Šlapimo egzosomų gautos mikroschemos, atspindinčios šunų inkstų funkcijos pokyčius ir histopatologiją | mokslinės ataskaitos

Šlapimo egzosomų gautos mikroschemos, atspindinčios šunų inkstų funkcijos pokyčius ir histopatologiją | mokslinės ataskaitos

Anonim

Dalykai

  • Biomarkeriai
  • Inkstas
  • miRNR
  • Molekulinė medicina
  • Patogenezė

Anotacija

MikroRNR veikia kaip po transkripcijos reguliatoriai, o šlapimo egzosomų (UExo) gaunamos mikroRNR gali būti naudojamos kaip biomarkeriai. Čia mes apžiūrėjome, ar nėra UExo gautų mikroRNR, atspindinčių šunų inkstų ligos (KD) būklę. Ištirti šunys buvo suskirstyti į sveiko inksto kontrolės (HC) ir KD grupes pagal inkstų funkcijos sutrikimą. Mes patvirtinome UExo, turinčio netaisyklingų gaublių pavidalą, šunį imunoblotu aptikdami egzosomų žymenis, TSG101 ir CD9. Remiantis mūsų ankstesniais duomenimis, naudojant KD modelio peles, ir čia gautais duomenimis iš sekančios kartos UExo išvestų mikroRNR šunims buvo parinkti miR-26a, miR-146a, miR-486, miR-21a ir miR-10a / b. kaip kandidatai mikroRNR. Visų pirma, iš UExo gautos miR-26a ir miR-10a / b reikšmingai sumažėjo KD šunims, o miR-26a lygis neigiamai koreliavo su pablogėjusia inkstų funkcija, palyginti su kitomis miRNR. Iš UExo išvestų miR-21a lygių, pataisytų ar nepataisytų pagal UExo, miR-26a ir miR-191 vidaus kontrolės mikroRNR, reikšmingai padidėjo dėl inkstų funkcijos sutrikimo. Inkstų audiniuose miR-26a ir miR-10a / b sumažėjimas glomeruloje ir miR-10b tubulointerstitiume neigiamai koreliavo su pablogėjusia inkstų funkcija ir histopatologija. Padidėjęs miR-21a padidėjęs tubulointerstitium, o ne glomeruluose, susijęs su pablogėjusia inkstų histopatologija. Taigi, šiame tyrime buvo nustatyti mikroRNR, atspindintys šunų inkstų funkcijos ir histopatologijos pokyčius.

Įvadas

Klinikinėje veterinarijoje kaip inkstų funkcijos žymenys visuotinai naudojami azoto (BUN) ir kreatinino (Cr) kraujo serume. Šunims ir katėms Cr lygis serume skiriamas lėtiniu inkstų liga (LKS) sergantiems pacientams, klasifikuojantiems į keletą klinikinių stadijų, kurias Tarptautinė inkstų interesų draugija pasiūlė tinkamai terapinei strategijai (//www.iris-kidney.com/guidelines/staging). html). Ankstesni atradimai rodo, kad CKD patogenezė skirtinguose gyvūnuose būna skirtinga, o glomerulus (Glo) ir tubulointerstitium (TI) paprastai galima sužeisti šunims ir katėms 1 . Serumo Cr padidėjimas rodo inkstų funkcijos sutrikimą. Tačiau iš serologinės analizės rezultatų sunku įvertinti konkrečias sužeistas inkstų dalis. Šlapimo baltymai ir Cr yra atitinkamai naudingi glomerulų funkcijos ir koncentracijos gebėjimo žymenys. Neseniai susitelkėme ties potencialios mikroRNR (miRNR), kaip naujos ligos žymeklio, taip pat terapinio taikinio gyvūnų inkstų ligoms (KD), 2, 3, 4, nustatymu .

miRNR yra stabilios mažos nekoduojančios RNR (20–25 bp), turinčios aukštą evoliucijos sekos išsaugojimą ir veikiančios kaip tikslinių genų posttranskripcijos reguliatoriai, jungdamiesi prie komplementarių sekų specifinėse tikslinėse mRNR. Artimas ryšys tarp kelių ligų progresavimo ir miRNR yra gerai ištirtas tiek eksperimentiniams graužikams, tiek žmonėms. Inkstuose miR-21 dalyvauja inkstų fibrozėje, nukreipdamas į transformuojančio augimo faktoriaus beta (TGF-β) / Smad signalą 6 . Mes taip pat parodėme, kad pakitusi miR-26a ir miR-146a išraiška koreliavo su glomerulų podocitų sužalojimo ir tubulointersticinio uždegimo progresavimu pelėse, sergančiose CKD, atitinkamai 2, 3 . Nors veterinarinėje medicinoje miRNR raiškos profilis gyvūnams nežinomas, mes neseniai nustatėme miRNR, išreikštus šunų ir kačių inkstų žievėje ir meduloje, naudodamiesi naujos kartos seka (NGS) 4 .

miRNR taip pat randama kūno skysčiuose, tokiuose kaip serumas, plazma, seilės, pienas ir šlapimas 7 . Šlapimo miRNR yra stabili, nes yra 40–100 nm nanodalelių pūslelėse, vadinamose „egzosomomis“ 8 . Egzosoma yra tarpląstelinių pūslelių, tokių kaip mikrovelelės, apoptoziniai kūnai ar ektosomos, rūšis 9 . Egzosomos gaunamos iš endosominių membranų susiformavimo, todėl susidaro daugiabriauniai kūnai (MVB) ir susidaro susiliejus MVB su plazmos membrana. Todėl egzosominių membranų molekulės, tokios kaip CD9, CD63 ir CD81, ir baltymai, dalyvaujantys egzosominėje biogenezėje, pavyzdžiui, užprogramuotas ląstelių mirties 6 sąveikaujantis baltymas (dar žinomas kaip ALIX) arba naviko jautrumas 101 (TSG101), naudojami kaip reprezentatyvūs egzosomų žymenys 10 .

