Sulfatinis hialuronanas keičia fibronektino matricos sąranką ir skatina osteogeninę žmogaus kaulų čiulpų stromos ląstelių diferenciaciją | mokslinės ataskaitos

Sulfatinis hialuronanas keičia fibronektino matricos sąranką ir skatina osteogeninę žmogaus kaulų čiulpų stromos ląstelių diferenciaciją | mokslinės ataskaitos

Anonim

Dalykai

  • Biomedžiagos - ląstelės
  • Biomineralizacija
  • Cheminis modifikavimas
  • Glikobiologija
  • Kamieninių ląstelių diferenciacija

Anotacija

Tarpląstelinės matricos (ECM) sudėtis ir struktūros vientisumas yra vienas iš daugelio veiksnių, turinčių įtakos ląstelių diferenciacijai. Fibronektinas (FN), kuris daugelyje audinių yra gausiausias ECM baltymas, sudaro unikalų pluošto tinklą. FN yra keletas sulfatuotų glikozaminoglikanų (sGAG), tokių kaip heparinas (Hep), kurie anksčiau buvo įtakojami FN konformacijai ir prisijungimui prie baltymų, surišančių vietų. Sintetinio sulfato hialuronano dariniai (sHA) gali būti pavyzdinės molekulės su gerai apibūdintu sulfacijos modeliu tiriant sGAG-FN sąveiką. Čia parodyta, kad mažai sulfatuotas sHA (sHA1) sąveikauja su FN ir daro įtaką fibrilų surinkimui. FN fibrilių sąveika su sHA1 ir Hep, bet ne su ne sulfatiniu HA, buvo parodyta imunofluorescenciniu dažymu. FRET FN analizė patvirtino, kad žmogaus kaulų čiulpų stromos ląstelėse (hBMSC) gautos ECM yra išsamesnės fibrilės, reaguojant į sHA1 ir Hep. Nors tiek sHA1, tiek Hep paveikė FN konformaciją, išskirtinai sHA1 padidino FN baltymų kiekį ir atnešė plonesnes fibrinas. Be to, tik sHA1 turėjo osteogeninį poveikį ir sustiprino audinių nespecifinės šarminės fosfatazės aktyvumą. Mes hipotezuojame, kad sHA1 sukeltas FN mazgo pakeitimas daro įtaką visam ECM tinklui ir galėtų būti pagrindiniu prosteogeninio sHA1 poveikio hBMSC mechanizmui.

Įvadas

Glikozaminoglikanai (GAG) yra linijiniai kompleksiniai tarpląsteliniai polisacharidai, susidedantys iš kintamų disacharidų kartojančių vienetų. Jie gali egzistuoti vien tik arba sudaryti proteoglikanus, prisijungdami prie pagrindinio baltymo. Heparinas (Hep) yra natūralus labai sulfatuotas polisacharidas, paprastai išskiriamas iš kaulas ląstelių ar gleivinės ir klinikoje naudojamas kaip antikoaguliantas 1, 2, 3 . Polimerinę Hep grandinę sudaro įvairios sulfatinės kartotinės urono rūgšties (L-idurono rūgšties, retai D-gliukurono rūgšties) seka, sujungta per 1, 4-glikozidinį ryšį su N-acetil-D-gliukozaminu. Natūralioji hepa yra gana įvairi, todėl joje yra daugybė skirtingos molekulinės masės grandinių. Heparano sulfatas turi keletą cheminių ir struktūrinių bruožų su Hep: Jis taip pat yra netaisyklingas, dažniausiai mažiau sulfatuotas nei Hep, turintis klasifikuoto sulfato modelį 2, 4 . Abu neigiamai įkrauti sulfatiniai GAG (sGAG) gali sąveikauti su daugybe baltymų, įskaitant augimo faktorius ir tarpląstelinės matricos (ECM) 3, 5 molekules, tokiu būdu vaidindami svarbų vaidmenį audinių inžinerijos metoduose 1 .

Keli in vitro tyrimai įvertino GAG ir proteoglikanų svarbą osteoblastų diferenciacijai 6, 7, 8, 9, 10 . Anksčiau buvo įrodyta, kad šiame tyrime naudojami sintetinti GAG dariniai (sGAG), gauti iš ne sulfatinio hialuronano (HA), skatina žmogaus kaulų čiulpų stromos ląstelių (hBMSC) osteogeninę diferenciaciją 11, 12 . Šie dirbtiniai sGAG dariniai pakeitė keletą ląstelių procesų, tokių kaip įvairūs ląstelių signalizacijos keliai (pvz., BMP-2 (kaulų morfogenetinis baltymas-2) ir TGF-β1 (transformuojantis augimo faktorius-β1) signalizacija), baltymai, dalyvaujantys endocitozėje, ląstelių ir ECM sąveika. ir ECM rekonstravimas, taip pat matricinės pūslelės formavimas ir sudėtis 13, 14, 15 . Nustatyta, kad GAG sulfavimas yra pagrindinis veiksnys, lemiantis šį poveikį, nes HA, kuriame nėra sulfatų , nepakeitė osteogenezės in vitro . Šiame tyrime tolesniam tėvų ląstelių mechanizmų apibūdinimui buvo pasirinktas sintetiškai mažai sulfatuotas HA darinys sHA1 (sulfato liekanų skaičius viename disacharido vienete (DS sulfacijos laipsnis: 1, 0–1, 5)).

Vienas pagrindinių sGAG sąveikos partnerių ECM yra glikoproteino fibronektinas (FN). Tai yra vienas gausiausių ECM komponentų, visur esančių tiek subrendusiuose, tiek embrioniniuose audiniuose, tiek kaulų čiulpų nišoje 16, 17 . FN yra prie disulfido prijungtas homodimeras (kiekvienas 220 kDa) ir yra sudarytas iš trijų skirtingų tipų domenų (FNI, FNII ir FNIII domenai) (1 pav.) 18 . Ląstelės jungiasi FN per RGD jungiančius α 5 β 1, α V β 1 ir α V β 3 18, 19, 20 integrinus ir gali panaudoti mechanines jėgas, kurias sukuria jų kontraktiškos mašinos ir perkeltos per membraninius integrinus į FN 18, 20 . Ląstelinės jėgos gali sukelti FN konformacinius pokyčius, dėl kurių gali atsirasti savaiminio susivienijimo vietos, susijusios su plaušelių surinkimu. 20, 21, 22, 23 . Tuomet struktūrinis mazgas į stabilias FN fibrilijas grindžiamas tarpmolekulinėmis FN-FN sąveikomis 24, 25, 26 .

