Rinkliava panašus 4-asis receptorius salelių β ląstelėse jaučia ekspresijos pokyčius 1 didelės grupės mobilumo grupėje ir prisideda prie 1 tipo diabeto atsiradimo | eksperimentinė ir molekulinė medicina

Rinkliava panašus 4-asis receptorius salelių β ląstelėse jaučia ekspresijos pokyčius 1 didelės grupės mobilumo grupėje ir prisideda prie 1 tipo diabeto atsiradimo | eksperimentinė ir molekulinė medicina

Anonim

Anotacija

1 tipo cukrinį diabetą sukelia autoimuninis β ląstelių sunaikinimas salelėse. Pastaraisiais metais buvo siūloma įgimtam imunitetui vaidinti pagrindinį vaidmenį šiame procese. 1 didelio judrumo grupės langelis (HMGB1), daugelio autoimuninių ligų uždegiminis sukėlėjas, suaktyvina priešuždegiminius atsakus po jo išsiskyrimo iš nekrotinių ląstelių. Mūsų tikslas buvo nustatyti HMGB1 reikšmę natūralioje diabeto istorijoje pelėms, kurioms nebuvo nutukusi diabeto (NOD). Mes pastebėjome, kad HMGB1 raiškos greitis salelių citoplazmoje buvo daug didesnis pelėms, sergančioms diabetu, palyginti su nediabetinėmis pelėmis. Dauguma ląstelių, teigiamai nudažytų dėl rinkliavai panašaus 4 receptoriaus (TLR4), buvo β ląstelės; kelios α ląstelės buvo nudažytos TLR4. Taigi mes ištyrėme anti-TLR4 antikūnų poveikį HMGB1 ląstelių sujungimui su paviršiumi, kurie patvirtino, kad HMGB1 sąveikauja su TLR4 izoliuotose salelėse. Išraiškos pokyčiai HMGB1 ir TLR4 buvo nustatyti per visą diabeto eigą. Mūsų išvados rodo, kad TLR4 yra pagrindinis β ląstelių receptorius ir kad HMGB1 per TLR4 gali signalizuoti selektyviai pažeisti β, o ne α ląsteles, kai vystosi 1 tipo cukrinis diabetas.

Įvadas

Manoma, kad 1 tipo cukrinis diabetas (T1DM), taip pat žinomas kaip nuo insulino priklausomas cukrinis diabetas arba nepilnamečių diabetas, atsiranda dėl imuninės sistemos sąveikos su painiu aplinkos ir genetinių veiksnių tinklu (Pino ir kt., 2010). . Pagrindinis T1DM bruožas yra ląstelių sukeliamas insuliną išskiriančių β ląstelių sunaikinimas kasos salelėse (Giarratana ir kt., 2004).

Iš pradžių HMGB1 beveik prieš 30 metų buvo identifikuotas kaip branduolinis baltymas, svarbus transkripcijos reguliavimui. HMGB1 sukelia DNR lenkimą ir palengvina kelių reguliavimo baltymų kompleksų prisijungimą prie DNR (Zhang ir kt., 1999; Lotze ir Tracey, 2005; Li ir kt., 2010). Įrodyta, kad ne tik vaidmuo transkripciniame reguliavime, HMGB1 aktyvina uždegimą sukeliančias reakcijas po nekrotinių ląstelių patekimo į tarpląstelinę aplinką (Wang ir kt., 2010). HMGB1 taip pat susijęs su daugelio ligų, susijusių su uždegimu ir audinių pažeidimais, patogenezėje (Wang ir kt., 2010). Neseniai daugelis tyrimų teigė, kad HMGB1 veikia kaip uždegiminis trigeris tokioms autoimuninėms ligoms kaip reumatoidinis artritas ir sisteminė raudonoji vilkligė (SLE) (Wittemann ir kt., 1990; Abdulahad ir kt., 2010).

Į HMGB1 signalizaciją buvo įtraukti keli svarbūs receptoriai, įskaitant rinkliavas primenančios receptorių šeimos narius (TLR) ir pažengusių gliukacijos galutinių produktų receptorius (RAGE) (Klune et al., 2008). TLR šeima yra evoliuciškai išsaugotas įgimtos imuninės sistemos komponentas (Medzhitov, 2007). Neseniai aptikti TLR ir atlikti tyrimai su gyvūnų modeliais sukėlė hipotezę, kad įgimta imuninė sistema vaidina pagrindinį vaidmenį sukeliant autoimuninį procesą (Meyers et al., 2010). RAGE, kuris specifiškai suriša pažangiausius glikikacijos galutinius produktus, yra ląstelių paviršiaus receptorių imunoglobulinų superšeimos narys (Song ir kt., 2011). HMGB1 gali signalizuoti TLR ir RAGE, kad suaktyvintų branduolinį faktorių-KB (NF-κB), sukeliantį uždegimą sukeliančių citokinų gamybą ir leukocitų adhezijos molekulių reguliavimą, taip skatinant sužalojimus ir uždegimą (Van Beijnum et al., 2008; Nogueira-Machado). et al., 2011).

