 and exon-3) 27, 28 and unspliced C9ORF72 transcripts retaining intron-1 (using qPCR primers annealing in exon-1 and in intron-1 upstream of the hexanucleotide repeat expansion) 27, 28 to evaluate the potential impact of SRSF1 -RNAi on the splicing of intron-1 and on the nuclear export of wild-type and pathological C9ORF72 transcripts. Depletion of the chromatin-remodelling factor SSRP1 in the cytoplasmic fractions and of actin in the nuclear fractions was used to validate the quality of the subcellular fractionation (Fig. 8e). The relative expression levels of SRSF1 mRNA were down regulated by approximately 80% upon SRSF1 -RNAi transduction of iNeurons differentiated from either two control or two sex/age-matched C9ORF72-ALS patient lines (Supplementary Fig. 10). No significant changes in the total, nuclear or cytoplasmic levels of intron-1-spliced transcripts were measured between control and C9ORF72-ALS iNeurons transduced or not with SRSF1 -RNAi lentivirus (Fig. 8f). The mRNA level ratios of SRSF1 -RNAi (MOI5) over untreated (MOI0) were further plotted to assess the net impact of the SRSF1 -RNAi on each cellular compartment and control or C9ORF72-ALS iNeurons (Fig. 8g). These data show that the proportion of exon1-exon3 spliced transcripts is not altered in C9ORF72-ALS neurons and that the presence of the hexanucleotide repeat expansion does not affect the splicing of intron-1, in full agreement with a recent study 27 . In addition, we also show here that the SRSF1 -RNAi has no effect on the nuclear export or the splicing of intron-1 in the spliced transcripts that lead to the production of the wild-type C9ORF72 protein. The same experimental analysis was carried out for the C9ORF72 transcripts retaining intron-1 (Fig. 8h, i). We were unable to detect significant levels (above non template control qRT–PCR reactions) of intron-1-retaining C9ORF72 transcripts in the cytoplasm of control iNeurons consistent with the nuclear retention of unspliced transcripts. In striking contrast, the presence of the hexanucleotide repeat expansion in C9ORF72-ALS patients triggers the nuclear export of C9ORF72 repeat transcripts retaining intron-1 (Fig. 8h) consistent with our previous data showing that the sequestration of SRSF1 on synthetic hexanucleotide repeat expansions promotes nuclear mRNA export through the interaction with NXF1 (Fig. 6). Whilst the depletion of SRSF1 did not affect the total level and biogenesis/stability of intron-1-retaining transcripts in control or C9ORF72-ALS iNeurons, it specifically triggers a cytoplasmic reduction and nuclear accumulation of pathological C9ORF72 repeat transcripts in C9ORF72-ALS iNeurons (Fig. 8h, i). These data demonstrate that the depletion of SRSF1 specifically inhibits the nuclear export of expanded C9ORF72 repeat transcripts. Taken together, our data show that the SRSF1 depletion has no effect on the expression level, splicing or nuclear export of wild-type spliced exon1-exon3 C9ORF72 transcripts while it specifically inhibits the nuclear export of pathological C9ORF72 transcripts retaining the hexanucleotide repeats in intron-1.

Diskusija

Microsatellite expansions of 3–6 nucleotides in coding and non-coding regions of genes cause neurodegeneration through complex mechanisms involving protein loss-of-function and protein/RNA toxic gain-of-function mechanisms 57 . The production of toxic polymeric repeat proteins by RAN translation has now been characterized in multiple neurodegenerative disorders caused by microsatellite expansions including spinocerebellar ataxia type 8 (SCA8) 58, myotonic dystrophy type 1 (DM1) 58, Fragile X-associated tremor and ataxia syndrome (FXTAS) 59, C9ORF72-ALS 6, 13, 14, 15, 16, 27 and Huntington disease (HD) 60 . However, the mechanisms involved in the nuclear export of these disease-related repeat transcripts are currently unknown.

We previously suggested that the sequestration of nuclear export adaptors onto C9ORF72 repeat transcripts might trigger the abnormal nuclear export of C9ORF72 repeat transcripts and the subsequent RAN translation of DPRs in the cytoplasm 12 . In this study, we identified for the first time the molecular mechanism driving the nuclear export of pathological C9ORF72 repeat transcripts. We investigated whether the partial depletion of two evolutionarily conserved nuclear export adaptors which avidly interact with the hexanucleotide repeat transcripts 12, ALYREF and SRSF1, would mitigate DPR-mediated neurotoxicity in an established Drosophila model of C9ORF72-ALS 16 . We discovered that the partial depletion of SRSF1 prevents in vivo neurodegeneration and suppresses the associated locomotor deficits while the depletion of ALYREF only had marginal effects. The depletion of SRSF1 in C9ORF72-ALS patient-derived motor neurons also conferred neuroprotection of motor neurons in co-culture with C9ORF72-ALS astrocytes. Moreover, we also showed that this intervention does not affect the morphology or the growth of control and C9ORF72-ALS patient-derived motor neurons. On the other hand, the depletion of SRSF1 in patient-derived C9ORF72-ALS astrocytes significantly suppressed motor neuron death in a co-culture system. The mechanisms for suppression of astrocyte-mediated neurotoxicity remain however to be determined. They might involve a modification of the RNA or protein composition in the extra-cellular exosomes released by astrocytes.