Image

FN išskiriamas kaip homodimeras, sujungtas su disulfidais, kurį sudaro trijų tipų kartotiniai moduliai (FNI, FNII ir FNIII), sunumeruoti serijiniu būdu. Splice variantai papildomai gali turėti papildomų domenų A (EDA) arba B (EDB) ir kintamąjį regioną CS (jungiamąjį segmentą) (visi pilki). FN turi keletą jungiamųjų domenų, skirtų sąveikos partneriams ECM, pvz., Kolageno I (tamsiai mėlyna) arba augimo faktorių (oranžinė). Kiekviena FN grandinė turi tris Hep surišančias sritis (geltona), esančias atitinkamai FNI 2-4, FNIII 4-6 ir FNIII 12-14 . FNI 1-4 ir FNIII 1-5 antiparallelė, tarpmolekulinė sąveika yra labai svarbi FN fibrillogenezei. RGD surišimo vieta yra FNIII 10 ir yra atpažįstama integrinų α 5 β 1, α V β 1 ir α V β 3 (raudonos ir mėlynos spalvos). Keletas tarpląstelinių procesų tiesiogiai paveikiami integrinų per citoskeletinį adapterį (aktinas žaliai) ir signalines molekules kaip FAK (židinio adhezijos kinazė), o mažas GTPazes kaip RhoA.

Visas dydis

FN yra privalomas GAG, kolageno I ir kitų ECM komponentų partneris ir palengvina tinklo formavimąsi 26, 27, 28 . Jame yra trys Hep surišimo regionai, esantys FNI 2-4, FNIII 4-6 ir FNIII 12-14 (1 pav.) 29, 30 . Hep surišimas su FN tirpale paverčia FN dimerą iš rutulinės į pailgą struktūrą ir tokiu būdu gali padidinti augimo faktoriaus surišimą pateikdamas kripto jungimosi vietas 31 . Keli tyrimai atskleidė, kad FN yra pagrindinis BMSC įsipareigojimo dėl osteoblastų kilmės palaikymas, palaikantis BMSC adheziją ir galiausiai diferenciaciją į osteoblastus. 32, 33, 34 .

Šiame tyrime mes nagrinėjome klausimą, ar sintetiškai mažai sulfatuotas HA darinys sHA1 veikia ląstelių FN matricos jungtį ir kaip tai gali būti siejama su pro osteogeniniu sHA1 poveikiu hBMSC 12 . Eksperimentų kontrolė buvo mažos molekulinės masės HA ir Hep. SHA1 lokalizavimui ECM buvo naudojamas fluorescenciniu ženklu pažymėtas sHA1 darinys. SHA1 įtaka FN konformacijai hBMSC deponuotame ECM buvo tiriama naudojant fluorescencinio rezonanso energijos perdavimo (FRET) zondą, kaip matuojant FN 22, 35 molekulinį pailgėjimą . Poveikis FN formavimui buvo išanalizuotas mRNR lygiu (realaus laiko PGR) ir baltymų lygiu (Western blot). FN tirpumo tyrimas pagal Wierzbicka-Patynowski ir kt. 36 apibūdinta FN fibrilių matricos surinkimo būsena. Galiausiai buvo įvertintas sHA1, HA ir Hep poveikis osteogeninei hBMSC diferenciacijai, nustatant audinių nespecifinės šarminės fosfatazės (TNAP) aktyvumą.

Rezultatai

sHA1 ir Hep kolocalizuojasi su FN fibrilėmis ir sukelia išsamesnę fibrozinės FN konformaciją

Norėdami ištirti GAG darinių lokalizaciją, hBMSC buvo kultivuojami audinių kultūros polistireno plokštelėse (TCPS) DMEM ir nuo 1 dienos iki 8 dienos buvo gydomi ATTO565 pažymėtais sHA1 ir HA dariniais. Analizuojant GAG lokalizaciją 8 dieną, nuolatinis hBMSC (d1-d8) apdorojimas ne sulfatiniu ATTO565-HA nesukūrė jokių specifinių struktūrų (2B pav.). Priešingai, kai buvo pastebėtas fibrilinis ATTO565-sHA1 išdėstymas, kai hBMSC buvo visam laikui gydomi mažai sulfatuotais HA dariniais (2 pav. C). Tačiau ši padėtis pasikeitė, kai ATTO565-sHA1 buvo pašalintas 4 dieną keičiantis terpe (gydymas d1-d4, 2 pav. D), patvirtinantis, kad nuolatiniam pluoštiniam išdėstymui reikalingas nuolatinis ATTO565-sHA1 (d1-d8) ir kad šis išdėstymas yra grįžtamasis.

Image

hBMSC buvo auginami TCPS (kontrolinis, CTRL, (A ). 8 dieną po sėjimo ląstelės buvo nuplaunamos, fiksuotos ir dažytos pelių anti-žmogaus FN-IgG / AlexaFluor488-ožkos anti-pelės IgG (žalia fluorescencija). Branduoliai hBMSC buvo gydomi 200 μg ATTO565-HA / ml (raudona fluorescencija) ( B ) arba 200 μg ATTO565-sHA1 / ml ( C ) ir nudažyti 8 dieną. kaip aprašyta anksčiau. hBMSC buvo gydomi nuo 1 dienos iki 4 dienos ( D ) 200 μg ATTO565-sHA1 / ml, fiksuojami 8 dieną ir dažomi taip, kaip aprašyta anksčiau. 8 dieną mėginiai, kurie buvo visam laikui apdoroti ATTO565-sHA1, hBMSC buvo apdoroti nuo 7 dienos iki 8 dienos ( F ) 200 μg ATTO565-sHA1 / ml ir nudažyti 8 dieną, kaip aprašyta anksčiau. hBMSC buvo apdoroti, kaip aprašyta anksčiau. su 200 μg ATTO565-sHA1 / ml, 5 μg AlexaFluor488-FN / ml ir 45 μg plazmos-FN / ml. Po 48 h ląstelės buvo fiksuotos ir branduoliai buvo nudažyti DAPI ( G ) hBMSC buvo apdoroti 200 μg FITC-Hep / ml (žalia fluorescencija, pažymėta raudona spalva). 8 dieną po sėjimo ląstelės buvo nuplaunamos, pritvirtintos ir nudažytos pelių anti-žmogaus FN IgG / AlexaFluor568 ožkos anti-pelės IgG (raudona fluorescencija, pažymėta žalia spalva) ir DAPI (mėlyna) ( H ). Mastelio juostos AD ir GH 50 μm, EF 20 μm.

Visas dydis

Be pluoštinės sHA1 struktūros, nemažas kiekis ATTO565-sHA1 susikaupė viduląsteliniu būdu ir buvo aptiktas perinuklearinėse pūslelėse (žr. 2C, D, G pav.), Nurodant numanomą endocitotinio įsisavinimo mechanizmą 37 .

Norėdami pamatyti, ar fibrilinis sHA1 išsidėstęs tarpląsteliniu būdu, hBMSC buvo pašalinti iš ECM, atliekant depiliaciją NH4OH - delluliarizacijos protokolu, kuris, kaip žinoma, nepažeidžia endogeninio ECM 38 . 2E pav. Parodyta, kad hBMSC suformuotas sHA1 pluoštinis išdėstymas buvo stabilus net po depiliacijos, kuris patvirtino specifinį tarpląstelinį sHA1 poveikį.