Šlapimo egzosomų (UExo) gautos miRNR gali būti nauji KD diagnostiniai žymenys. Solé ir kt . pranešė, kad miR-29c lygis UExos koreliavo su lėtiniu nefritu sergančių žmonių lėtiniu ir glomerulinės sklerozės laipsniu 11 . Be to, miR-1915 ir miR-663 lygis UExo buvo sumažintas pacientams, sergantiems židinine segmentine glomeruloskleroze, palyginti su sveikomis kontrolinėmis grupėmis, tuo tarpu miR-155 buvo sureguliuotas tiems pacientams 12 . Mes taip pat pranešėme apie pakitusį miR-26a ir miR-146a kiekį šlapime, kuriame yra CKD pelių 2, 3 . Taigi iš UExo gaunamų miRNR pokyčiai reikšmingai koreliuoja su KD progresu. Tačiau gyvūnų, kurie yra kompanionai, įrodymų nėra.

Šiame tyrime, naudodamiesi šunų UExo ir NGS, mes nustatėme naujus miRNR kandidatus, atspindinčius inkstų funkcijos pokyčius ar inkstų histopatologiją, ir palyginome jų klinikopatologinę reikšmę su KD susijusiomis miRNR, jau nustatytomis ankstesniuose mūsų tyrimuose.

Rezultatai

UExo ir UExo gautų RNR išvaizda sveikiems šunims

1a paveiksle apibendrinti UExos ir iš UExo išvestų RNR analizės protokolai. 1b ir c pav. Buvo tiriami UExos, surinkti naudojant reagentą 1- arba 2 pagrindu iš šviežio šuns šlapimo, parodantį normalią inkstų funkciją. Imunologiniam tyrimui buvo aptiktos juostos, atitinkančios egzosomų žymenis, TSG101 ir CD9 (1b pav.), Tačiau akivaizdi pastarojo juosta buvo aptikta, kai UExos buvo surinkti iš 5 ml šlapimo. Be to, TSG101 gauta juosta buvo aptikta tiek 1, tiek 2 reagento UExo atskyrimo protokoluose. Skanavimo elektronų mikroskopija (SEM) parodė, kad šuo UExos turėjo netaisyklingos formos žemės rutulio formą, kurios skersmuo buvo maždaug 50–200 nm, o kai kurie iš jų pateikė duobę ar procesą (1c pav.).

Image

a ) Protokolių, naudojamų šlapimo egzosomų ir iš egzosomų gaunamoms RNR analizuoti, schema. b ) Šlapimo egzosomų žymenų TSG101 ir CD9 aptikimas šlapimo egzosomų turinčiose frakcijose. Šiame eksperimente buvo naudojamas 1 arba 2 reagentas. „ML“ juostos viršuje rodo sunaudoto šlapimo tūrį. Rodyklių galvutės nurodo numatomas TSG101 arba CD9 juostas. Buvo naudojami švieži šlapimo mėginiai. c ) Šuns šlapimo egzosomos ultravioletinė struktūra. Suspensijos buferis arba pakartotinai suspenduota egzosomomis turtinga frakcija buvo sumontuota ant varine tinkleliu uždengtos membranos ir stebėta skenavimo elektronų mikroskopu. Šunų egzosomos buvo netaisyklingos apvalios formos ir maždaug 50–200 nm skersmens. Kai kurie iš jų pateikė duobę (rodyklės galvutė) arba procesą (rodyklė). Buvo naudojami švieži šlapimo mėginiai. d ) RNR kiekis, gautas iš šunų, turinčių daug šlapimo, turinčių egzozomų, frakciją, naudojant 3 skirtingus metodus. e ) RNR (gautos RNR / sunaudoto šlapimo tūrio), gauto iš šlapimo egzosomų turinčios frakcijos, atkūrimo efektyvumas šunims naudojant 3 skirtingus metodus. f ) miRNR lygis RNR, gautas iš šlapimo egzosomų turinčios frakcijos 3 skirtingais būdais šunims. „miR-26a“ buvo analizuojamas kaip reprezentatyvi miRNR, gausiai ekspresuojama gyvūno inkstuose. TaqMan PGR metodas. Df grafikai šiame eksperimente buvo naudojami keturi sujungti sušaldyto šlapimo mėginiai, gauti iš daugiau kaip 10 šunų iš kiekvieno mėginio. Reikšmės = vidurkis ± SE. * Reikšmingas skirtumas tarp 1 ir 5 ml grupių, analizuotas Mann-Whitney U testu ( P <0, 05). †, †† Reikšmingas skirtumas tarp kitų metodų toje pačioje šlapimo tūrio grupėje, analizuotoje Scheffé metodu (atitinkamai P <0, 05, P <0, 01), atlikus Kruskal-Wallis testą.