Using neuronal N2A cells, we demonstrated that the nuclear export of C9ORF72 repeat transcripts and subsequent RAN translation depends on the interaction of SRSF1 with the nuclear export receptor NXF1. Depleting SRSF1 or inhibiting its endogenous RNA-repeat sequestration and interaction with NXF1 lead to a marked inhibition of the nuclear export of C9ORF72 repeat transcripts and RAN translation of sense and antisense DPRs to prevent C9ORF72 repeat-mediated neurotoxicity. We also showed that the SRSF1-dependent inhibition of the nuclear export of C9ORF72 repeat transcripts leads to altered production of DPRs in Drosophila and patient-derived motor neurons. We noted some variability in the efficiency of the SRSF1 depletion in patient-derived motor neurons. This might be due to variation between expression levels of DPRs and/or genetic background of patients-derived cells. Importantly, the depletion of SRSF1 in control or C9ORF72-ALS patient-derived neurons does not affect the expression levels or the nuclear export of intron-1-spliced transcripts required for the translation of the wild-type C9ORF72 protein. This also indicates that the nuclear export of non-repeat C9ORF72 transcripts does not depend on the nuclear export adaptor SRSF1. In sharp contrast to control neurons, the presence of the hexanucleotide repeat expansion in intron-1 of C9ORF72 transcripts led to SRSF1-dependent mRNA nuclear export, while depletion of SRSF1 specifically inhibits the nuclear export but not the levels or splicing of C9ORF72 transcripts retaining expanded hexanucleotide repeats in intron-1. Taking these data together, we show that sequestration of SRSF1 onto C9ORF72 hexanucleotide repeats is able to license the NXF1-dependent nuclear export of pathological C9ORF72 repeat transcripts without functional coupling of the nuclear export process to pre-mRNA splicing. This explains in turn why the depletion of SRSF1 has no effect on the level, intron-1-splicing or nuclear export of wild-type C9ORF72 transcripts.

In conclusion, we have elucidated for the first time the molecular mechanism driving the nuclear export of pathological C9ORF72 repeat transcripts which allows for RAN translation of dipeptide repeat proteins in the cytoplasm (Fig. 9a). The depletion of SRSF1 specifically inhibits the nuclear export of the pathologically expanded C9ORF72 transcripts without interfering with biogenesis/processing of the wild-type C9ORF72 transcripts (Fig. 9b). The expression of the engineered SRSF1-m4 protein, which retains specific ability to be sequestered on repeat transcripts but fails to effectively interact with NXF1, also inhibits the nuclear export of repeat transcripts and the production of DPRs. (Fig. 9c). Both these interventions represent promising prospects for the development of an effective neuroprotective strategy in C9ORF72-related ALS. The effects of antagonizing SRSF1 in the vertebrate brain remain to be elucidated in wild-type mice as well as in murine C9ORF72-ALS models. Interestingly, it was recently shown that whilst SRSF1 directly binds thousands of transcripts, the depletion of SRSF1 in isolation affects the nuclear export of only 225 transcripts (<1% transcribed coding genes) due to the presence of 6 additional SRSF factors (SRSF2-7) which act as redundant NXF1-dependent nuclear export adaptors 46 . The cellular pathways causing C9ORF72 repeat-mediated neurodegeneration and the precise mechanism(s) of neuroprotection conferred by the targeting of SRSF1 remain to be elucidated in future studies.

Image

( a ) The nuclear export of sense and antisense C9ORF72 transcripts retaining expanded hexanucleotide repeats in intron1 specifically depend on the sequestration of SRSF1 and its interaction with the nuclear export receptor NXF1. In contrast, the nuclear export of intron1-spliced C9ORF72 transcripts required for the production of the C9ORF72 protein does not involve the interaction of SRSF1 with NXF1 however the nuclear export adaptor(s) (NEA) remain to be identified. ( b ) The depletion of SRSF1 specifically inhibits the nuclear export of C9ORF72 transcripts retaining expanded hexanucleotide repeats in intron1, likely due to a reduction in the sequestration of endogenous SRSF1 onto the C9ORF72 hexanucleotide repeats and failure to abnormally remodel NXF1 in a high RNA-binding mode, while it does not affect the expression levels and splicing/retention of intron1. Moreover, the depletion of SRSF1 does not affect the expression levels, the splicing of intron1 or the nuclear export of wild-type intron1-spliced C9ORF72 transcripts required for the production of the C9ORF72 protein. ( c ) Over-expression of the SRSF1-m4 protein, which fails to interact efficiently with NXF1, competes endogenous SRSF1 for sequestration onto hexanucleotide repeats preventing in turn interactions with NXF1 and nuclear export of C9ORF72 repeat transcripts.