Gerai žinoma, kad α ląstelės neturi įtakos diabeto vystymuisi, tuo tarpu β ląstelės smarkiai sunaikinamos, nors α ląstelės sudaro žiedą ir sukuria fizinį barjerą aplink β ląsteles. Šiame tyrime HMGB1 pasiskirstymas kasoje buvo tiriamas imunohistocheminiu dažymu, kuris parodė, kad HMGB1 raiškos greitis salelių citoplazmoje buvo daug didesnis pelėms, sergančioms cukriniu diabetu, palyginti su nediabetinėmis pelėmis. Ne nutukusioms diabeto (NOD) pelėms išsivysto savaiminė autoimuninio diabeto forma, imituojanti daugelį žmogaus ligos bruožų ir paprastai išsivysčiusi nuo 12 iki 14 savaičių (Anderson ir Bluestone, 2005). Mes išbandėme savo hipotezę, kad skirtingi HMGB1 receptoriai pasiskirsto skirtinguose kasos ląstelių tipuose NOD pelėse. Taigi mes ištyrėme anti-TLR2, anti-TLR4, anti-TLR9 ir anti-RAGE antikūnų poveikį HMGB1 ląstelių sujungimui su paviršiumi, kurie patvirtino, kad HMGB1 sąveikauja su TLR4 izoliuotose salelėse. Šie HMGB1 ir TLR4 pokyčiai buvo nustatyti per visą diabeto eigą. Ankstyvosiose diabeto stadijose jie buvo žymiai iš naujo sureguliuoti, o laikui bėgant lėtai mažėjo. Mūsų duomenys pateikia tvirtų įrodymų, kad TLR4 yra pagrindinis β ląstelių receptorius ir kad HMGB1, kuris pasyviai išsiskiria iš pažeistų salelių ląstelių, veikia per TLR4 signalizacijos kelią, selektyviai pažeisdamas β, o ne α ląsteles, kai vystosi autoimuninis diabetas.

Rezultatai

HMGB1 yra susijęs su salų sunaikinimu

Kadangi buvo pranešta, kad HMGB1 gali pasyviai išsiskirti iš pažeistų ląstelių (Abdulahad et al., 2010) arba nekrozuotų audinių (Lin et al., 2011a, 2011b), mes ištyrėme, ar jis taip pat išsiskiria iš pažeistų salelių ląstelių T1DM NOD pelės. Histologinis ir morfologinis kasos pjūvių, dažytų hematoksilinu ir eozinu, vertinimas parodė, kad diabetinėms NOD pelėms yra didelis salų sunaikinimas (1B pav.), Palyginti su 4 savaičių amžiaus nediabetinėmis pelėmis (1A pav.). Mes taip pat ištyrėme HMGB1 raišką ir pasiskirstymą ląstelėse NOD kasos audinių mėginiuose imunohistocheminiu dažymu. HMGB1 daugiausia buvo lokalizuotas salelių ląstelių branduoliuose 4 savaičių nediabetinėmis NOD pelėmis (1C pav.). Tačiau HMGB1 padidėjo salelių citoplazmoje progresuojant diabetui (1D pav.). HMGB1 ekspresijos greitis salelių citoplazmoje buvo daug didesnis pelėms, sergančioms diabetu, palyginti su nediabetinėmis pelėmis ( P <0, 01) (1E pav.). Apibendrinant, mūsų duomenys rodo, kad HMGB1 gali pasyviai išsiskirti iš pažeistų salelių ląstelių arba uždegtų salelių ląstelių autoimuniteto metu.