Visas dydis

Toliau mes ištyrėme UExo išvaizdą ir išmatuojome UExo gautų RNR kiekį šunų užšaldytuose šlapimo mėginiuose pagal 3 skirtingus protokolus. 1d – f pav. Buvo išanalizuoti 4 jungtiniai mėginiai, paimti iš daugiau nei 10 šunų, kurių inkstų funkcija normali. Didžiausias bendras UExo gautų RNR kiekis buvo gautas naudojant kolonėlės metodą, palyginti su kitais metodais, naudojant ir 1, ir 5 ml šlapimo (1d pav.). Kalbant apie UExo gautų bendrųjų RNR atsigavimo efektyvumą (1e pav.), UExo gautos bendrosios RNR turėjo tendenciją mažėti, atsižvelgiant į šlapimo tūrį visuose tirtuose protokoluose, o reikšmingi skirtumai tarp grupių, naudojant 1 ir 5 ml, buvo nustatyti 1 reagento ir kolonėlės metodas. Be to, didžiausias UExo gautų RNR kiekis buvo gautas naudojant kolonėlės metodą, palyginti su kitais abiejų grupių metodais, naudojant 1 ir 5 ml šlapimo. 1f paveiksle pavaizduoti miR-26a lygiai, apie kuriuos pranešta, kaip gauta UExo gautų RNR gausiai išreikšta miRNR pelių, šunų ir kačių inkstuose 3, 4 . „MiR-26a“ lygis turėjo tendenciją didėti, atsižvelgiant į šlapimo tūrį, naudojamą visuose tirtuose protokoluose, ir reikšmingi skirtumai tarp grupių, naudojant 1 ir 5 ml, buvo nustatyti 1 reagento ir kolonėlės metodu. Taigi, mūsų duomenys parodė, kad UExo yra aptinkami šunims, ir parodė, kad iš UExo gautų bendrų RNR kiekis nebūtinai yra panašus į miRNR.

Iš UExo gautos miRNR sveikų inkstų kontrolės (HC) ir KD šunims

Remiantis serumo Cr ir BUN, šlapimo spalva ir klinikinio veterinarijos gydytojo diagnoze, gauti šlapimo mėginiai buvo suskirstyti į 2 grupes; HC (n = 37, mediana = 10 metų) ir KD (n = 47, mediana = 12 metų). Tiriamų šunų klinikinė informacija, įskaitant lytį, amžių ir rūšis, yra apibendrinta 1 papildomoje lentelėje ir papildomame 1 pav. 2a pav. Parodyta HC ir KD šunų inkstų funkcija. KD šunims buvo reikšmingai aukštesnės BUN ir Cr serumo vertės ir mažesnės CR šlapimo vertės, palyginti su HC šunimis. NGS buvo atliktas naudojant šiuos pavyzdžius (2b pav.). Dėl suderinimo gautų UExo gautų miRNR procentas buvo atitinkamai 0, 12% ir 0, 42% iš UExo gautų bendrų RNR HC ir KD šunims. Būdinga tai, kad dauguma skaitomų sekų buvo gautos iš perdavimo RNR. Dėl to buvo anotuota 2 035 miRNR.

Image

a ) Šunų, suskirstytų į sveiko inksto kontrolę (HC, n = 37) ir inkstų ligos (KD, n = 47), klinikiniai parametrai. BUN: šlapalo azoto kiekis kraujyje. Cr: kreatininas. Brūkšniai brūkšniuose ir reikšmės lentelėse rodo kiekvienos grupės mediana. ** Reikšmingas skirtumas tarp HC ir KD, analizuotas Mann-Whitney U testu ( P <0, 01). ( b ) Kiekvienos RNR, gautos iš šlapimo egzosomų pagamintos RNR, procentas šunims, naudojant sekančios kartos seką. Ištirti sveikų inkstų kontrolės (HC, n = 37) ir inkstų ligos (KD, n = 47) mėginiai. tRNR: perduoda RNR.

Visas dydis

1 lentelėje apibendrinti UExo gautų miRNR lygių rezultatai HC ir KD šunims. Kandidatams patikslinti buvo atrinktos miRNR, turinčios daugiau nei 100 skaitomų skaičių abiejose grupėse, ir KD šunų, palyginti su HC šunimis, 2 kartų skirtumas (didesnis ar mažesnis). „miR-3107“, „miR-486a“, „miR-21a“, „miR-10a“ ir „miR-10b“ atitiko šiuos reikalavimus. „miR-3107-5p“ neseniai buvo atnaujintas kaip „miR-486b-5p“, pateikiant tą pačią brandžią seką kaip „uccuguacugagcugccccgag“, kaip ir „miR-486a-5p“, remiantis pelių duomenų baze (miRBase, //www.mirbase.org/). Todėl miR-3107 ir miR-486a iš esmės yra tos pačios subrendusios miRNR. Be to, norint nustatyti vidinę kontrolinę miRNR šunų UExo, buvo pasirinktos miRNR, turinčios daugiau nei 300 skaitymo skaičių abiejose grupėse ir mažesnį nei 2 kartus didesnis (didesnis ar mažesnis) KD grupėje, palyginti su HC grupe. Tarp pasirinktų miRNR, vėlesniame tyrime mes panaudojome miR-191 kaip vidinę kontrolę, nes jis parodė mažiausią raukšlės pokytį tarp HC ir KD grupių ir buvo gausiai išreikštas pelių, šunų ir kačių inkstuose 3, 4 .

Pilno dydžio lentelė

Pasirinktų iš UExo gautų miRNR lygiai HC ir KD šunims

Tada atrinktų miRNR kiekiai UExo buvo kiekybiškai įvertinti pagal 1 lentelėje pateiktus rezultatus. MiR-26a ir miR-146a lygiai, kurie buvo skirtingai išreikšti CKD pelių inkstuose, palyginti su sveikų kontrolinių pelių inkstais, ankstesniais tyrimais, taip pat buvo kiekybiškai įvertinti 2, 3 . Neapdoroti miR-26a, miR-10a, miR-10b ir miR-191 lygiai buvo žymiai mažesni KD šunų UExo, palyginti su HC šunų UExo (3a pav.). Priešingai, miR-146a ir miR-21a lygis buvo didesnis KD šunų UExo, palyginti su HC šunų UExo. Reikšmingas skirtumas tarp grupių buvo aptiktas tik miR-21a lygiu. Be to, mes pakoregavome jų lygį pagal neapdorotus miR-26a ir miR-191 lygius (3b ir c pav.), Kurie buvo parinkti kaip vidinė šunų UExo kontrolė, atsižvelgiant į jų gausų išraišką šunų inkstuose 3, 4 . Rezultatai pateikti 1 lentelėje. Kai išraiškos lygiai buvo pataisyti pagal miR-26a, miR-146a ir miR-21a lygis KD šunų UExo buvo žymiai didesnis nei HC šunų UExo (3b pav. ). Kai išraiškos lygiai buvo pataisyti pagal miR-191, miR-146a, miR-21a, miR-10a ir miR-10b lygiai buvo didesni KD šunų UExo nei HC šunų UExo. Tarp grupių buvo nustatytas reikšmingas miR-21a lygio skirtumas (3c pav.). Be to, mes ištyrėme neapdorotus miRNR lygius ir pataisytus lygius kiekvienoje lyties grupėje, įskaitant vyrus, kastruotus vyrus, moteris ir šerpetojusias moteris. Nebuvo jokio reikšmingo su lytimi susijusio skirtumo ( P > 0, 05) jokiame miRNR, kaip nustatyta Kruskal – Wallis testas.