Visas dydis

Inhibiting the nuclear export of repeat transcripts might also confer neuroprotection in other microsatellite expansion disorders. However, it will remain essential to determine pathophysiological contributions between polymeric repeat protein production and RNA-mediated toxicity by nuclear retention of transcripts and/or sequestration of RNA-processing factors on repeat transcripts. While expression of repeat proteins can kill cells in vitro , it is difficult to evaluate the levels of RAN-translation in patients and the thresholds required for triggering neurotoxicity which will differ depending on the nature of the repeat expansions, the disease in question and the cell types. There is however growing evidence for a pathogenic role of RAN-translation and the data presented here fully support this. For example, FXTAS was initially thought to be caused by intranuclear retention of transcripts and sequestration of splicing factors 61, 62 . However, the discovery of RAN translation in the same model challenged this view 59 . Similarly, in C9ORF72-ALS, a 10-fold increase in the number of intranuclear RNA foci does not significantly alter survival or global RNA processing, while expression of DPRs caused neurodegeneration 27 in full agreement with the data presented here. Partial depletion of individual nuclear export adaptors does not appear to be detrimental to the functioning of higher eukaryotic cells. Therefore, they might constitute viable therapeutic targets for inhibiting the nuclear export of repeat transcripts and the production of toxic repeat proteins, particularly in neurodegenerative diseases where RAN-translation appears to have a prominent pathological role.

Metodai

Drosophila husbandry and locomotor assays

Drosophila were raised under standard conditions on a molasses, cornmeal and yeast based food in 12 h:12 h light:dark cycle at 25 °C unless otherwise stated. All C9ORF72 transgenic lines 16 were a gift from Adrian Isaacs and Linda Partridge (University College London). GMR-GAL4 , D42-GAL4 , nSyb-GAL4 , da-GAL4 , UAS- sbr -RNAi [P{TRiP.HM05135}attP2] and UAS- luciferase -RNAi [P{TRiP.JF01355}attP2], used as control-RNAi, were obtained from the Bloomington Drosophila Stock Centre (Bloomington, IN). Other UAS-RNAi lines were obtained from the Vienna Drosophila Resource Centre. References and sequences of insertions are provided in Supplementary Note 1. For larval crawling assays, transgenes were expressed by nSyb-GAL4 and animals were grown at 29 °C. Wandering third instar larvae were collected from vials, rinsed with distilled water, and placed in petri dishes with a 1% agarose matrix. Larvae were observed directly for 2 min and the number of peristaltic waves recorded. Climbing assays were performed as described 63 with transgenic expression induced by D42-GAL4 . Adult flies were tested 1-3 days after eclosion. Male flies were used for all experiments.

Drosophila light microscopy imaging and scanning electron microscopy

Eye phenotypes were analysed by induction of transgene expression by GMR-GAL4 raised at 25 °C. For light microscopy of Drosophila eyes, stacks of images were collected on a Nikon motorized SMZ stereo zoom microscope fitted with 1x Apo lens. Extended focus images were generated using Nikon Elements software. Scanning electron microscopy (SEM) was performed according to a standard protocol 64 and images were captured using a Philips XL-20 SEM microscope. All animals of a given genotype displayed essentially identical phenotypes and randomly selected representative images are shown.

Plazmidės

FLAG-tagged SRSF1/SF2/ASF plasmids were generated in ref. 36. MicroRNA sequences were designed using the 'miR RNAi' Block-IT RNAi designer tool (ThermoFisher) at Sequences are presented in Supplementary Note 2. Synthesized oligonucleotides (Sigma) were annealed and ligated into pcDNA6.2-GW/EmGFP using the BLOCK-iT PolII-miR-RNAi Expression Vector Kit with EmGFP (ThermoFisher, catalogue number K4936-00). For chaining, BamHI/XhoI-restricted pre-miR2-RNAi cassettes were subcloned into pcDNA6.2-GW/EmGFP- SRSF1 -miR1 using BglII/XhoI. The PCR fragments encompassing EmGFP and the chained SRSF1 pre-miRNA cassette were additionally cloned into the lentiviral plasmid SIN-PGK-cPPT-GDNF-WHV(9) 65 using SpeI/XhoI.

Uninterrupted C9ORF72 hexanucleotide sense GGGGCCx15 or GGGGCCx38 and antisense CCCCGGx15 or CCCCGGx39 repeats were built using the synthetic oligonucleotides 5′-(GGGGCC) 15 -3′ and 5′-CCCC-(GGCCCC) 14 -GG-3′. Oligonucleotides were annealed by heating to 99 °C for 30 min and cooling 0.5 °C min −1 to ambient with incubation at 70 °C for 10 min. Oligonucleotides were phosphorylated with T4-Polynucleotide Kinase (New England Biolabs), ligated using T4 DNA Ligase (ThernoFisher) and treated with Mung Bean nuclease (New England Biolabs) for blunt ligation. The band corresponding to trimeric oligonucleotides was gel-purified and ligated into pcDNA3.1 (Invitrogen) with blunted EcoRI ends to allow cloning in both sense and antisense orientation. Sequences are presented in Supplementary Fig. 4.