Image

Kasos sekcijų dažymas hematoksilinu ir eozinu rodo, kad diabetinės NOD pelės (B) yra smarkiai pažeidusios saleles, palyginti su 4 savaičių, nediabetinėmis NOD pelėmis (A). Imunohistocheminis dažymas parodo, kad HMGB1 yra lokalizuotas salelių ląstelių branduoliuose 4 savaičių amžiaus be diabeto pelėms (C, E). HMGB1 raiška salelių citoplazmoje yra daug didesnė, kai vystosi diabetas (D, F). HMGB1 raiškos greitis salelių citoplazmoje buvo daug didesnis pelėms, sergančioms diabetu, palyginti su nediabetinėmis pelėmis (E) ** P <0, 01 ( n = 9 vienai grupei).

Visas dydis

HMGB1 receptorių ekspresija NOD pelių kasos salelėse

HMGB1 receptorių, įskaitant TLR2, TLR4, TLR9 ir RAGE, raiška ir pasiskirstymas ląstelėse NOD pelių kasos salelėse buvo ištirtas imunofluorescencijos būdu ir vizualizuotas konfokalinės mikroskopijos būdu. TLR2, TLR9 ar RAGE ekspresija buvo nedidelė arba visai nebuvo nustatyta keturių savaičių, nediabetinių NOD pelių kasos salelėse (2B ir 2J bei 2N paveikslai). TLR4, priešingai, buvo lokalizuotas salelėse ir parodė padidėjusią ekspresiją 4 savaičių nediabetinėmis NOD pelėmis (2F pav.).

Image

HMGB1 receptorių (TLR2, TLR4, TLR9 ir RAGE) ir insulino ekspresija 4 savaičių nediabetinių NOD pelių kasos salelėse. (A, E, I, M) β ląstelių imuninis apšvietimas (raudonasis). (B, F, J, N) TLR2, TLR4, TLR9 ir RAGE imuniniai dažikliai (žali). (C, G, K, O) DAPI branduolinis dažymas (mėlynas). Kasos salelės, gautos iš 4 savaičių nediabetinių NOD pelių, rodo mažai TLR2 (B), TLR9 (J) ar RAGE (N). Priešingai, TLR4 yra labai išreikštas salelėse (žaliosiose) 4 savaičių nediabetinėmis NOD pelėmis (F). TLR4 ir insulino (H) lokalizacija (geltona) rodo, kad TLR4 daugiausia ekspresuojamas β ląstelėse. .

Visas dydis

Toliau mes ištyrėme, kurie iš kasos ląstelių tipų buvo teigiami TLR4 receptoriams. 4 savaičių nediabetinėmis NOD pelėmis mes atlikome dvigubą salas ir β ląstelių žymėjimą TLR4. TLR4 daugiausia buvo paplitęs citoplazmoje. Be to, ląstelės, ekspresuojančios TLR4, buvo insulino teigiamos ląstelės (ty, β ląstelės), kurios sudaro didžiąją dalį salelių ląstelių (2E-2H paveikslai). Gliukagono teigiamos ląstelės (α ląstelės) sudarė žiedą aplink salelę; tačiau santykinai nedaug α ląstelių išreiškė TLR4 (3 paveikslas).

Image

TLR4 nėra ekspresuojamas α ląstelėse. 4 savaičių nediabetinių NOD pelių salelės buvo pažymėtos dvigubu etikete su TLR4 ir gliukagonu. (A) Gliukagono imuninis dažymas (raudonas). (B) TLR4 receptorių imuninis dažymas (žalias). (C) DAPI branduolinis dažymas (mėlynas). (D) TLR4 ir gliukagono lokalizacija rodo retą TLR4 ekspresiją α ląstelėse.

Visas dydis

HMGB1 sąveikauja su TLR4 izoliuotose salelių ląstelėse

Norėdami toliau tirti HMGB1 ir jo atitinkamų receptorių sąveiką, mes ištyrėme anti-TLR2, anti-TLR4, anti-TLR9 ir anti-RAGE antikūnų poveikį HMGB1 ląstelių paviršiaus rišimui salelėse, naudodami konfokalinę mikroskopiją. Salos buvo išskirtos iš 4 savaičių nediabetinių NOD pelių ir išgrynintos rankomis. Tada išsklaidytos salelės ląstelės buvo kultivuojamos standartinėje terpėje. N-hidroksisukcinimido (NHS) -fluoresceino-HMGB1 surišimas ląstelių paviršiuje buvo pastebėtas salelių ląstelėse, inkubuotose su NHS-fluoresceinu-HMGB1 6 h 4 ℃, ir dažymas sudarė žiedinį modelį (4A pav.). Pirminis gydymas anti-TLR2, anti-TLR9, anti-RAGE ar IgG neturėjo reikšmingos įtakos HMGB1 ląstelių paviršiaus rišlumui (4B-4E paveikslai). Tačiau anti-TLR4 antikūnai (4F paveikslas) arba nepaženklinti HMGB1 (4G paveikslas) sumažino HMGB1 ląstelių sujungimą su paviršiumi, parodydami sumažėjusį su ląstelėmis susijusį fluorescencijos intensyvumą, palyginti su kontroliniais IgG. Šie rezultatai rodo, kad HMGB1 fiziškai sąveikauja su TLR4 salelių ląstelėse.