Image

a ) Neapdorotas miRNR kiekis šunų šlapime iš egzosomų pagamintos miRNR. ( b ) miRNR lygis pataisytas pagal miR-26a lygį šunų šlapimo egzosomų iš miRNR. ( c ) miRNR lygiai, pataisyti pagal miR-191 lygį šunų šlapimo egzosomų iš miRNR. Šunys buvo suskirstyti į sveiko inksto kontrolės (HC, n = 37) ir inkstų ligos (KD, n = 47) grupes. *, ** Reikšmingas skirtumas tarp HC ir KD grupių, analizuotas Mann-Whitney U testu (atitinkamai P <0, 05, P <0, 01). TaqMan PGR metodas. Juostos grafikuose ir reikšmės lentelėse rodo kiekvienos grupės mediana.

Visas dydis

Iš UExo gautų miRNR lygių ir inkstų funkcijos koreliacija HC ir KD šunims

Aptikta reikšminga teigiama koreliacija tarp amžiaus ir miR-146a (2 lentelė). BUN serumas reikšmingai ir neigiamai koreliavo su miR-26a ir miR-10b. Serumo Cr reikšmingai ir neigiamai koreliavo su miR-26a, miR-10a, miR-10b ir miR-191 ir teigiamai koreliavo su miR-21a. Šlapimo Cr reikšmingai ir teigiamai koreliavo su miR-26a, miR-486, miR-10a, miR-10b ir miR-191. Kai miRNR raiškos lygiai buvo pataisyti su miR-26a lygiu, amžius buvo teigiamai koreliuojamas su miR-146a, o BUN ir Cr serumas buvo teigiamai koreliuojamas su miR-146a ir miR-21a, o šlapimo Cr šlapimas buvo neigiamai koreliuojamas su šiomis miRNR. Kai išraiškos lygiai buvo pataisyti pagal miR-191, miR-21a buvo teigiamai koreliuojami su amžiumi, serumo BUN ir Cr, tuo tarpu jis buvo neigiamai koreliuojamas su šlapimo Cr.

Pilno dydžio lentelė

Inkstų miRNR raiška inkstuose HC ir KD

4a paveiksle pateikiami šunų, kurių histopatologiškai suskirstyti į HC (n = 6, vidutinis = 11 metų) ir KD (n = 7, mediana = 10, 5 metų), inkstų funkcijos ir inkstų pažeidimo balai. Tiriamų šunų klinikinė informacija yra apibendrinta 2 lentelėje. Šunims, sergantiems KD, nustatyta žymiai aukštesnės BUN ir Cr serumo vertės bei Glo, TI ir KD serumo pažeidimo balai. Tipiški HC ir KD šunų inkstų histopatologiniai ypatumai parodyti 4b pav. KD šunims inkstai parodė aiškius Glo ir TI pažeidimus. 4c paveiksle parodyta vietinė miRNR ekspresija inkstuose, analizuota lazeriu, mikrodisdiskcija (LMD). Visų tirtų miRNR raiška buvo mažesnė KD, palyginti su HC surinktu Glo. Tarp grupių buvo nustatyti reikšmingi skirtumai tarp miR-26a, miR-10a ir miR-10b. Surinktų TI atveju miR-21a išraiška KD buvo didesnė nei HC mėginiuose. Kitų miRNR raiška buvo mažesnė. Tarp grupių buvo nustatytas reikšmingas miR-10b lygio skirtumas. Mes taip pat apskaičiavome miRNR raiškos santykį Glo, palyginti su TI (4d pav.). HC grupės miR-26a, miR-146a ir miR-486 Glo ir TI santykis buvo didesnis nei 1, 5, tai reiškia, kad jie buvo gausiai išreikšti Glo, o ne TI, tačiau miR-21a ir miR-10b rodė 0, 99 ir 1, 18 santykis, atitinkamai, tai reiškia, kad jie buvo santykinai išreikšti tiek Glo, tiek TI. Visi parametrai KD šunims buvo mažesni, palyginti su HC šunimis. Tarp grupių stebimi reikšmingi miR-21a ir miR-10a lygių skirtumai. Be to, miR-21a, miR-10a ir miR-10b lygiai buvo mažesni nei 1, 0 šunims, sergantiems KD, tai reiškia, kad jie turėjo daugiau reikšmės TI, o ne Glo šunims su KD.