8-ą dieną po nuolatinio hBMSC apdorojimo ATTO565-GAG dariniais struktūriniai ECM baltymai buvo dažyti imunofluorescenciniu būdu, kad būtų galima nustatyti tariamus sąveikos partnerius, verčiančius sHA1 sudaryti tokią fibrilarinę struktūrą. FN (žalia fluorescencija) parodė tankų pluoštų tinklą, kuris stipriai kolokalizavosi su ATTO565-sHA1 (raudona fluorescencija) geltonai atsirandančiose struktūrose (2C, E pav.), Tačiau neparodė tokios pačios lokalizacijos kaip ne sulfatinis ATTO565-HA darinys (2 pav. 2B). Kadangi ATTO565-sHA1 nuolat buvo laikomasi šio požiūrio, lieka atvira, ar sHA1 sąveikauja su jau surinktomis FN fibrilėmis, ar jis buvo integruotas į struktūras FN fibrillogenezės metu. Norėdami išspręsti šį klausimą, ląstelės buvo gydomos ATTO565-sHA1 24 valandas nuo 7 dienos iki 8 dienos. Šiame nustatyme buvo nustatyta FN-fibrilių kolokalizacija su ATTO565-sHA1 (2F pav.), Kas rodo tiesioginį sHA1 prisijungimą prie iš anksto suformuotos FN fibrilės. Abiejų, fluorescenciškai pažymėtų FN (AlexaFluor488-FN) ir ATTO565-sHA1 pridėjimas prie hBMSC 48 valandas parodė, kad ATTO565-sHA1 gali sąveikauti ir su naujai susidariusiomis, susidarančiomis FN fibrilėmis (2G pav.).

Be sintetinio sHA1 darinio, Hep buvo naudojamas kaip natūraliai sulfatuota kontrolė, tiriant jo FN jungtį in vitro . Tuo tikslu hBMSC buvo gydomi 200 μg FITC-Hep / ml nuo 1 dienos iki 8 dienos, mėginiai buvo fiksuojami ir kartu dažomi FN 8 dieną (2H pav.). FITC signalas žaliame kanale (pažymėtas raudona spalva) kolokalizuotas su FN fibrilėmis raudoname kanale (pažymėta žalia spalva) geltonos spalvos struktūrose.

Kaip pavaizduota 2C pav., E – G ATTO565-sHA1 ir FN fibrilės rodė panašų modelį, kuris rodo abiejų komponentų kolokales iš hBMSC gauto ECM. Norint tai įvertinti išsamiau, buvo atlikta kiekybinė ATTO565-sHA1 (raudonojo kanalo) ir AlexaFluor488-FN (žaliojo kanalo) kolokalalizacijos analizė (pagal 2G pav.), Naudojant kolokacijos įskiepį JACoP Fiji Software 39 programoje (3 pav.). . Kadangi žaliojo ir raudonojo kanalo signalo intensyvumai skiriasi vienas nuo kito, buvo apskaičiuotos nuo intensyvumo nepriklausančios kolokalalizacijos vertės (Pearsono ir Manderso). ATTO565-sHA1 ir AlexaFluor488-FN kolokalizei buvo apskaičiuotas Pearsono koeficientas 0, 740, kuris patvirtino dalinę kolokalizaciją; 1 vertė reikštų 100% kolokales. Manderdo koeficientai M1 ir M2 kiekvienam kanalui rodė panašias vertes - apie 85%.

Image

hBMSC buvo kultivuojami TCPS. Praėjus 24 valandoms po sėjimo, hBMSC buvo apdoroti 5 μg AlexaFluor488-FN / ml (žalia fluorescencija), 45 μg plazmos-FN / ml ir 200 μg ATTO565-sHA1 / ml (raudona fluorescencija). Po 48 valandų ląstelės buvo pritvirtintos, nudažytos DAPI ir įterptos į Mowiol 4-88, kaip aprašyta anksčiau. Geltona fluorescencija rodė perdengtas „AlexaFluor488-FN“ ir „ATTO565-sHA1“ struktūras (kairiajame skydelyje). Kolokalizacijai nustatyti ir kiekybiškai įvertinti, slenkstis buvo nustatytas Otsu metodu, vaizdai buvo vizualizuojami neteisingomis spalvomis (dešinysis skydelis; signalas baltas, fonas juodas) ir pavaizduoti JACoP įskiepiu iš Fidžio programinės įrangos. Kolokalizuotos struktūros yra baltos spalvos (dešinysis skydelis). Mastelio juosta 5 μm. Žemiau apibendrinti 15 atsitiktinai parinktų vaizdų kolokalizacijos analizės duomenys (reikšmės kaip vidurkis ± SEM (standartinė vidurkio paklaida)).

Visas dydis

Lokalizacijos tyrimai parodė, kad čia naudojamas ATTO-TEC fluorescencinių dažų cheminis sujungimas su GAG dariniais buvo tinkamas metodas fluorescenciniais GAG dariniais generuoti lokalizacijos tyrimams in vitro . Kad būtų galima pašalinti laisvų dažų molekulių galimus artefaktus, buvo naudojamas dvigubai pažymėtas ATTO565-ATTO655-sHA1 darinys, kad patvirtintų pažymėtos sHA1 molekulės stabilumą. Todėl, norint įvertinti ženklinimo stabilumą, buvo atlikta dviejų dažų kiekybinė kolokazės analizė (kaip aprašyta aukščiau), patvirtinanti netoliese esančią pilną ATTO565 ir ATTO655 kolokalizaciją (žr. Papildomą S1 pav.). Beveik 100% abiejų dažų kolokalizavimas parodė atvirkščiai stabilų ATTO-TEC molekulių sujungimą su sHA1 ir patvirtino GAG grandinių stabilumą, nes fluorescencinės etiketės nebuvo atskirtos skilimo metu. Be to, laisvos ATTO565-NH2 dažų molekulės specialiai nesąveikavo su jokiais ląstelių taikiniais (duomenys nepateikti), patvirtindami, kad sHA1 dažų kompleksas, o ne laisvas ATTO565 dažiklis yra kolokalizuotas su FN fibrilėmis.

Imunofluorescencinis dažymas parodė, kad ATTO565-sHA1 ir FITC-Hep kolokalizuojasi su FN fibrilėmis, kurias surinko hBMSC, esant 200 μg sGAG / ml (2C pav., H). FN sąveika su Hep yra žinoma, nes FN turi keletą Hep surišančių sričių 40, 41, 42, ir įrodyta, kad jo surišimas reguliuoja FN konformaciją matricos fibrilėse 31 . Tačiau čia pirmą kartą parodytas sintetiniu būdu sulfatuoto sHA1 darinio surišimas ir kolokalizavimas su FN fibrilėmis, surinktomis hBMSC. Norėdami toliau ištirti šių dviejų sGAG panašumus, mes įvertinome, ar sHA1 darinys turi panašų poveikį FN konformacijai kaip Hep. FN konformacija buvo patikrinta pridedant nedidelį kiekį dvigubai pažymėto FRET-FN (FN donoro akceptorius: FN-DA) į ląstelės terpę 21, 22 . Vaizdai 4A pav. Rodo reprezentatyvių spalvų koduotų FRET santykio (akceptoriaus / donoro) atvaizdus iš hBMSC gauto ECM po 72 valandų inkubacijos su FN-DA. Spalvos kodas parodė FN fibrilių konformacinių būsenų diapazoną nuo raudonos (kompaktiškos, FRET santykis 1) iki mėlynos (labai ištemptas, FRET santykis 0). Sintetiniu būdu sulfatuotas SHA1 darinys sukėlė FN FRET santykio sumažėjimą, panašų į Hep, ir tai rodo didesnę FN konformaciją, palyginti su neapdorota kontrole (CTRL). Mūsų duomenys apie ilgesnių FN skaidulų apdorojimą gydant Hep atitinka anksčiau paskelbtus rezultatus 35 . Išskyrus sHA1 ir Hep, sulfatinis HA neturėjo įtakos FRET santykiams ir elgėsi panašiai kaip neapdorotas kontrolinis mėginys (CTRL). Dėžutės ir ūsų diagrama 4B pav. Apibendrina vidutinius FRET koeficientus, apskaičiuotus iš keturių donorų kiekviename egzemplioriuje, ir patvirtina reikšmingą sHA1 ir Hep pokyčius link mažesnių FRET santykio, palyginti su CTRL. Tarp CTRL ir HA apdorotų mėginių reikšmingo skirtumo nepastebėta. Šie pokyčiai taip pat atsispindėjo vidutinių FRET santykio histogramose, gautose iš 10 nepriklausomų vieno reprezentatyvaus donoro vaizdų, palyginti su CTRL (pilkos linijos; 4 pav. C). Visais atvejais FRET reikšmės parodė panašų atitinkamų histogramų pasiskirstymą ir plotį, parodydamos, kad panašus FN konformacijų diapazonas egzistuoja kartu su FN fibrilėmis ECM. Tačiau mėginių histogramos, apdorotos Hep (žalia linija) ir sHA1 (raudona linija), buvo aiškiai perkeltos į mažesnį FRET santykį, palyginti su HA (oranžinė linija) ir CTRL.