Image

TLR antikūnų poveikis HMGB1 surišimui ant paviršiaus. Salos buvo išskirtos iš 4 savaičių necukrinio diabeto NOD pelių, apleistos šešių šulinėlių plokštelėmis ir panaudotos 70% santakoje. (A) Salų inkubacija su NHS-fluoresceinu-HMGB1 6 valandas 4 ℃ temperatūroje davė žiedinį dažymo modelį. (BG) Ląstelės taip pat buvo iš anksto inkubuotos su 25 µg / ml anti-TLR2 (B), TLR9 (C), RAGE (D), IgG (E), TLR4 (F) arba nepaženklintu HMGB1 (G) 30 minučių 4 ° C temperatūroje. ℃ Opti-MEM I terpėje, po to 5 h / ml NHS fluoresceinu pažymėtas HMGB1 6 h 4 ℃ temperatūroje. Tada ląstelės tris kartus plaunamos PBS (pH 7, 2) ir 20 minučių fiksuojamos kambario temperatūroje 2% paraformaldehido-PBS. Po fiksavimo fluorescencija buvo užregistruota konokaliniu mikroskopu.

Visas dydis

HMGB1 ir TLR4 baltymų ekspresija NOD pelių kasoje

Kasos HMGB1 ir TLR4 baltymų ekspresija buvo vertinama atliekant Western blot analizę įvairiais NOD pelių natūralios diabeto istorijos laikotarpiais (5 paveikslas). Kasos raiška tiek HMGB1, tiek TLR4 buvo maža NOD pelių (4-6 savaičių amžiaus). Kasos HMGB1 ir TLR4 ekspresija, priešingai, ankstyvoje diabeto stadijoje (10–14 savaičių amžiaus) buvo reikšmingai padidinta ( P <0, 01). Mūsų nuostabai, vyresnio amžiaus diabetu sergančių pelių (28–32 savaičių amžiaus) HMGB1 ir TLR4 baltymų ekspresija buvo žymiai sumažinta ( P <0, 01).

Image

HMGB1 ir TLR-4 baltymų ekspresijos Western blot analizė. Kasos skydinė HMGB1 ir TLR4 ekspresija buvo maža nediabetinėmis NOD pelėmis (4–6 savaičių amžius). Ankstyvoje diabeto stadijoje (10–14 savaičių amžiaus) HMGB1 ir TLR4 baltymų ekspresija buvo reikšmingai sureguliuota. Pelėms, sergančioms nustatytu diabetu (28-32 savaičių amžius), HMGB1 ir TLR4 raiška sumažėjo. Duomenys gauti iš trijų nepriklausomų eksperimentų. ** P <0, 01, palyginti su kontrolinėmis ir vėlyvos stadijos normaliomis pelėmis.

Visas dydis

Kasos HMGB1 ir TLR4 mRNR raiškos pokyčiai NOD pelių diabeto vystymosi metu

Kasos 3–5 savaites kasos HMGB1 ir TLR4 mRNR raišką vertinome NOD pelių diabeto vystymosi metu (6 pav.). Ši analizė neparodė jokių ryškių HMGB1 mRNR raiškos pokyčių per pirmąsias 8 NOD pelių gyvenimo savaites. Tačiau HMGB1 mRNR ekspresija reikšmingai padidėjo 10 savaičių amžiaus, o po to lėtai ekspresija mažėjo laikui bėgant, kad pasiektų panašų lygį kaip ir 8 savaičių amžiaus.

Image

Kasos mRNR išraiška HMGB1 ir TLR-4 mRNR. Kasos audinys buvo gaunamas iš NOD pelių (8 pelės per kartą) kas 3–5 savaites nuo 4 iki 32 savaičių ir jiems buvo atliktas qRT-PGR. Vertės yra vidurkiai ± vidurkio standartinė paklaida. Duomenys gauti iš trijų nepriklausomų eksperimentų. * P <0, 05 (HMGB1) 8 ir 10 savaičių, 10 ir 12 savaičių, 12 ir 16 savaičių bei 20 ir 26 savaičių (Wilcoxon pasirašytas rango testas). ** P <0, 05 (TLR4) 4 ir 6 savaičių, 6 ir 8 savaičių, 8 ir 10 savaičių, 12 ir 16 savaičių, 16 ir 20 savaičių, 26 ir 32 savaičių. (Wilcoxono pasirašytas rango testas).