Image

a ) Tiriamų šunų klinikiniai ir histopatologiniai parametrai. Šunys buvo suskirstyti į sveiko inkstų kontrolės (HC) ir inkstų ligos (KD) grupes. *, ** Reikšmingas skirtumas tarp HC ir KD grupių, analizuotas Mann-Whitney U testu (atitinkamai P <0, 05, P <0, 01). Brūkšniai brūkšniuose ir reikšmės lentelėse rodo kiekvienos grupės mediana. b ) Reprezentatyvūs analizuotų šunų histopatologiniai požymiai. KD šunims pažeidimai pastebimi glomeruluose (Glo, strėlės) ir tubulointerstitium (TI, arrowhead). Parodyti histopatologiniai Glo ir TI balai, taip pat kraujo karbamido azoto (BUN) ir kreatinino (Cr) koncentracijos serume. Skyriai buvo dažomi periodine rūgštimi Schiff. Glo ir TI turintys plotai buvo išskirti lazeriniu mikrotarpu (LMD) po dažymo toluidino mėlyna spalva. ( c ) miRNR raiška GloD ir TI, surinkti LMD, buvo analizuojami TaqMan PGR metodu. Vertės išreiškiamos KD padidėjimu, palyginti su HC. (d) Glo ir TI miRNR ekspresijos santykiai. HC: n = 6. KD: n = 7. *, ** Reikšmingas skirtumas tarp HC ir KD, analizuotas Mann-Whitney U testu (atitinkamai P <0, 05, P <0, 01). Duomenys rodo vidutinę kiekvieno stulpelio vertę. Brėžinių brūkšniai ir lentelių reikšmės rodo kiekvienos grupės mediana.

Visas dydis

Koreliacija tarp miRNR lygio inkstuose ir inkstų funkcijos HC ir KD šunims

Dėl miRNR lygio inkstų audiniuose, surinktų LMD (3 lentelė), amžius nesusijęs su tirtais miRNR lygiais. Serumo BUN ir Cr bei Glo pažeidimo balai buvo neigiamai koreliuojami su miR-26a, miR-10a ir miR-10b Glo lygiais. Serumo Cr taip pat neigiamai koreliuoja su miR-146a lygiais. Tiek TI pažeidimo balas, tiek KD balas buvo neigiamai koreliuojami su miR-486, miR-10a ir miR-10b Glo lygiais. Be to, serumo BUN ir Cr, taip pat Glo ir TI pažeidimo balai ir KD balai buvo neigiamai koreliuojami su miR-10b TI lygiais. Glo pažeidimai ir KD balai taip pat buvo neigiamai koreliuojami su miR-21a lygiais.

Pilno dydžio lentelė

Kalbant apie Glo ir TI santykį (4 lentelė), miR-26a, miR-146a ir miR-10a buvo neigiamai koreliuojami su Glo pažeidimais ir KD balais, o miR-146a ir miR-10a neigiamai koreliavo su TI pažeidimo balais ir serumu. Cr, atitinkamai. „miR-10b“ buvo neigiamai koreliuojamas su amžiumi.

Pilno dydžio lentelė

Diskusija

Mes ištyrėme iš UExo gautų miRNR lygius, atrinktus iš NGS, ir ankstesnėse ataskaitose 2, 3 . Neapdoroti UExo gautų miRNR lygiai (3a pav.) Gali parodyti 2 galimybes; 1) kiekybiniai bendro UExo kiekio pokyčiai arba 2) kiekybiniai miRNR pokyčiai UExo. Kadangi sunku tiksliai išmatuoti UExo kiekį šunims, nes trūksta tinkamų matavimo metodų, manėme, kad kaip alternatyva reikėjo vidinės kontrolės iš UExo išvestų miRNR. Todėl kaip vidinę kontrolę naudojome miR-26a ir miR-191, nes žinoma, kad jie gausiai išsiskiria pelių, šunų ir kačių inkstuose 3, 4 . Be to, miR-191 neparodė drastiškų kiekybinių pokyčių HCS ir KD šunų šlapime NGS (1 lentelė). miR-26a ir miR-191 reikšmingai sumažėjo KD šunų UExo, palyginti su HC šunimis, ir tai rodo, kad bendras UExo kiekis KD linkęs mažėti, palyginti su HC. Todėl sumažėjęs jo lygis taip pat būtų susijęs su bendro UExo kiekio sumažėjimu KD šunims. Be to, neapdoroti miR-26a ir miR-191 lygiai UExo koreliavo su inkstų funkcijos rodiklių pokyčiais, tokiais kaip BUN serumas, serumo Cr ar šlapimo Cr. Todėl sumažėjęs UExo kiekis KD gali rodyti inkstų funkcijos pakitimą šuns inkstuose.

miR-10b taip pat reikšmingai sumažėjo KD šunims, palyginti su HC šunimis, ir jų lygis buvo glaudžiai susijęs su inkstų funkcija, palyginti su kitomis miRNR. Nors miR-10b ir miR-10a lygio skirtumai nesiskyrė tarp TaqMan PGR ir NGS, mes išanalizavome šias miRNR, nes jų skaitymo skaičius buvo didelis (1 lentelė) ir jie yra labai išreikšti žmogaus šlapime 13, taip pat šunų ir kačių inkstai 4 . Šiam metodiniam skirtumui gali turėti įtakos skirtumai tarp atskirų mėginių TaqMan PGR ir sujungtų mėginių NGS. Kita vertus, iš UExo gautos miR-21a išraiška reikšmingai padidėjo KD šunims, palyginti su HC šunims. Šis padidėjimas vis dar buvo pastebėtas pakoregavus išraiškos lygius vidaus kontrolės kandidatų, tokių kaip miR-26a ar miR-191, lygius ir glaudžiai susijęs su inkstų funkcijos rodiklių pokyčiais. Taigi miR-21a kiekis UExo, o ne neapdorotas miR-21a kiekis šlapime, KD metu padidėjo ir koreliavo su šunų inkstų funkcijos pokyčiais.