Image

hBMSC buvo kultivuojami ant TCPS ir inkubuojami su 45 μg FN / ml plazmoje ir 5 μg FN-DA / ml per 2 valandas po sėjimo. Po 24 valandų ląstelės buvo apdorotos Hep, HA arba sHA1 (po 200 μg / ml kiekviena). Neapdorotos ląstelės tarnavo kaip kontrolė (CTRL). Po 48 valandų GAG inkubacijos, mėginiai buvo fiksuoti 4% (m / v) paraformaldehidu PBS 10 minučių ir įterpiami į Mowiol 4-88. FRET analizei buvo vizualizuoti FN donoro ir akceptoriaus kanalai ( A ). FRET spalvų schema parodo santykinius FN fibrilų konformacinius pokyčius raudonos (kompaktiškos) iki mėlynos (labai ištemptos) spalvų diapazone. Mastelio juosta 50 μm. Vidutinis FRET santykio, apskaičiuoto iš keturių donorų, kurių kiekvienas turi du egzempliorius, grafikas ir ūsai, diagrama yra ( B ). Statistinis reikšmingumas tarp CTRL ir Hep, atitinkamai, CTRL ir sHA1, žymimas (p <0, 05). Reprezentatyvios FRET santykio histogramos, gautos iš 10 atsitiktinai parinktų vaizdų po apdorojimo Hep (žalia linija), HA (oranžinė linija) ir sHA1 (raudona linija), palyginti su neapdorota kontrole (pilka linija), parodytos ( C ) (n = 1 ). Vertikalios linijos parodo FRN-DA santykį tirpale, kuris denatūruotas atitinkamai 1, 2 arba 4 M GdnHCl.

Visas dydis

sHA1, bet ne Hep, padidina FN baltymų lygį ir keičia hBMSC FN jungties būseną

Imunofluorescenciniai vaizdai parodė, kad sHA1 gali iš naujo sureguliuoti FN matricos rinkinį, nes FN tinklas atrodo tankesnis ir sudarytas iš daugiau, bet plonesnių FN fibrilių, palyginti su neapdorotu valdymu (žr. 2A, C pav.). Nei HA, nei Hep nepakeitė FN tinklo, palyginti su CTRL (žr. 2B pav., H).

Siekiant išsamiau ištirti pirmąjį kokybinį stebėjimą, FN matricos komplektacijos skirtumai buvo įvertinti naudojant anksčiau pateiktą deoksicholato (DOC) tirpumo testą 36 . Šis tyrimas išskiria mažiau surinktus ir tokiu būdu DOC tirpius FN pluoštus, o DOC netirpi frakcija, kurioje yra stabiliai surinktų FN fibrilių, gali būti tirpi tik natrio dodecilsulfato (SDS) turinčiame buferyje. HBMSC DOC ir SDS lizatų mėginiai buvo visam laikui gydomi atitinkamai Hep, sHA1 arba HA, o abiejų lizatų FN kiekis buvo analizuojamas atliekant Western blotting (pagrindinės juostos esant ~ 220 kDa) ir densiometriškai įvertinant signalus (5A – C¸ brėžiniai viso ilgio papildomame S2 pav.). Kiekybiniai „Western blot“ duomenys iš tikrųjų patvirtino mūsų kokybinius stebėjimus iš imunofluorescencinių vaizdų, nes gydymas sHA1 padidino bendrą FN baltymo lygį maždaug 2–3 kartus, palyginti su CTRL, HA ir Hep. Kaip matyti 5B pav., Bendro FN kiekio (DOC ir SDS frakcijos suma) padidėjimą daugiausia lemia padidėjęs DOC tirpių, mažiau surinktų FN rezultatas. Tai eina kartu su reikšmingu sHA1 sukeltu DOC tirpiojo FN poslinkiu (apie 80% bendro FN tirpsta DOC), palyginti su CTRL (apie 40% bendro FN tirpsta DOC) (5C pav.). Priešingai nei sHA1, Hep neturėjo įtakos nei FN baltymų lygiui, nei FN jungties būklei, palyginti su negydyta kontrole. Labiausiai tikėtina, kad HA sulfavimas buvo atsakingas už šiuos padarinius, nes ne sulfatinis HA nepakeitė bendro FN baltymų kiekio ir parodė FN frakcijų pasiskirstymą, panašų į neapdorotą kontrolę. Apibendrinant galima pasakyti, kad FN jungties būklės apibūdinimas parodė, kad išskirtinai sHA1 sukėlė aiškų poslinkį nuo stipriai surinktų DOC netirpių iki mažiau surinktų DOC tirpių FN fibrilių.