Visas dydis

Kuriant diabetą, NOD pelėms buvo būdingas didelis TLR4 mRNR ekspresijos vienodumas. Po 6 savaičių TLR4 mRNR raiška pastebimai padidėjo, palyginti su 4 savaičių amžiumi. Šis padidėjimas buvo trumpalaikis, o po 8–10 savaičių labai padidėjo TLR4 mRNR ekspresija, vėliau reikšmingai sumažėjo vertės.

Diskusija

HMGB1 atsirado daugiau nei prieš 500 milijonų metų, prieš pasiskirstant gyvūnų ir augalų karalystėms (Han et al., 2008). Todėl tai yra vienas evoliuciškai konservuotų baltymų eukariotų karalystėje, turintis 99% aminorūgščių tapatumą tarp graužikų ir žmonių (Han et al., 2008). HMGB1 gali pasyviai atpalaiduoti sužeistos arba nekrotinės ląstelės arba aktyviai sekretuoti makrofagai (Lin et al., 2011a). HMGB1 išleidimas į tarpląstelinę aplinką, kur jis gali veikti kaip endogeninis pavojaus signalas arba „aliarmas“ uždegimui skatinti, yra susijęs su keliomis ligomis, tokiomis kaip sepsis ir ūmus plaučių pažeidimas (Wang ir kt., 2010).

HMGB1 daro pleiotropinį poveikį, jungdamasis su keliais į rinkliavas panašiais šeimos nariais, įskaitant TLR2, TLR4, TLR9 ir RAGE, ir tokiu būdu skatina uždegiminius procesus (Klune et al., 2008; Gdynia et al., 2010). TLR yra 1 tipo transmembraniniai receptoriai ir atpažįsta skirtingus su patogenais susijusius molekulinius modelius (PAMP) per jų leucino turtingus pakartojimus ekstracitoplazminėje srityje (Miranda-Hernandez ir kt., 2011). TLR taip pat gali atpažinti endogeninę medžiagą ląstelės sužalojimo metu (Johnson ir kt., 2003). TLR šeima vaidina svarbų vaidmenį įgimtam ir adaptyviam žinduolių imuniniam atpažinimui. Pavyzdžiui, TLR4 atpažįsta gramneigiamo produkto lipopolisaharidą ir dalyvauja kelių endogeninių ligandų, įskaitant šilumos šoko baltymus, atpažinime, tuo tarpu TLR2 atpažįsta įvairius grybelinius, gramneigiamus ir mikobakterinius komponentus (Yu et al., 2006). TLR9 atpažįsta bakterijų CpG DNR sekas, o HMGB1 dalyvauja TLR9 aktyvavime, dėl to subręsta imuninės ląstelės ir išsiskiria citokinų sekrecija (Klune ir kt., 2008; Miranda-Hernandez ir kt., 2011). Be to, nuo HMGB1 priklausomas RAGE aktyvinimas skatina NF-κB kelio suaktyvinimą, taip pat signalo perdavimą per ERK ir p38, siekiant skatinti citokinų gamybą ir ląstelių išgyvenimą (Lotze ir Tracey, 2005).

T1DM yra autoimuninė liga, kai sutrikęs įgimto imuninio atsako signalas yra susijęs su ligos progresavimu. Dabartiniai duomenys rodo, kad įgimtos imuninės sistemos anomalijos vaidina svarbų vaidmenį patogenezuojant T1DM. Kai kuriems T1DM sergantiems žmonėms virusinė infekcija gali sukelti NK dominuojantį insulitą, β ląstelių disfunkciją ir ilgainiui sukelti hiperglikemiją ir diabetą (Grieco ir kt., 2011). TLR2 ir TLR4 raiška, kartu su jų taikiniais pasroviui, padidėjo monocituose, gautuose iš pacientų, sergančių T1DM (Pino ir kt., 2010). Naudodami streptozotocino sukeltą diabetinę C57BL / 6 pelės modelį, Devaraj ir kt. nustatė, kad TLR4 genetinis trūkumas reikšmingai sumažino MyD88 ir IRAK-1 baltymų fosforilinimą ir NF-κB aktyvumą, ir sušvelnino T1DM priešuždegiminę būseną (Devaraj ir kt., 2011).