Apskritai, visų tirtų miRNR raiška turėjo mažesnę reikšmę KD šunų glo, palyginti su HC šunų, bet šie pokyčiai buvo švelnesni TI nei Glo, KD šunims (4c pav.). Anksčiau pranešėme, kad KKL glo pažeidimai, tokie kaip podocitų sužalojimai, labiau koreliavo su šunų inkstų funkcijos sutrikimu nei katėmis 1 . Be to, maždaug 52% sergančių šunų inkstų biopsijos mėginių buvo gauta Glo traumų 14 . Kita vertus, katės KD 15, 16 dažniausiai buvo stebimi TI pažeidimai, įskaitant ląstelių infiltraciją, fibrozę, policistinius pažeidimus ir nekrozę. Todėl sumažėjusi tirtų miRNR raiška Glo gali būti susijusi su šunų inkstų patologinėmis savybėmis, tokiomis kaip Glo dominuojanti šios rūšies patogenezė.

Sumažėję KD glo miRNR, tokių kaip miR-26a, miR-10a ir miR-10b, reikšmingas ir stiprus ryšys su šunų inkstų disfunkcija ir Glo sužalojimais. Šios miRNR taip pat parodė sumažėjusį UExo lygį ir reikšmingą koreliaciją su keliais inkstų funkcijos sutrikimo parametrais (2 lentelė). Šios 3 miRNR yra gausiai ekspresuojamos pelės Glo. Remiantis mūsų pelių tyrimu 3, atrodė, kad podocitai išreiškia miR-26a. Kaip parodytas Glo / TI santykis (4d pav.), MiR-26a ir miR-10a taip pat, atrodo, buvo išreikšti šunų Glo, palyginti su TI. Nors apie miR-10a „Glo“ ląstelėse nėra pranešimų, CKD pelės modelyje 3 buvo pranešta apie miR-26a ir miR-10a sumažėjusį reguliavimą Glo. Sumažėjęs miR-26a kiekis inkstuose taip pat įrodytas sergantiems žmonių ir pelių diabetine nefropatija 17 . Žmonėms miR-26a lygis sumažėjo inkstuose ir šlapime pacientams, sergantiems vilkligės nefritu 18 . „miR-26a“ nutildymas paveikė citoskeletą ir išaugintų pelių podocitų diferenciaciją per pakitusią aktino šeimos ir vimentino 3 išraišką. Be to, miR-26a sumažėjęs reguliavimas yra susijęs su diabetinės nefropatijos progresavimu tiek žmonėms, tiek pelėms per sustiprintą TGF-β / jungiamojo audinio augimo faktorių, signalizuojantį 17 . Podocitai ir mesangialinės ląstelės gali gaminti 2, 19, 20 egzosomas . Taigi sumažėjusi miRNR raiška Glo, bent jau miR-26a atveju, būtų esminis patologinis reiškinys šunų KD ir koreliuotų su sumažėjusiu UExo dėl pakitusios egzosomų gamybos ar ląstelių skaičiaus augimo Glo.

miR-10b sumažėjo tiek KD šunų Glo, tiek TI ir šis pokytis reikšmingai koreliavo su inkstų funkcijos sutrikimais. miR-10b yra ekspresuojamas pelių, šunų ir kačių inkstuose 3, 4 . MiR-10b vaidmuo KD nežinomas, tačiau ankstesnėje ataskaitoje teigiama, kad cAMP reaguojančių elementų, jungiančių 1 baltymą, praradimas, praradus miR-10b, yra svarbus vaidmuo inkstų ląstelių karcinomos 21 navikogenezėje. Be to, miR-10b yra smarkiai sumažintas atmestų allograftų reguliavimas, o miR-10b slopinimas žmogaus endotelio ląstelėse pakartoja apoptozę, priešuždegiminių citokinų / chemokino išsiskyrimą ir makrofagų chemotaksį 22 . Remiantis miR-10b Glo / TI santykiu (0, 8 KD, palyginti su 1, 2 HC), miR-10b buvo išreikštas tiek Glo, tiek TI, tačiau senstant šis santykis sumažėjo. Be to, miR-10b lygis sumažėjo UExo KD šunims. Todėl sumažėjęs miR-10b kiekis inkstuose ir UExo gali atspindėti nenormalias ląstelių, sudarančių šuns inkstus, savybes ir (arba) uždegiminę būklę. Senėjimas taip pat veikia šiuos procesus.

MiR-486 lygis Glo ir Glo / TI santykis miR-146a taip pat reikšmingai koreliavo su inkstų histopatologiniais balais, nors reikšmingų pokyčių nei Glo, nei TI tarp HC ir KD šunų nebuvo nustatyta. Šių miRNR, nors iš UExo gauto miR-146a / miR-26a santykis koreliavo su inkstų funkcijos parametrais (2 lentelė), nebuvo pastebėta nuolatinė tendencija tarp miR146a ir miR-486 išraiškos UExo ir inkstų funkcinių parametrų. Atrodė, kad amžius daro įtaką miR-146a lygiui „UExo“. Naujausi tyrimai pranešė, kad miR-486 šlapimo nuosėdose, gautose iš šlapimo eritrocitų, o ne iš inkstų parenchiminių ląstelių, žymiai padidėjo žmonėms, sergantiems IgA nefropatija 23, ir kad miR-146a išraiška inkstuose buvo specifiškai susijusi su uždegiminių ląstelių infiltracija CKD pelėms 2. . Šuns inkstuose kitos miRNR, o ne miR-486 ir miR-146a, labiau koreliavo su inkstų patogeneze ar inkstų funkcijų pokyčiais.