Synthetic sequences encoding poly-Gly-Pro and poly-Gly-Ala x36 DPRs independently of G4C2 repeats were first cloned into pcDNA3.1 using EcoRI/NotI. Synthetic sequences encoding poly-Gly-Pro and poly-Gly-Ala x36 were subcloned using BamHI/NotI into pCI-neo-V5-N using BclI/NotI. BclI restriction site was previously introduced into pCI-neo-V5-N by site directed mutagenesis using forward actctagaggtaccacgtgatcattctcgagggtgctatccaggc and reverse gcctggatagcaccctcgagaatgatcacgtggtacctctagagt primers.

Lentivirusinė produkcija

Twenty 10 cm dishes seeded with 3 × 10 6 HEK293T cells/dish were each transfected with 13 μg pCMVΔR8.92, 3.75 μg pM2G, 3 μg pRSV and 13 μg SIN-CMV-miRNA using calcium phosphate transfection 65 . Media was replaced after 12 and 48 h later, supernatant was collected, filtered through a 0.45 μm filter and centrifuged at 19, 000 rpm for 90 min at 4 °C using a SW28 rotor (Beckman). The viral pellet was re-suspended in PBS with 1% BSA and stored at −80'C. The biological titre of the virus was determined by transducing HeLa cells with 10 −2, 10 −3 and 10 −4 dilutions of the vector. 72 h post-transduction, the percentage of GFP positive cells was measured with a Fluorescent-Activated cell sorter (FACS, LSRII). The biological titre is expressed as the number of transducing units per ml (TU/ml) and is calculated as follows: Vector titer=[(% positive cells × total number of cells) × dilution factor × 2].

Audinių kultūra

Cells were maintained in a 37 °C incubator with 5% CO 2 . HEK293T c ells were cultured in Dulbecco's Modified Eagle Medium (Sigma) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 5 U ml −1 Penstrep (Lonza). Neuro-2a (N2A) (ATCC) cells were cultured in Dulbecco's Modified Eagle Medium (Sigma) supplemented with 10% FBS (Gibco), 5 U ml −1 Penstrep (Lonza) and 5 mM sodium pyruvate.

Hb9GFP mouse stem cells were cultured as described 66 and differentiated into motor neurons with 2 μM retinoic acid (Sigma) and 1 μM Smoothened Agonist (SAG) (Millipore) for 5 days. Embryoid bodies were then dissociated with papain and sorted using the FACSAria III (BD Biosciences).

For patient-derived cell cultures, informed consent was obtained from all subjects before sample collection (Study number STH16573, Research Ethics Committee reference 12 /YH/0330). Human patient-derived astrocytes (iAstrocytes) were differentiated from induced Neural Progenitor Cells (iNPCs) as described 52 and cultured in DMEM Glutamax (Gibco) with 10% FBS (Sigma) and 0.02% N2 (Invitrogen). Human patient-derived neurons (iNeurons) were differentiated from the previously established iNPCs using a modified version of the protocol described in reference 52 . Briefly, 30, 000 iNPCs were plated in a 6-well plate coated with fibronectin (Millipore) and expanded to 70–80% confluence. At confluence, iNPC medium was replaced with neuron differentiation medium (DMEM/F-12 with Glutamax supplemented with 1%N2, 2%B27 (Gibco)). On day one of differentiation the cells were treated with 2.5 μM of DAPT (Tocris). On day three the neuron differentiation medium is supplemented with 1 μM retinoic acid (Sigma), 0.5 μM Smoothened Agonist (SAG) (Millipore) and 2.5 μM Forskolin (Sigma) for 7 days. To obtain iMotor Neurons, iNeurons were re-plated on fibronectin and cultured in retinoic acid, SAG and Forskolin for 14 more days with addition of BDNF, CNTF and GDNF (all at 20 ng ml −1 ) for the last 10 days of differentiation. For SRSF1 knockdown, cells were transduced with lentivirus expressing control GFP or human SRSF1 -RNAi co-expressing GFP at an MOI of 5 at day 14 along with the HB9:RFP adenovirus.