Šio tyrimo tikslas buvo ištirti, ar HMGB1 dalyvauja T1DM patogenezėje, ir nustatyti receptorius, dalyvaujančius HMGB1 tarpininkaujant uždegimo signalizacijos aktyvavimui NOD pelėms. Pirmiausia pastebėjome, kad HMGB1 ekspresijos laipsnis salelių citoplazmoje buvo daug didesnis pelėms, sergančioms diabetu, palyginti su nediabetinėmis pelėmis, kurios gali būti susijusios su salelių sunaikinimu ar insulitu. Mes pradėjome HMGB1 receptorių (TLR2, TLR4, TLR9 ir RAGE) raišką skirtingose ​​kasos salelių ląstelėse iš nediabetinių NOD pelių. Mes nustatėme, kad dauguma ląstelių, teigiamai nudažytų TLR4, buvo β ląstelės, ir tai sudarė didžiąją dalį salelių esančių ląstelių. Ankstyvoje diabeto stadijoje (8–10 savaičių amžiaus) buvo sureguliuota tiek HMGB1, tiek TLR4 raiška, o tai gali pagreitinti diabeto vystymąsi. Tačiau HMGB1 ir TLR4 išraiška reikšmingai sumažėjo vėlyvoje diabeto stadijoje (16–32 savaičių amžiuje), palyginti su ankstyva diabeto stadija (8–10 savaičių amžiaus), kuri gali atsirasti sunaikinus dauguma β ląstelių salelėse ir atitinkamų receptorių skaičiaus sumažėjimas. Dabartiniai atradimai rodo, kad β ląstelėse esantis TLR4 gali pajusti HMGB1, išsiskiriančio iš nekrozinių salelių ląstelių, pokyčius, dėl kurių aplink saleles gali atsirasti uždegimas ir prisidėti prie autoimuninio diabeto atsiradimo.

Mūsų žiniomis, ši ataskaita yra pirmoji, apibūdinanti ryšį tarp HMGB1 ir jo receptorių izoliuotose NOD pelių salelėse, kuris yra puikus T1DM pavyzdys žmonėms. Mes nustatėme pokyčius, kurie įvyksta kasos HMGB1 ir TLR4 baltymų ir mRNR ekspresijoje per visą diabeto eigą NOD pelėms. Mūsų pastebėjimai rodo, kad TLR4 yra pagrindinis β ląstelių receptorius ir kad HMGB1 pasyviai atpalaiduojamas iš pažeistų salelių ląstelių, per TLR4 selektyviai pažeisdamas β, o ne α ląsteles ankstyvose diabeto stadijose. Taigi TLR4 gali būti ankstyvasis β ląstelių sunaikinimo žymeklis, nors norint patvirtinti šią hipotezę būtina atlikti T1DM turinčių pacientų tyrimus. Būsimuose tyrimuose nagrinėsime TLR4 raišką ir signalizaciją sergant 2 tipo diabetu, kuris taip pat yra priešuždegiminė liga.

Metodai

Pelės

Visi bandymai su gyvūnais buvo atlikti vadovaujantis laboratorinių gyvūnų priežiūros ir naudojimo vadovu, patvirtintu Fudano universiteto Zhongshan ligoninės institucinės etikos valdybos. Sveikos, 4 savaičių (15–17 g) NOD / JSlac pelių patelės buvo įsigytos iš Šanchajaus laboratorinių gyvūnų centro, Kinijos mokslų akademijos. Visi gyvūnai buvo laikomi specialiame patogenų neturinčiame gyvūnų skyriuje Zhongshan ligoninėje, Fudano universitete, Šanchajuje. Kiekviena pelė buvo pasveriama ir per savaitę prieš gyvūno nužudymą buvo stebimas periferinis gliukozės kiekis kraujyje (A010120; Bayer, Vokietija). Diabetas buvo diagnozuotas, kai du iš eilės matuojant gliukozės kiekį kraujyje buvo nustatyta didesnė kaip 13, 0 mmol / L vertė (Yaacob ir kt., 2009).