Image

hBMSC buvo auginami TCPS ir nuo 1 dienos iki 8 dienos visam laikui buvo gydomi 200 μg Hep / ml, 200 μg HA / ml arba 200 μg sHA1 / ml. Neapdorotos ląstelės tarnavo kaip kontrolė (CTRL). 8 dieną ląstelės buvo lizuotos DOC buferiu. DOC netirpūs baltymai vėliau buvo ištirpinti SDS buferyje. Abiejoms frakcijoms buvo atliktas 4–15% (v / v) SDS PAGE gradiento gelis ir išanalizuotas FN baltymų (pagrindinės juostos esant ~ 220 kDa) Western blot analizei, naudojant vidinę kontrolę vimentin (juostos ~ 55 kDa). FN ir vimentinas buvo aptikti naudojant monokloninius pelių anti-žmogaus IgG / HRP konjuguotus anti-pelių IgG tuo pačiu blot ir po to nustatant chemoliuminescenciją. Paveikslėlyje ( A ) pateikiami du reprezentatyviai apkarpyti DOC tirpių ir DOC netirpių frakcijų to paties eksperimento Western blotai, apdoroti lygiagrečiai (viso ilgio blotai papildomame S3 paveiksle). Pagrindinės FN juostos esant ~ 220 kDa buvo identifikuotos iš tepinėlių juostų iš DOC netirpios frakcijos. Diagramoje ( B ) parodytas densiometrinis abiejų frakcijų Western blot signalų kiekybinis įvertinimas naudojant „ImageQuant“ programinę įrangą. FN densiometrinio įvertinimo vertės buvo susietos su vimentino vertėmis ir po to normalizuotos iki neapdorotos kontrolės (CTRL, pažymėta punktyrine linija). Reikšmės parodytos kaip vidurkis ± SEM, o reikšmingi skirtumai tarp sHA1 ir HA žymimi a (p <0, 05). n = 4. Bendrojo FN procento apskaičiavimas DOC netirpiose ir DOC tirpiose frakcijose pateiktas ( C ). Reikšmės parodytos kaip vidurkis ± SEM, o reikšmingi skirtumai tarp sHA1 ir CTRL nurodomi b (p <0, 01), n ​​= 4. 1 ir 8 dieną ląstelės buvo lizuotos RNR paruošimui ir analizuojamos atlikus atvirkštinę transkripciją, kad fn1 būtų išreikšta realia. laiko PGR ( D ). Lyginamasis kiekybinis įvertinimas buvo normalizuotas iki rps26. Kiekvieno laiko vertės buvo normalizuotos pagal CTRL (pažymėtos punktyrine linija) ir parodytos kaip vidurkis ± SEM. Reikšmingi Hep ir sHA1 skirtumai 8-ą dieną pažymėti a (p <0, 05). n = 3.

Visas dydis

Norint įvertinti, ar bendras didesnis FN baltymų kiekis ląstelių lizatuose, gydomuose sHA1, gali būti padidėjusios fn1 geno ekspresijos realiojo laiko PGR analizė, atlikta gydymo GAG 1 ir 8 dienomis. PGR analizė parodė, kad fn1 mRNR lygį žymiai padidino sHA1 1-osios dienos ir vėlesniais laiko momentais, tuo tarpu Hep ir ne sulfatinėmis HA apdorotose ląstelėse fn1 raiška buvo panaši į neapdorotą kontrolę (5 pav. D).

sHA1, bet ne Hep, padidina TNAP aktyvumą hBMSC

Kaip matyti, išskirtinai sHA1 padidino FN baltymų lygį ir pakeitė hBMSC FN matricos jungties būseną. Norint įvertinti šios pasekmės hBMSC diferenciacijai, buvo nustatytas TNAP, pripažinto ankstyvosios osteogeninės diferenciacijos 43 žymens, aktyvumas. sHA1 sukėlė reikšmingą TNB aktyvumo padidėjimą hBMSC maždaug 3, 5 karto, palyginti su negydytais kontroliniais preparatais, HA ir Hep (6A pav.). Keletas tyrimų parodė, kad sHA dariniai, kaip dirbtinių kolageno pagrindu pagamintų matricų komponentas, atskleidė osteogeninį poveikį hBMSC 11, 12 . 6B paveikslas parodo, kad fluorescencijos etiketė nepadarė įtakos sHA1 ir HA poveikiui TNAP aktyvumui. Kaip ir sHA1 poveikis FN struktūrai tęsėsi tol, kol jame buvo sHA1 (žr. 2C, D, F pav.), Taip pat dėl ​​sHA1 įtakos TNAP aktyvumui reikėjo nuolatinio gydymo sHA1 (6 pav. C). Pridedant sHA1 prie hBMSC kultūrų vėlesniais laiko momentais (4 arba 7 dieną), buvo prarastas osteogeninis poveikis. Visas GAG darinių poveikis TNAP aktyvumui taip pat nustatytas pagrindinėje terpėje (be osteogeninių papildų) ir osteogeninėje terpėje (DMEM, papildytas β-glicerofosfatu, askorbatu, deksametazonu) (taip pat žr. Papildomą S3 pav.).

Image

hBMSC buvo auginami TCPS (CTRL) ir buvo apdoroti ištirpintais GAG dariniais, kaip aprašyta. TNAP aktyvumas buvo nustatytas iš ląstelių lizatų 8 dieną. Diagramos rodo apskaičiuotas vertes kaip vidurkį ± SEM. ( A ) hBMSC 8 dienas buvo veikiami 200 μg GAG darinio / ml. Diagramoje parodytas TNAP aktyvumas, apskaičiuotas iš keturių skirtingų donorų, ir 100% buvo nustatyta neapdorota kontrolė (CTRL). Reikšmingi skirtumai tarp sHA1 ir CTRL, HA ar Hep yra pažymėti c (p <0, 001) ir b (p <0, 01). ( B ) hBMSC 8 dienas buvo gydomi 200 μg HA arba sHA1 / ml arba lygiaverčiu ATTO565 pažymėtu dariniu. n = 3. ( C ) hBMSC buvo veikiami 200 μg sHA1 / ml skirtingais laiko tarpais (d1-8, d4-8, d7-8), o TNAP aktyvumas buvo nustatytas 8 dieną. Neapdorota kontrolė (CTRL) buvo nustatyta į 100%. Reikšmingi (d1-8) ir CTRL, (d4-8) ar (d7-8) skirtumai nurodomi c (p <0, 001) ir a (p <0, 05). n = 3.

Visas dydis

Diskusija

Šiame tyrime pirmą kartą aprašome sulfatuoto HA darinio įtaką FN matricos surinkimui hBMSC išvestoje ECM. Buvo rasta, kad hBMSC ECM yra fluorescenciniu ženklu pažymėtas sulfato sHA1 darinys (ATTO565-sHA1), turintis fibrilinę struktūrą (2C – G pav.), Panašią į tą, kuri matoma su fluorescenciniu etikete Hep (2H pav.). Kartu dažant eksperimentai parodė stiprią ATTO565-sHA1 ir FN tarpląstelinio tinklo kolokalalizaciją, kuri buvo patvirtinta kiekybine kolokalizacijos analize (3 pav.). Tai atrodo pagrįsta, nes FN turi tris Hep surišimo sritis, kurios taip pat gali būti elektrostatiškai palankios sąveikai su sHA1, bet ne su ne sulfatinėmis HA. Mūsų lokalizacijos tyrimai su ATTO565-sHA1 ir FITC-Hep rodo abiejų sGAG elektrostatinę sąveiką su tarpląstelinėmis FN fibrilėmis (2 pav. C, H), tuo tarpu ne sulfatiniai ATTO565-HA nebuvo kolokalizuoti su FN (2 pav. B). SHA1-FN kolokalizacija buvo aptinkama tol, kol sHA1 buvo ECM (2 pav. C), ir buvo grįžtamoji pašalinus sHA1 (2 pav. D). Tai atitinka anksčiau paskelbtas išvadas, teigiančias, kad joninės sGAG-FN sąveikos yra grįžtamos fiziologinėmis sąlygomis, o paviršiaus difuzija ir dažni atsiribojimo ir pakartotinio surišimo įvykiai leidžia vienai sGAG grandinei sąveikauti su keliomis FN molekulėmis 44 . sGAG, jungiantis prie šių sričių, gali konkuruoti su kitomis molekulėmis perkrautoje FN fibrilės 19 aplinkoje, nes visos trys Hep surišimo sritys turi kelis surišimo partnerius (žr. 1 pav.).