Co-cultures of patient-derived iAstrocytes and motor neurons

For Hb9GFP motor neuron and patient-derived iAstrocyte co-cultures, 20, 000 induced neural progenitor cells (iNPCs) were plated in 6-well plates in astrocyte medium. The day after plating, cells were transduced with lentivirus expressing control GFP or human SRSF1 -RNAi at an MOI of 5, 7 or 10. The human SRSF1 -RNAi virus also co-expressed GFP for evaluating transduction efficiency. Co-culture experiments were performed using GFP+ motor neurons from Hb9GFP+ mouse stem cells and i-Astrocytes transduced with an adenovirus expressing red fluorescent protein (Ad-RFP). Seven days post-transduction with Ad-RFP and LV- SRSF1 -RNAi, iAstrocytes were plated at a density of 10, 000 cell per well. The day after, Hb9GFP embryoid bodies were dissociated and sorted for GFP+ cells. 10, 000 GFP+ motor neurons were plated onto the astrocytes in motor neuron medium consisting of DMEM/F12, 2% horse serum (Invitrogen), 2% N2, 2% B27 plus GDNF (Invitrogen; 10 ng ml −1 ), BDNF (Invitrogen; 10 ng ml −1 ), CNTF (Invitrogen; 10 ng ml −1 ) and IGF-1 (Invitrogen; 10 ng ml −1 ). Nine 10 × images/well to cover the whole well surface were acquired daily for 3 days using the high content imaging system InCell 2000 (GE Healthcare), gathering data on neuronal cell size and number, axonal length and neurite branching. Data analysis was performed using the Columbus software (PerkinElmer). Data are presented for 3 days of co-culture. The programme designed for co-culture analysis only takes into account GFP+ cells with at least one projection to exclude counting cell debris. For iMN on iAstrocyte cultures, iAstrocytes were plated in 384-well plates 24 h before plating 1, 000 FACS-sorted iMNs. Cultures were maintained for 4 days. Data are presented for 4 days of co-culture.

Western blot and dot blot analysis

HEK cells were transfected for 72 h with 650 ng pcDNA6.2-GW/EmGFP-Control-miR-RNAi, pCDNA6.2-GW/EmGFP-human SRSF1 -miR1+2-RNAi or LV-EmGFP-human SRSF1 -miR1+2-RNAi constructs and 50 ng p3XFLAG/human-SRSF1 using 3.5 μg PEI/ml media and one tenth medium volume of OptiMEM. Neuro-2a cells were split into each well of 24-well plates (75, 000 cells per well) and transfected for 72 h with 350 ng pcDNA6.2-GW/EmGFP-Control-miR-RNAi (ThermoFisher), pcDNA6.2-GW/EmGFP-mouse SRSF1-miR1+2-RNAi, p3xFLAG, p3xFLAG/SRSF1(11-196), p3xFLAG/SRSF1(11-196)-m2 or p3xFLAG/SRSF1(11-196)-m4 and 350 ng pcDNA3.1/RAN-G4C2x38-sense or RAN-C4G2x39-antisense using 3 μg PEI/1 μg DNA and one tenth medium volume OptiMEM.

Proteins were extracted 72 h post-transfection. Cells were washed in ice-cold phosphate-buffered saline (PBS) and scraped into ice-cold lysis buffer (50 mM Hepes pH7.5, 150 mM NaCl, 10% glycerol, 0.5% Triton X-100, 1 mM EDTA, 1 mM DTT, protease inhibitor cocktail (Sigma)). Cells were left to lyse on ice for 10 min followed by centrifugation at 17, 000 g at 4 °C for five minutes. Protein extracts were quantified using Bradford Reagent (BioRAD), resolved by SDS–PAGE, electroblotted onto nitrocellulose membrane and probed using the relevant primary antibody. Human/mouse SRSF1/SF2 [1:1, 000 dilution] (Cell Signaling #8241), poly-Gly-Pro [1:10, 000 dilution] (kindly received from Prof Stuart Pickering Brown) and Histone H3 (Santa Cruz sc-10809) primary antibodies were detected with horseradish peroxidase (HRP)-conjugated rabbit secondary antibody (Promega), while α-tubulin [1:10, 000 dilution] (Sigma, clone DM1A), FLAG [1:2, 000 dilution] ( Sigma F1804, clone M2), ALYREF [1:2, 000 dilution] (Sigma A9979, clone 11G5) and poly-Gly-Ala [1:500 dilution] (kindly provided from Prof Dieter Edbauer) antibodies were detected using HRP-conjugated mouse secondary antibody (Promega). Uncropped western blot images are shown in Supplementary Figs 11–16. For dot blot analysis, 50 μg total protein extracts prepared in ice-cold lysis buffer were loaded onto a nitrocellulose membrane using a microfiltration apparatus (Biorad), sliced into strips and analysed by immunoblotting.

Cytoplasmic fractionation

Neuro-2a cells were split into 6-well plates (2 × 10 6 cells per well) and transfected for 72 h with 1 μg pcDNA6.2-GW/EmGFP-Control-miR-RNAi, pcDNA6.2-GW/EmGFP-mouse SRSF1-miR1+2-RNAi, p3xFLAG/SRSF1(11-196), or p3xFLAG/SRSF1(11-196)-m4 and 1 μg pcDNA3.1/RAN-G4C2x38-sense or RAN-C4G2x39-antisense using 3 μg PEI/1 μg DNA and one tenth medium volume OptiMEM. iNeurons were cultured in 6-well plates and transduced with 5MOI human LV- SRSF1 -RNAi lentivirus for 5 days.