Histologinė ir morfologinė analizė

Pelių kasa buvo išpjaustyta ir fiksuota per naktį 4% paraformaldehide, esant 4 ℃. Fiksuoti audiniai buvo apdoroti parafino įdėjimui ir buvo paruošti nuoseklūs 5 μm storio pjūviai ir nudažyti hematoksilinu ir eozinu (Beyotime biologijos institutas, Sudžou, Kinija), kad būtų galima įvertinti kasos salelių histologiją ir morfologiją eksperimentiniams gyvūnams. Salų histologija ir morfologija buvo įvertinta naudojant Carl-Zeiss mikroskopiją Axiovert 200 (Carl-Zeiss, Jena, Vokietija).

Imunofluorescencija ir konfokalinė analizė

NOD pelių kasos buvo įterptos į OCT junginį (Sakura Finetechnical Co., Ltd., Tokijas, Japonija). Iš eilės 10 μm ilgio kriostato sekcijos buvo supjaustytos ir džiovinamos kambario temperatūroje. Skyriai pirmą kartą buvo inkubuojami per naktį su pirminiu antikūnu esant 4 ℃. Jūrų kiaulytės antivirusinis antikūnas nuo pelės (Invitrogen, Carlsbad, CA), ožkos anti-pelės ir gliukagono antikūnas (Santa Cruz Biotechnology, Santa Cruz, CA), triušio anti-pele-HMGB1 antikūnas (Abcam, Cambridge, UK), pelė pirminiai antikūnai buvo monokloniniai T2.5 iki TLR2 (Abcam), triušių anti-pelių-TLR4 antikūnai (Abcam), pelių monokloniniai 26C593 iki TLR9 (Abcam) ir triušių anti-pelių-RAGE antikūnai (Millipore, Billerica, MA). Skyriai buvo tris kartus plaunami PBS ir 2 valandas inkubuojami kambario temperatūroje su Cy3 konjuguotu asilų anti-GP antriniu antikūnu (Millipore), Alexa Fluor 555 asiliuko anti-ožkos antriniu antikūnu (Invitrogen), Alexa Fluor 488 ožkos anti-triušio antriniu antikūnas (Invitrogen), ožkos „Alexa Fluor 555“ anti-triušio antrinis antikūnas („Invitrogen“) ir „Alexa Fluor 488“ asiliuko antivirusinis antikūnas („Invitrogen“). Branduoliniai regionai buvo nudažyti DAPI (Sigma-Aldrich) prieštaringu dažymu. Galiausiai sekcijos, pritvirtintos glicerolio / PBS (1: 1). Dažyti pjūviai buvo naudojami su izotipu suderintais antikūnais ir PBS. Mėginiai buvo vizualizuoti „Leica TCS SP5“ konokaliniu mikroskopu (Leica, Manheimas, Vokietija).

Salų ląstelių atskyrimas ir kultūra

Kasa buvo suplėšyta atliekant tulžies latako punkciją ir įpurškiant 1, 5–2 ml V tipo ledo šalto kolagenazės (Sigma-Aldrich, Sent Luisas, MO) atgal. Liaukos buvo pašalintos ir suleistos į subalansuoto D-Hanko druskos tirpalą, kuriame yra V tipo kolagenazė. Kasa buvo suardoma 37 ° C temperatūroje, nuolat purtant. Virškinimas tris kartus plaunamas RPMI 1640 (Gibco, Incorporated, Invitrogen, Carlsbad, CA), turinčiame 5% BSA, ir po to gryninamas Ficoll, kaip aprašyta (Sutton et al., 1986). Atskirtos salelės buvo papildomai išgrynintos rankomis paimant kapiliarines pipetės (BD, Franklin Lakes, NJ) ir buvo identifikuotos selektyviai dažant raudonai raudoną spalvą Dithizone (DTZ), kad būtų užtikrintas salų grynumas. Tada išsklaidytos salelės ląstelės buvo kultivuojamos standartinėje terpėje, RPMI 1640 (Gibco), papildytame 10% galvijų vaisiaus serumo (FBS) (Gibco), 20 mmol / l hidroksietilpiperazino etansulfoninės rūgšties (HEPES) (Sigma-Aldrich) ir 10 mmol / L niacinamido (Sigma-Aldrich) esant 37 ℃ 95% O 2 /5% CO 2 ir prisotintoje drėgmėje.