MiR-21a ekspresija inkstuose yra palyginti maža pelių, šunų ir kačių 3, 4 . Šiame tyrime miR-21a ekspresija TI KD linkusi didėti, o Glo / TI santykis KD sumažėjo, palyginti su HC šunimis (0, 20 KD, palyginti su 0, 99 HC), kas rodo, kad genų ekspresija ir (arba) ląstelės, ekspresuojančios miR-21a TI, turėjo tendenciją didėti KD, tačiau reikšmingos koreliacijos tarp inkstų miR-21a ekspresijos ir visų tirtų inkstų funkcinių parametrų nepastebėta. Daugybė tyrimų parodė, kad miR-21a yra sureguliuojamas keliuose gyvūnų modeliuose ir žmonėms, kenčiantiems nuo KD, ir yra laikomas pagrindiniu inkstų fibrozės tarpininku 24, 25 . „miR-21a“ slopina genų, dalyvaujančių mitochondrijų ir peroksisomų funkcijose, generavimą ir reaktyviųjų deguonies rūšių generavimą inkstų kanalėlių ląstelėse ir pristato mitochondrijų slopinamąją funkciją, sustiprindamas matricos nusėdimą ir branduolinio faktoriaus kappa B signalizaciją fibroblastuose 26 . Šiame tyrime miR-21a išraiška TI reikšmingai koreliavo su Glo pažeidimo balais, o ne TI pažeidimo balais, ir šis rezultatas gali atspindėti, kad šunų inkstų patologija turėjo tendenciją parodyti Glo pažeidimus, ką parodo reikšmingas miR-26a sumažėjimas Glo KD šunų. Priešingu atveju laiko skirtumas tarp miR-21a ekspresijos ir histopatologinio TI pažeidimo pasireiškimo gali paaiškinti prieštaravimus tarp miR-21a ekspresijos TI, Glo pažeidimo ir TI žalos. Įdomu tai, kad miR-21a buvo sureguliuotas šuniui UExo (3 pav.). Todėl miR-21a būtų inkstų audinių traumų rodiklis, nepriklausomai nuo inkstų funkcijos sutrikimo šunų inkstuose.

Mes išgavome UExo turinčią frakciją ir vėliau gavome bendrą RNR, įskaitant miRNR (1 pav.). UExo gautos bendros RNR atsistatymo efektyvumas sumažėjo padidėjus šlapimo kiekiui, naudojamam visais tirtais metodais, tai reiškia, kad nežinomi slopinantys veiksniai turi įtakos iš UExo gaunamų RNR ekstrahavimo procesams. Tačiau miRNR lygis (šiame tyrime buvo tiriamas „miR-26a“) nekoreliavo su visos „UExo“ RNR lygiu. Kaip parodė imunoblotai, atrodė, kad egzosominio žymeklio TSG101 juostos intensyvumas didėja vartojant šlapimo tūrį. Todėl iš UExo gautų miRNR atsistatymo efektyvumas padidėtų atsižvelgiant į naudojamą šlapimo tūrį, o kitos koduojančios ar nekoduojančios RNR, tokios kaip ribosominės, pernešančiosios, branduolinės, ir jų suskaidytos RNR, gautos iš šlapimo supernatanto arba tarpląstelinių pūslelių, išskyrus tokias egzosomas kadangi mikrovelelės, apoptoziniai kūnai ar ektosomos gali trukdyti iš UExo gautos RNR išgauti. Iš tikrųjų mūsų NGS, naudojant kolonų metodu išgautas iš UExo gautas bendras RNR, dauguma skaitytų sekų, iš dalies gautų iš perkeliamųjų RNR (2b pav.). Ankstesnė ataskaita taip pat parodė, kad skirtingi RNR ekstrahavimo metodai turėjo įtakos NGS rezultatams iš žmogaus UExo gautų miRNR 13 . Šiame tyrime, kadangi gautos UExo išvestų miRNR sekos svyravo nuo 0, 12 iki 0, 42% šunų UExo išvestose RNR, tolesnė modifikuota metodika, skirta konkrečiai sukoncentruoti miRNR išvestas sekas, leistų atlikti tikslesnę UExo išvestų miRNR analizę. Be to, gerų antikūnų, skirtų aptikti šunų egzosomų žymenis, nėra daug, nors yra lengvai prieinami geri antikūnai žmogaus ir pelių egzosomų žymenims nustatyti. Ateityje atliekant tyrimus reikia nustatyti tinkamus baltymų žymenis šunų egzosomoms ir sukurti atitinkamus antikūnus. Be to, visi šlapimo mėginiai buvo paimti iš gyvūnų ligoninių ir juose dalyvavo skirtingų veislių šunys iš abiejų grupių šiame tyrime, o tai gali turėti įtakos gautiems rezultatams. Todėl vertinimas naudojant fiksuotą pastovųjį metodą, pagrįstą tinkamu UExo išvestų miRNR ekstrahavimo metodu, naudojant UFX ir kiekvienos šunų veislės didelio afiniteto antikūnus, būtų svarbus UExo išvestų miRNR tiek klinikiniams žmonėms, tiek veterinarijoje. vaistas.

Apibendrinant, mes nustatėme keletą miRNR kandidatų, susijusių su pakitusiomis inkstų funkcijomis ir inkstų audinių sužalojimais, iš UExos miRNR ekspresijos duomenų ir šunų inkstų mėginių. Visų pirma, remiantis mūsų dabartiniais duomenimis ir keliais ankstesniais tyrimais, miR-26a ir miR-21a būtų stiprūs kandidatai, nurodantys atitinkamai Glo ir TI žalą. Tolesni šių miRNR ekspresijos duomenų tyrimai UExo ir inkstų audiniuose yra pagrįsti, kad UExo gautos miRNR būtų pritaikytos klinikinėje veterinarijoje.

Metodai

Etikos pareiškimas

Tyrėjai laikėsi Hokaido universiteto Veterinarinės medicinos aukštosios mokyklos laboratorinių gyvūnų priežiūros ir naudojimo vadovo (patvirtinto Tarptautinės laboratorinių gyvūnų priežiūros ir įvertinimo asociacijos). Visi mėginių ėmimo procesai buvo atlikti kaip klinikinės apžiūros ar diagnozės dalis, o gyvūnų savininkai pateikė informuotą sutikimą. Šis tyrimas retrospektyviai išanalizavo šiuos surinktus mėginius 2012 - 2016 m.