Kokybiniai stebėjimai iš 2 pav. Rodo stiprų sHA1, bet ne Hep poveikį FN tinklo struktūrai. 8 dienas buvęs sHA1 sąlygojo FN matricos morfologiją, padidėjus plonesnėms fibriulėms, palyginti su negydyta kontrole. Nepaisant įrodytos FN sąveikos su Hep, panašios į sHA1, Hep neturėjo pastebimo poveikio FN tinklo struktūrai. Šis skirtumas greičiausiai grindžiamas skirtinga abiejų sGAG molekulių struktūra: Sintetinį sHA1 darinį sudaro nuoseklūs disacharidų vienetai, turintys taisyklingą ir vienodą sulfatų struktūrą per visą polimero ilgį 45 (žr. 7 pav.), Tuo tarpu natūralią Hep sudaro kintami disacharidų vienetai, turintys įvairius urono rūgšties likučius ir turintys labiau atsitiktinai paskirstytą, susikaupusį sulfato modelį 2, 4, 46 (žr. 8 pav.)

Image

HA susideda iš kintamų disacharidų vienetų (D-gliukurono rūgšties ir N-acetilgliukozamino), sujungtų glikozidiniais ryšiais. SHA1 darinys (DS 1.0–1.5) yra geriau sulfatuojamas N-acetilgliukozamino vieneto C6. HA ir sHA1 žymėjimas buvo atliktas naudojant ATTO565-NH2, todėl buvo atliktas karboksilo grupių ( A ) modifikavimas iš šono. Dvigubai paženklintas ATTO565-ATTO655-sHA1 darinys buvo gautas modifikuojant galą su ATTO565-NH2, po to atliekant funkcionalizavimą šone su ATTO655-NH2 ( B ).

Visas dydis

Image

Polimerinę grandinę sudaro pakartotiniai DN-acetilgliukozamino ir urono rūgšties (L-idurono rūgštis, retai D-gliukurono rūgštis) disacharidai, sujungti 1, 4-glikozidiniu ryšiu.

Visas dydis

Norėdami įvertinti sHA1 poveikį FN matricos surinkimo būklei, panaudojome tirpumo testą, kuris atskleidė, kad sHA1 sukėlė reikšmingą poslinkį nuo stipriai surinktų, netirpių DOC į mažiau surinktų, DOC tirpių FN fibrilių (4 pav.). Konversija į DOC netirpstančias FN fibrilės yra paremta stipriomis, ne kovalentiškomis baltymų ir baltymų sąveikomis 47 ir kitais veiksniais, tokiais kaip tarpląstelinio transglutaminazės katalizuojamas kryžminio sujungimo aktyvumas 48 ir tarpląstelinis disulfidinis ryšys, katalizuojamas vidinio FN 49 baltymo disulfido izomerazės aktyvumo. Visiems šiems veiksniams gali turėti įtakos sHA1 ir tokiu būdu užkirsti kelią DOC netirpių FN skaidulų susidarymui.

HA sulfatacija tiesiogiai paveikė ECM sudėtį, nes sHA1 buvimas padidino bendrą FN baltymo lygį (4 pav.), Kuris pirmiausia buvo pagrįstas sHA1 sukelta padidinta fn1 ekspresija , parodyta PGR analizės būdu. Nesulfatuotas HA neturėjo įtakos nei fn geno raiškai, nei jo baltymų lygiui, leidžiančiam manyti, kad HA sulfavimas yra varomoji jėga, reikalinga šiam efektui pasiekti. Be to, Hep neturėjo įtakos FN baltymo ar fn1 RNR lygiui, todėl buvo galima pasakyti apie specifinį sHA1 mechanizmą, pagrįstą nuolatiniu šios molekulės sulfacijos modeliu. Kitas tarpląstelinio FN fibrilių kaupimosi paaiškinimas gali būti sumažėjęs fermentinis FN matricos skaidymasis dėl proteolitinių fermentų. Ankstesni tyrimai parodė, kad sintetiniai sHA dariniai sumažino matricos metaloproteinazės-2 (MMP-2), vieno iš FN ardančių proteolitinių fermentų 14, 15, aktyvumą. Šį MMP sumažėjimą gali paskatinti padidėjęs SHA sukeltas MMP inhibitoriaus TIMP-3 (metaloproteinazės-3 audinio inhibitorius), kuris galėtų dar labiau prisidėti prie FN kaupimosi, blokuodamas su MMP susijusios matricos skilimą 15 .

FN konformacija ECM fibrilėse buvo įvertinta naudojant FRET molekulinės įtampos zondą FN. Esant sHA1, FN išsiplėtimas buvo panašus į anksčiau aprašytą Hep poveikį FN 35, tuo tarpu ne sulfatuotas HA neturėjo įtakos FRET santykiams, palyginti su negydytu kontroliniu preparatu (3 pav.). Taigi tikroji FN konformacija yra sGAG surišimo kartu su ląstelių sukeltu mechaniniu kamienu 22, 35, 41, 50 rezultatas. Nustatyta, kad abiejų sGAG (sintetinio sHA1, taip pat natūralaus Hep) surišimas FN sukelia konformacijos išplėtimą jo viduje. FN fibrilės deponuotos hBMSC gautame ECM. Nepakankamas HA nepastebėjo jokio matomo poveikio FN konformacijai, o tai atitinka anksčiau paskelbtus rezultatus 31 . Tai ypač svarbu, nes FN turi daugybę kripto rišimosi vietų, kurias galima atidengti ir paveikti sGAG surišus 31, 44, 51 . Šios kriptos yra įvairios FN savaiminio susibūrimo vietos, kurių ekspozicija reikalinga FN fibrillogenezei sukelti 52 . Tokie FN molekulių konformaciniai pokyčiai gali turėti drastiškų padarinių, nes jie stipriai reguliuoja FN funkciją, pvz., Augimo faktoriaus surišimas 31, 44 .

Specifinis sHA1 poveikis FN matricos surinkimo būklei ir baltymų lygiui buvo paskutiniame eksperimente, susijęs su osteogeninės hBMSC priklausymu linijai: Ankstyvasis osteogeninis žymeklis TNAP padidėjo tik esant sHA1, o ne HA ar Hep (5A pav.). Be to, nuo 1 dienos po sėjimo (d1-8) reikėjo nuolatinio sHA1 buvimo osteogeniniam įsipareigojimui ir dėl to TNAP aktyvumui (5 pav. C). Buvo pranešta, kad sGAG, ypač Hep ir heparano sulfatas, skatina BMSC 6, 35, 53 osteogenezę. Poveikis labai priklausė nuo ląstelių sistemų, išsamių sGAG savybių (dozių, molekulinio svorio, sulfato liekanų skaičiaus viename disacharido vienete (sulfacijos laipsnis DS), sulfacijos schema) ir protokolų (pvz., ECM fiksavimui).