NHS-fluoresceino HMGB1 žymėjimas ir ląstelių imunofluorescencija

HMGB1 („eBioscience“, San Diegas, CA) baltymas buvo paženklintas NHS fluoresceinu (Pierce Biotechnology, Rockford, Il) pagal gamintojo instrukcijas. Salos ląstelės buvo išskirtos iš 4 savaičių necukrinio diabeto NOD pelių ir pasodintos į šešių šulinėlių plokšteles (Corning Inc., Corning, NY). Ląstelės buvo naudojamos 70% santakoje. Ląstelės buvo iš anksto inkubuotos su anti-TLR2, -TLR4, -TLR9 arba -RAGE antikūnais (25 µg / ml) 30 minučių 4 ° C temperatūroje Opti-MEM I terpėje (Invitrogen). Tada ląstelės buvo apdorotos 5 µg / ml NHS-fluoresceinu pažymėtu HMGB1 ir inkubuojamos dar 6 valandas 4 ℃ (Yu et al., 2006). Tada ląstelės tris kartus plaunamos PBS (pH 7, 2) ir 20 minučių fiksuojamos kambario temperatūroje 2% paraformaldehido-PBS. Po fiksavimo fluorescencija buvo užfiksuota Leica TCS SP2 vertikaliu konokaliniu mikroskopu (Leica, Manheimas, Vokietija).

Western blot analizė

Penkiasdešimt mikrogramų baltymų, išskirtų iš NOD pelių kasos, buvo elektroforezuotos 10% natrio dodecilsulfato poliakrilamido gelio elektroforezės geluose ir perkeltos į polivinilideno difluorido membranas (Millipore). Po blokavimo 5% neriebiu pienu, membranos buvo inkubuojamos su pirminiais antikūnais, atpažįstančiais HMGB1 (Abcam) ir TLR4 (Abcam) per naktį, esant 4 ℃. Tada juostelės 1 valandą kambario temperatūroje buvo inkubuojamos su krienų peroksidaze (HRP) konjuguotais ožkų anti-pelių ir ožkų anti-triušių antikūnais (Jackson ImmunoResearch Laboratories, West Grove, PA). Baltymai buvo vizualizuojami naudojant sustiprintus chemiliuminescencinius (ECL) Western blotting aptikimo reagentus (Pierce) ir kiekybiškai įvertinti naudojant „Bio-Rad Fluor-S Multi-Imager“ (Typhoon 9400, Amersham, Švedija).

qRT-PGR analizė

Bendroji RNR (1 µg iš visos kasos) buvo ekstrahuota ir išgryninta naudojant TRIzol (Invitrogen) pagal gamintojo instrukcijas. Po to, naudojant „PrimeScript® RT“ reagentų rinkinį (Takara Biotec, Kiotas, Japonija), vienodi RNR kiekiai buvo perrašyti į cDNR. Kiekybinis realaus laiko PGR buvo atliktas naudojant „Mastercycler® ep realplex“ realiojo laiko PGR sistemą (Eppendorfas, Hamburgas, Vokietija) su SYBR žaliųjų PGR pagrindiniu mišiniu (Takara Biotec). PGR panaudoti pradmenys buvo šie: HMGB1, pirmyn: GAGAGATGTGGAACAACACTGC, atvirkščiai: AGCTCTGTAGGCAGCAATATCC, 104 bp; TLR-4, į priekį: TTTCACCTCTGCCTTCACTACA, atvirkštinė: AGATACACCAACGGCTCTGAAT, 139 bp; β-aktinas, į priekį: GTCCCTCACCCTCCCAAAAG, atvirkštinis: GCTGCCTCAACACCTCAACCC, 266 bp. Važiavimo dviračiu sąlygos buvo tokios: pradinis įjungimas esant 95 ℃ 30 s; po 40 ciklų 5 s, esant 95 ℃, ir 30 s, esant 60 ℃. Tikslinės mRNR lygis ląstelėse buvo analizuojamas 2 -ΔΔCt metodu.

Statistinė analizė

Statistiškai reikšmingi skirtumai tarp grupių buvo įvertinti atitinkamai naudojant parametrinius arba neparametrinius testus. Vertės pateikiamos kaip vidurkiai ± vidurkio standartinė paklaida. Statistinė analizė atlikta naudojant SPSS 17.0 programinę įrangą. Vertės P <0, 05 buvo laikomos statistiškai reikšmingomis.

Žodynas

DTZ

ditizonas

ECL

sustiprinta chemiliuminescencija

HMGB1

didelio judrumo grupės 1 langelis

NHS

N-hidroksisukcinimidas

NOD

ne nutukęs diabetas

PAMP

su patogenais susiję molekuliniai modeliai

RAGE

pažangūs galutiniai glikacija

SLE

sisteminė raudonoji vilkligė

T1DM

1 tipo cukrinis diabetas

TLR

rinkliavą primenantis receptorius