For the cytoplasmic fractionation, cells were collected in DEPC PBS and pelleted by centrifugation at 800 g for 5 min. Cell pellets were quickly washed with hypotonic lysis buffer (10 mM HEPES pH 7.9, 1.5 mM MgCl 2, 10 mM KCl, 0.5 mM DTT) and lysed in hypotonic lysis buffer containing 0.16 U μl −1 Ribosafe RNase inhibitors (Bioline), 2 mM PMSF (Sigma) and SIGMAFAST Protease Inhibitor Cocktail tablets, EDTA free (Sigma). For flies, da-GAL4 was used to drive transgene expression in all tissues, and 10 third instar larvae were homogenized and lysed using the same buffer and a dounce homogenizer. All lysates underwent differential centrifugation (1, 500 g , 3 min, 4 °C then 3, 500 g rpm, 8 min, 4 °C and then 17, 000 g , 1 min, 4 °C) transferring the supernatants to fresh tubes after each centrifugation. Nuclear pellets obtained after centrifugation at 1, 500 g for 3 min were lysed in Reporter lysis buffer (Promega) for 10 min on ice before centrifugation at 17, 000 g , 5 min, 4 °C. Total fractions were collected in Reporter lysis buffer containing 0.16 U μl −1 Ribosafe RNase inhibitors (Bioline), 2 mM PMSF (Sigma) and Protease Inhibitors prior to lysis for 10 min on ice before centrifugation at 17, 000 g , 5 min, 4 °C. Total and fractionated extracts were added to PureZOL to extract RNA. Equal volumes of total, nuclear and cytoplasmic lysates were subjected to western immunoblotting using SSRP1 and α-tubulin (Neuro-2a), SSRP1 and Actin (iNeurons), or α-tubulin and α-Histone H3 ( Drosophila ) antibodies.

Kiekybinis RT – PGR

For Drosophila , total RNA was extracted from crushed larvae or adult flies using 800 μl PureZOL (BioRAD). Lysate was cleared by centrifugation for 10 min at 12, 000 g at 4 °C. 200 μl of chloroform was added and tubes were vigorously shaken for 15 s. After 10 min incubation, tubes were centrifuged at 12, 000 g for 10 min at 4 °C and supernatants (400 μl) were collected. RNA was precipitated for 30 min at room temperature with 2 μl Glycogen (5 μg μl −1, Ambion) and 500 μl isopropanol and pelleted at 12, 000 g for 20 min at 4 °C. Pellets were washed with 70% DEPC Ethanol and re-suspended in 40 μl DEPC water.

For HEK cells, 50, 000 cells were split into each well of 24-well plates and transfected with 700 ng pcDNA6.2-GW/EmGFP-Control or human SRSF1-miR-RNAi constructs using 3.5 μg PEI/ml media and one tenth medium volume OptiMEM (ThermoFisher). For iAstrocytes, 20, 000 induced neural progenitor cells (iNPCs) were plated in 6-well plates in astrocyte medium. The day after plating, 3 wells were transduced with lentivirus expressing human SRSF1 -RNAi at an MOI of 5. Total RNA was extracted from HEK cells 72 h after transfection or iAstrocytes 5 days after transduction and RNA extracted using the EZ Total RNA Isolation Kit (Geneflow). Briefly, cells were washed in DEPC-treated PBS before lysis in the culture dish using the denaturing solution. Lysed cells collected and equal volume extraction buffer added, vigorously shaken, incubated at room temperature for 10 min and then centrifuged for 15 min at 4 °C and 12, 000 g . RNA was precipitated using equal volume of isopropanol overnight at −20 °C, pelleted at 12, 000 g , 4 °C for 15 min, washed with 70% DEPC Ethanol and re-suspended in 22.5 μl DEPC water.

All RNA samples were treated with DNaseI (Roche) and quantified using a Nanodrop (NanoDropTechnologies). Following quantification, 2 μg RNA was converted to cDNA using BioScript Reverse Transcriptase (Bioline). qRT–PCR primers were designed using Primer-BLAST 67 (NCBI) and validated using a 1 in 4 serial template dilution series (standard curve with R 2 >0.97). qRT–PCR reactions were performed in duplicate using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies) on a MX3000P QPCR system (Statagene) using an initial denaturation step, 45 cycles of amplification (95 °C for 30 s; 60 °C for 30 s; 72 °C for 1 min) prior to recording melting curves. qRT–PCR data was analysed using MxPro (Stratagene) and GraphPad Prism (Version 6). The sequences of qPCR primers are provided in Supplementary Note 3 including citations of refs 68, 69, 70.