Šis tyrimas parodė sintetinio sHA1 ir natūralaus hep panašumus į sąveiką su FN, sąlygojantį konformacinį FN tempimą ląstelėse gautose ECM skaidulose. Tačiau du sGAG atskleidė skirtingą poveikį FN baltymų lygiui ir matricos surinkimui: Čia pirmą kartą parodyta, kad sHA1, bet ne Hep, sukėlė didėjančią fn1 RNR, FN baltymo lygio ir DOC tirpių FN fibrilių kiekį. . Šiuos radinius galėtume susieti su padidėjusiu TNAP aktyvumu, rodančiu stiprų pro osteogeninį sHA1 poveikį hBMSC. Mes hipotezuojame, kad sHA1 sukeltas ECM tinklo pokytis yra pagrindinis veiksnys, keičiantis augimo faktoriaus surišimą ir tokiu būdu signalizavimą iš išorės, taigi pateikiame galimą sHA1 pro-osteogeninio poveikio hBMSC paaiškinimą.

Medžiagos ir metodai

Sintetinių HA darinių paruošimas

Natūralus didelės molekulinės masės HA buvo gautas iš „Aqua Biochem“ (išskirtas iš Streptococcus , M W (LLS, lazerio šviesos sklaida) = 1, 1 ∙ 10 6 g / mol, PD = 4, 8).

Suskaidytas mažos molekulinės masės HA buvo paruoštas, kaip aprašyta anksčiau, ir bus naudojama kaip etaloninė medžiaga in vitro eksperimentams, nes natūralaus HA pirmtako molekulinė masė sumažėja sulfatuojant 45, 54, 55, 56 HA darinių su sulfacijos laipsniu ( DS, sulfato liekanų skaičius viename disacharido vienete), lygus 1, 0–1, 5, nurodytas kaip mažai sulfatuotas HA darinys sHA1 (1 lentelė).

Pilno dydžio lentelė

HA darinių (HA, sHA1) funkcionalizavimas fluorescenciniais dažais ATTO565-NH2 buvo atliktas HA D-gliukurono rūgšties vieneto karboksilo grupėse (funkcionalizavimas šone), naudojant įprastą EDC / NHS sujungimo protokolą (pav. .7, 1 lentelė) 56, 57 . Dvigubu etikete pažymėtas ATTO565-ATTO655-sHA1 darinys buvo paruoštas sujungiant ATTO565-NH2 prie redukcinio sHA1 galo per azometino jungtį ir po to sumažinant C = N dvigubą jungtį (funkcionavimo pabaiga), po to sujungiant ATTO655. -NH2 GAG karboksilo grupėje, naudojant EDC / NHS (1-etil-3- (3-dimetilaminopropil) karbodiimidą / N-hidroksi sukcinimidą).

Hep dariniai

Natrio hep dariniai (DS 2, 2, disacharidų struktūra 8 pav.), Gauti iš kiaulės žarnyno gleivinės. Hep (Sigma-Aldrich) molekulinis svoris buvo nuo 6–30 kDa; fluorescencinis FITC (5-fluoresceino izotiocianatas) -Hep (λ ex = 491 nm, λ em = 516 nm; Polysciences) turėjo molekulių diapazoną nuo 17 iki 19 kDa.

HBMSC auginimas

Pagal Oswald ir kt., hBMSC buvo išskirti iš kaulų čiulpų aspiratų Drezdeno universitetinės ligoninės kaulų čiulpų transplantacijos centre . 58 . Tyrimą patvirtino Drezdeno technologijos universiteto vietos etikos komisija (etikos balsavimo Nr. EK114042009) ir donorai (moterys ir vyrai, vidutinis amžius 28, 2 metų) buvo informuoti apie procedūras ir davė sutikimą. Metodai buvo atlikti laikantis atitinkamų gairių (geroji mokslo praktika pagal Vokietijos tyrimų fondo (DFG) gaires).

Eksperimentams 7 000 hBMSC / cm2 buvo dedama ant audinių kultūros polistirolo plokštelių (TCPS). Buvo naudojamas „Dulbecco Modified Eagle“ vidutiniškai mažas gliukozės kiekis (DMEM) su 10% (v / v) termiškai inaktyvuoto veršelio vaisiaus serumo (FCS), 20 μg streptomicino / ml ir 20 U penicilino / ml. hBMSC buvo apdoroti 200 μg GAG / ml. Jei neminėta, GAG buvo įpilama praėjus 2 valandoms po sėjos ir vėl kiekvieną kartą keičiant terpę du kartus per savaitę.

Siekiant didesnio TNAP (audinių nespecifinės šarminės fosfatazės) indukcijos, 4 dieną į terpę buvo dedami osteogeniniai papildai.

Imunofluorescencinis dažymas

Imunofluorescencinis dažymas buvo atliktas, kaip aprašyta anksčiau, 13, 14, 55 . Fiksuotos ląstelės buvo inkubuotos su pirminiu monokloniniu pelės anti-žmogaus FN antikūnu (1, 25 μg / ml; BD Biosciences), po to inkubuojamos su antriniu antikūnu AlexaFluor488 arba AlexaFluor568 konjuguotu ožkos anti-pelės IgG ir 0, 2 μg DAPI / ml (4 ′, 6-diamidino-2-fenilindolis). Vėliau ląstelės buvo įdėtos į „Mowiol 4–88“ ir vizualizuotos naudojant „Olympus IX70“ fluorescencinį mikroskopą.

Kad būtų galima aptikti tarpląstelinę sHA1 lokalizaciją, ląstelės buvo pašalintos iš ECM ankstesnio fiksavimo etapo, inkubuojant 25 mM NH4OH 20 minučių kambario temperatūroje, išlaikant nepažeistą endogeninį ECM.

Susikūrusių FN fibrilių analizė

Kad būtų įrodytas sHA1 įsiskverbimas į besiformuojančias FN fibrinas, hBMSC tuo pačiu metu buvo gydomi tirpiais, „AlexaFluor488“ pažymėtais plazmos FN ir ATTO655-sHA1. FN buvo išskirtas iš žmogaus plazmos (kraujo perpylimo tarnyba, Šveicarijos Raudonasis Kryžius, Ciurichas), naudojant želatinos-sefarozės chromatografiją. Susietas FN iš kolonėlės išplaunamas 6 M karbamido tirpalu, surenkamas ir užšaldomas tolimesniems tyrimams. Vienkartiniam žymėjimui buvo naudojamas 60 kartų molinis AlexaFluor488 karboksirūgšties sukcinimidilo esterio perteklius ir inkubuotas 1 valandą kambario temperatūroje (185 μg dažų 2, 1 mg FN). Tuomet laisvieji dažai buvo pašalinti išleidžiant baltymų tirpalą per PD-10 kolonėlę, o buferis pakeistas į PBS.

Susidarančioms FN fibrilėms stebėti hBMSC buvo pasėtos į 8 šulinėlių kameros stiklelius, kurių tankis buvo 14 000 ląstelių / cm2, kad per 24 valandas po sėjimo būtų gautas vientisas sluoksnis. Praėjus 24 valandoms po sėjimo, hBMSC buvo apdoroti 5 μg su AlexaFluor488 pažymėtu FN / ml, 45 μg plazmos FN / ml ir 200 μg ATTO565-sHA1 / ml. Po 48 valandų ląstelės buvo pritvirtintos, dažytos DAPI ir įterptos į Mowiol 4–88, kaip aprašyta anksčiau.