MTT ląstelių proliferacijos tyrimas

Neuro-2a cells were split into 24-well plates (30, 000 cells per well). Each plate contained 4 wells with only media to serve as a blank and 4 wells/treatment. Cells were transfected for 72 h with either 500 ng pcDNA3.1, pcDNA3.1/RAN-G4C2x15, RAN-G4C2x38-sense, RAN-C4G2x15 or RAN-C4G2x39-antisense; or 250 ng pcDNA6.2-GW/EmGFP-Control-miR-RNAi, pcDNA6.2-GW/EmGFP-mouse SRSF1-miR1+2-RNAi, p3xFLAG/SRSF1(11-196) or p3xFLAG/SRSF1(11-196)-m4 and 250 ng pcDNA3.1, pcDNA3.1/RAN-G4C2x38-sense or RAN-C4G2x39-antisense.

250 mg Thiazolyl Blue Tetrazolum Bromide reagent (MTT) was added to each well and incubated in the dark at 37 °C for 1 h. Cells were subsequently lysed with equal volume MTT lysis buffer (20%SDS, 50% Dimethylformamide (DMF)) and incubated, shaking, at room temperature for 1 h. Absorbance at 595 nm was then assessed with a PHERAstar FS (BMG Labtech). Absorbance data was retrieved using PHERAstar MARS (BMG Labtech).

Immunofluorescence of rat cortical neurons

Cortical neurons were isolated, cultured and transfected as described 21 . Briefly, neurons were transfected using Lipofectamine LTX with PLUS reagent according to manufacturer's instructions (Thermofisher; DNA:PLUS:LTX ratio of 1:0.5:0.5 with 2 μg DNA/100, 000 cells per cm 2 ). After 6 h, the transfection mix was replaced with conditioned medium. Immunofluorescence staining of rat cortical neurons was performed 72 h after transfection as described 21 with the exception that cells were blocked with 4% goat serum in PBS for 2 h at room temperature and incubated overnight at 4 °C with the V5 antibody [1:1, 000 dilution] (ThermoFisher Scientific #R96025) in PBS containing 4% goat serum. Cells were washed three times with PBS containing 4% goat serum and incubated for 1 h with PBS containing 4% goat serum & goat anti-mouse secondary antibody, Alexa Fluor 594 [1:1, 000 dilution] (ThermoFisher Scientific). Cells transfected with pcDNA6.2-GW/EmGFP-Control or human SRSF1-miR-RNAi constructs were subsequently stained with Hoechst 33342 for 10 min at room temperature, washed 3 times with PBS and mounted in fluorescence mounting medium (Dako). After incubation in the secondary antibody, cells transfected with p3xFLAG/SRSF1(11-196) or p3xFLAG/SRSF1(11-196)-m4 were washed 3 times with PBS containing 4% goat serum, incubated at room temperature for one hour with PBS containing 4% goat serum & anti-FLAG M2-FITC antibody (10 μg ml −1 ; Sigma-Aldrich #F4049) and subsequently stained with Hoechst 33342. Cells were then washed 3 times with PBS and mounted.

Bendras imuninis nusodinimas

Cells were split into one 10 cm plates/treatment (1.5 × 10 6 cells per plate) and transfected with 15 μg p3xFLAG, p3xFLAG/SRSF1(11-196), p3xFLAG/SRSF1(11-196)-m2 or p3xFLAG/SRSF1(11-196)-m4 using 3 μg PEI/1 μg DNA and one tenth medium volume OptiMEM.

Proteins were extracted from Neuro-2a cells 48 h post-transfection. Cells were washed in ice cold PBS, scraped into 500 μl ice cold lysis buffer, passed through a 21G gauge needle 10 times and left to lyse on ice for 10 min. Lysed cells were cleared by centrifugation at 17, 000 g at 4 °C for 5 min and protein extracts were quantified using Bradford Reagent. 2 mg total protein in 1 ml lysis buffer was incubated with 30 μl anti-FLAGM2 affinity resin (Sigma A2220) (which had been blocked overnight with 1% BSA in IP lysis buffer) for 2 h at 4 °C on a rotating wheel. Beads were washed 5 times with lysis buffer and eluted in 50 μl IP lysis buffer supplemented with 100 μg ml −1 3xFLAG peptide (Sigma #F4799) for 30 min at 4 °C on a rotating wheel. 30 μg total protein and 15 μl eluates were subjected to western immunoblotting using FLAG, NXF1 clone 53H8 [1:2, 000] (Abcam ab50609) and α-tubulin antibodies.

RNA:protein UV crosslinking assays

Recombinant proteins expressed in 1.5 l of Escherichia coli BL21 (DE3)-RP (Novagen) cultures were purified on TALON/Cobalt beads (Clontech) in 1 M NaCl containing buffers (Lysis buffer: 50 mM TRIS-HCl pH 8.0, 1 M NaCl, 0.5% Triton X-100; Wash buffer: 50 mM TRIS-HCl pH 8.0, 1 M NaCl, 0.5% Triton X-100, 5 mM imidazole). Elution was achieved with imidazole (50 mM TRIS-HCl pH 8.0, 500 mM NaCl, 200 mM imidazole) and 50 mM L-Arg/L-Glu mixture to prevent protein precipitation while retaining interaction with RNA and NXF1 (refs 35, 36). 2 μg purified proteins were incubated in RNA-binding buffer (15 mM HEPES at pH 7.9, 150 mM NaCl, 0.2 mM EDTA, 5 mM MgCl 2, 0.05% Tween 20, 10% glycerol) with 20 nmoles 5′-end 32 P-radiolabelled probes (RNA oligonucleotides purchased from Dharmacon) for 10 min at room temperature and 10 min on ice prior to UV-crosslinking or not (10 min, 1.5 J cm −2 ). Binding reactions were resolved on SDS–PAGE prior to analysis by Coomassie staining and Phosphoimaging.

RNA immunoprecipitation assays

Cells were split into one T-175 flask/treatment (5 × 10 6 cells per plate) and transfected with 30 μg p3xFLAG, p3xFLAG/SRSF1(11-196) or p3xFLAG/SRSF1(11-196)-m4 and 10 μg pcDNA3.1/RAN-G4C2x15-sense, RAN-G4C2x38-sense, RAN-G4C2x15-antisense or RAN-C4G2x39-antisense using 3 μg PEI/1 μg PEI and one tenth volume OptiMEM. 1% formaldehyde was added to the medium of live cells for 10 min 48 h post-transfection. Formaldehyde was quenched with 250 mM Glycine and DEPC-treated PBS-washed cells were scraped into ice cold RNase-free lysis buffer (DEPC-treated water containing 50 mM Hepes pH 7.5, 150 mM NaCl, 10% glycerol, 0.5% Triton X-100, 1 mM EDTA, 1 mM DTT, 1 μl RNase inhibitor, protease inhibitors). Cells were passed through a 21G gauge needle 10 times and left to lyse on ice for 10 min, followed by centrifugation at 17, 000 g at 4 °C for five minutes and quantification using Bradford Reagent. 2.5 mg of total protein at a 1 mg ml −1 was incubated with 40 μl anti-FLAGM2 affinity resin (which had been blocked overnight with 1% BSA and 5 μl ml −1 ssDNA) overnight at 4 °C on a rotating wheel. Beads were washed 5 times with RNase-free lysis buffer. Complexes were reverse cross-linked and eluted from the resin in EZ RNA extraction denaturing buffer (Geneflow) for 1 h at 70 °C, re-suspending the resin every 10 min. The formaldehyde crosslinks were reversed by heating the samples for 1 h at 70 °C and RNA was extracted using PureZOL (for total samples) or the EZ Total RNA Isolation Kit (for eluted complexes) as described in the qRT–PCR section. Extracted RNA samples were re-suspended in 25 μl RNase-free water, DNase-treated and 10 μl input or eluate RNA was converted to cDNA and used for qPCR as described in the qRT–PCR section.

Visualization of RNA foci and colocalization studies

To visualize sense RNA foci, RNA fluorescence in situ hybridization (FISH) was performed as described 12 using a 5′ TYE-563-labelled LNA (16-mer fluorescent)-incorporated DNA probe (Exiqon, Inc.). For human post mortem spinal cord tissue, the study was approved by the South Sheffield Research Ethics Committee and informed consent was obtained for all samples. RNA-FISH and immunohistochemistry were performed on formalin fixed paraffin-embedded (FFPE) tissues as in reference 12 . Anti-SRSF1 antibody (Cell Signaling #8241) at a dilution of 1:200. Mounted slides were visualized using a Leica SP5 confocal microscope system and a 63/1.4 oil immersion objective lens. The presence of RNA foci was assessed at high resolution (848 μm 2 per image, 393 × 393 pixels) using 0.9 μm z-stacks through the entire volume of the cell.

Statistical analysis of data

Either one-way or two-way ANOVA (analysis of variance) with Tukey's correction for multiple comparisons was used for most experiments with the following exceptions: DPR analysis in primary neurons used Fisher's exact test; fly climbing ability was analysed by Kruskal-Wallis non-parametric test with Dunn's correction for multiple comparisons; and the analysis of G4C2x36 transcripts in Drosophila used paired two-tailed t -test. No randomization was used in the animal studies. Data were plotted using GraphPad Prism 6. Significance is indicated as follows; NS: non-significant, P ≥0.05; * P <0, 05; ** P <0, 01; *** P <0, 001; **** P <0, 0001. RNA foci, DPR-positive neurons, crawling and climbing assays were analysed in a blinded manner and several investigators carried out the analysis. Several researchers were involved in producing qRT–PCR and western blot data.

Duomenų prieinamumas

All data files and files produced for statistical analysis are available on request.

Papildoma informacija

PDF failai

  1. 1.

    Papildoma informacija

  2. 2.

    Tarpusavio apžvalgos byla

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.