Kolokalizacijos analizė

Imunofluorescencijos signalų kolokalizavimas buvo analizuotas naudojant Fidžio programinę įrangą, naudojant kolokalizacijos papildinį JACoP 39 . Slenkstis buvo nustatytas automatiškai, naudojant Otsu metodą, kuris geriausiai atitiko aptiktus signalus. Kolokalizacijos vertės (Pearsono, Manderso koeficientai) 59 buvo apskaičiuotos iš 15 reprezentatyvių vaizdų iš kiekvieno iš trijų nepriklausomų eksperimentų.

FRN FN analizė

FN buvo išskirtas iš žmogaus plazmos, kaip aprašyta anksčiau 22 . Kripto cisteino likučiai buvo atidaryti etiketėms denatūruoti 4 M guanidino hidrochloride (GdnHCl). Akceptoriaus žymėjimui buvo naudojamas 30 kartų molinis AlexaFluor546 C5 maleimido (akceptoriaus A) perteklius ir inkubuotas 1 valandą kambario temperatūroje. Tuomet laisvieji dažai buvo pašalinti išleidžiant baltymų tirpalą per PD-10 kolonėlę ir buferis buvo pakeistas į PBS su 0, 1 M NaHC03, esant pH 8, 5. Donorų žymėjimui buvo naudojamas 70 kartų molinis AlexaFluor488 karboksirūgšties sukcinimidilo esterio (D donoras) perteklius, norint sujungti laisvuosius aminus ir gauti dvigubai paženklintą FN-DA 21, 22 . Po 1 valandos inkubacijos laisvieji dažikliai vėl buvo pašalinti, praleidžiant baltymų tirpalą per PD-10 kolonėlę. Šiame tyrime naudotai FN-DA partijai buvo apskaičiuota vidutiniškai 7, 5 donoro etikečių ir 3, 5 akceptorinių etikečių vienai FN molekulėi.

Mėginiui paruošti hBMSC buvo pasėjama į 8 šulinėlių kameros stiklelius, kurių tankis yra 14 000 ląstelių / cm2, kad per 24 valandas gautųsi monosluoksnis. Praėjus 2 valandoms po sėjimo, ląstelės buvo apdorotos 5 μg FN-DA / ml ir 45 μg plazmos-FN / ml. 200 μg GAG / ml (Hep, HA arba sHA1) buvo įpilta po 24 valandų. Po 48 valandų inkubacijos su GAG, mėginiai buvo pritvirtinti 4% (m / v) paraformaldehido ir įterpiami į Mowiol 4–88.

FRET analizė buvo atlikta pagal Smith et al. 22 Vaizdai buvo gauti naudojant „Olympus FV-1000“ skenuojantį lazerinį konokalinį mikroskopą su 40x vandens objektyvu (NA 0, 90). Vaizdų analizė buvo atlikta naudojant MATLAB, remiantis pritaikyta ankstesnio scenarijaus versija 22 . Kiekvienai imčiai buvo išanalizuota 10 atsitiktinai parinktų regėjimo laukų. Reprezentatyviosios histogramos buvo apskaičiuojamos iš visų duomenų pikselių kiekvienoje grupėje. FRET santykis buvo koduojamas spalvomis, kad būtų gaunami FRET vaizdai. Visi FRET santykiai (I A / I D, intensyvumo akceptorius / intensyvumo donoras) buvo sukalibruoti pagal skirtingas FN konformacijas 22 GdnHCl tirpale (0 M GdnHCl (FRET santykis 0, 64), 1 M (0, 44), 2 M (0, 30), 4 M. (0, 22)).

FN tirpumo tyrimas

Ląstelės buvo sėjamos į 6 cm petri lėkšteles ir visam laikui apdorojamos 200 μg GAG / ml. 8 dieną FN matricos sąranka buvo analizuojama naudojant deoksicholato (DOC) tirpumą kaip kriterijų, leidžiantį atskirti mažiau ir stipriai surinktus FN pluoštus 36 . Ląstelės buvo lizuotos 150 μl DOC lizės buferiu. DOC netirpi medžiaga buvo išskirta centrifuguojant ir po to ištirpinta 40 μl natrio dodecilsulfato (SDS) buferyje.

Abiejų frakcijų baltymų koncentracija buvo nustatyta Bradfordo tyrimu. Vienodi suminiai baltymų tirpių DOC ir DOC netirpių frakcijų kiekiai buvo redukuoti naudojant β-merkaptoetanolį, virinama 5 minutes ir išskaidyta SDS poliakrilamido gelio elektroforeze (PAGE). Šlapias pernešimas buvo atliktas ant nitroceliuliozės membranos ir atlikta Western blot analizė, kaip aprašyta anksčiau 13, naudojant pirminį monokloninį pelės anti-žmogaus antikūną FN (50 ng / ml) ir vimentiną (29 μg / ml; Dako Agilent Technologies). Buvo atliktas chemiliuminescencijos nustatymas ir mėginiai buvo analizuojami densiometriškai.

Genų ekspresijos analizė

RNR buvo tiesiogiai paruošta iš lizatų ir realiojo laiko PGR analizė buvo atlikta, kaip aprašyta anksčiau 11 . Pradmenis sintezuoja Eurofins MWG Operon, norėdamas nustatyti fn1 (114 bp, 5′-3 ′ sekas: priekinė CTGGCCAAAAATATATATGTAAA, atvirkštinė CCACAGTCGGGTCTCGGAG) ir ribosominį baltymą S26 ( rps26 ; 189 bp, 5′-3ACAGGAGGATGAAA sekos: pirmyn CAATGATGAAAA).

TNAP aktyvumo nustatymas

TNAP aktyvumas buvo nustatytas iš ląstelių lizatų, kaip anksčiau aprašyta 11, 12, 13 . Lizato baltymų koncentracija buvo atskirai nustatyta Bradfordo tyrimu, o TNAP aktyvumas buvo apskaičiuotas mU / mg baltymo.

Statistinė analizė

Eksperimentai buvo atlikti su nesujungtais trijų ar keturių kaulų čiulpų donorų hBMSC preparatais dviem egzemplioriais. Rezultatai pateikiami kaip vidurkis ± vidurkio standartinė paklaida (SEM). Statistinis reikšmingumas buvo išanalizuotas atliekant vienpusę dispersijos analizę (ANOVA), po to atlikus porinį post hoc Bonferroni testą. P vertės <0, 05 buvo laikomos statistiškai reikšmingomis.

Papildoma informacija

Kaip pacituoti šį straipsnį : Vogel, S. et al. Sulfatuotas hialuronanas keičia fibronektino matricos rinkinį ir skatina osteogeninę žmogaus kaulų čiulpų stromos ląstelių diferenciaciją. Mokslas. Rep. 6, 36418; „doi“: 10.1038 / srep36418 (2016).

Leidėjo pastaba : „Springer Nature“ išlieka neutralus paskelbtų žemėlapių jurisdikcijos reikalavimų ir institucinių ryšių atžvilgiu.

Papildoma informacija

PDF failai

  1. 1.

    Papildoma informacija

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.