Gyvūnų pacientai

Šunų šlapimo mėginiai buvo paimti iš veterinarijos mokymo ligoninės, Hokaido universiteto (Saporas, Japonija) ir Matsubaros gyvūnų ligoninės (Osaka, Japonija) ir buvo analizuojami retrospektyviai. Pirmiausia šunys, kurių serumo Cr lygis viršija 1, 5 mg / dL, buvo atrinkti kaip kandidatai, turintys KD riziką (Tarptautinė inkstų interesų draugija; //iris-kidney.com/guidelines/grading.html). Keturiasdešimt septyni šunys buvo diagnozuoti KD, remiantis serumo Cr, taip pat BUN serumu, šlapimo spalva, klinikinio veterinarijos gydytojo diagnoze ir ligos istorija iš sveikatos įrašų šlapimo paėmimo dieną. KD mėginiai rodė serumo BUN (35, 4–140, 0 mg / dL) ir Cr (1, 5–9, 2 mg / dL) diapazoną. HC mėginiai buvo apibrėžti kaip mėginiai iš asmenų, kurių normalus serumo BUN (8, 0–18, 0 mg / dL) ir Cr (0, 1–0, 9 mg / dL) diapazonas. Visi šlapimo mėginiai buvo laikomi –3 0 ° C temperatūroje iki naudojimo.

Inkstų audinių mėginiai buvo paimti Hokaido universitete, kai šunys buvo išnaikinti ir skiepyti. Pirmiausia inkstų mėginiai, rodantys normalią inkstų histologiją ir akivaizdžius inkstų pažeidimus, buvo suskirstyti atitinkamai į HC ir KD grupes. Kandidatams, kuriems nustatytas padidėjęs BUN serumo diapazonas (30, 4–140, 0 mg / dL) ir Cr (0, 5–7, 2 mg / dL), buvo diagnozuota KD (n = 7). Kandidatams, kuriems nustatytas normalus BUN serumo diapazonas (8, 3–21, 8 mg / dL) ir Cr (0, 3–0, 9 mg / dL), buvo diagnozuotas HC (n = 6).

UExo turinčios frakcijos išskyrimas

Visi šlapimo mėginiai (1 ml arba 5 ml) buvo centrifuguoti 2 000 x g 30 minučių 4 ° C temperatūroje, kad būtų pašalintos ląstelės ir nuosėdos. Iš šlapimo supernatanto, UExo turtinga frakcija buvo išskirta, naudojant Total Exosome Isolation (iš šlapimo) (1 reagentas; ThermoFisher Scientific, Waltham, MA, JAV) arba miRCURY Exosome Isolation Kit-Cells, šlapimą ir CSF (2 reagentas; Exiqon)., Vedbaek, Danija) pagal gamintojo instrukcijas. Trumpai tariant, 1 reagentui, vienodi tūriai šlapimo ir reagento buvo sumaišyti ir inkubuojami kambario temperatūroje 1 valandą. Po inkubacijos mėginys buvo centrifuguojamas 10 000 x g greičiu 1 valandą 4 ° C temperatūroje. 2 reagentui šlapimas ir reagentas (santykis nuo 2, 5 iki 1, 0) buvo sumaišyti ir inkubuojami 4 ° C temperatūroje 1 valandą. Po inkubacijos mėginys buvo centrifuguojamas 10000 g g 30 minučių 20 ° C temperatūroje. Abiejuose protokoluose po supernatanto aspiracijos buvo gauta granulė, kurioje yra UExo, ir panaudota imunoblotų, SEM arba RNR analizei.

Imunoblotai

Tirpūs baltymai buvo ekstrahuojami iš išskirtos UExo turinčios frakcijos, naudojant RIPA lizės buferį (Santa Cruz Biotechnology; Dalasas, TX, JAV). Imunoblotai buvo atlikti naudojant „NuPAGE“ elektroforezės sistemą (Life Technologies, Carlsbad, CA, JAV) su triušio anti-TSG101 antikūnu (reaktyvumas su žmogumi, pele, žiurke, karve, šunimi, arkliu ir triušiu; Biorbyt, Kembridžas, JK), triušio anti-CD9 antikūnas (reaktyvumas su žmogumi, pele, žiurke; Abcam, Kembridžas, JK) ir asilų anti-triušio IgG (H + L) antrinis konjuguotas antikūnas „Alexa Fluor 488“ („ThermoFisher Scientific“). Imuniniai kompleksai buvo aptikti naudojant „Typhoon Variable-Mode Imager“ („GE Healthcare“; Little Chalfont, JK).

SEM

UExo turtinga frakcija, išskirta naudojant 2 reagentą, buvo 10 minučių suspenduota 100 µL resuspensijos buferio (Exiqon), turinčio 2% paraformaldehido. Po fiksavimo 10 μl mėginio tirpalo buvo uždėta ant „Parafilm“ (Bemis, WI, JAV) ir 10 minučių uždengta tinkleliu (200 akių), padengta „excel“ palaikomąja plėvele („Nisshin EM“, Tokijas, Japonija). Po du kartus plovimo fosfatu buferiniu druskos tirpalu (PBS) 30 s, prie mėginio pritvirtinti tinkleliai 5 minutes buvo fiksuojami 2, 5% gliutaraldehido. 30 kartų 7 kartus plaunami distiliuotu vandeniu (DW), mėginiai 30 min. Buvo fiksuojami 1% osmio tetroksidu. Po plovimo DW 30 s 7 kartus, mėginiai buvo inkubuojami su 10% samario 10 min. Po plovimo DW 30 s 7 kartus, mėginiai, pritvirtinti prie tinklelio, buvo sumontuoti ant aliuminio mėginio pakopos ir lengvai padengti dulkių dažais E-1030 (Hitachi, Tokijas, Japonija). Mėginys buvo stebimas S-4100 SEM (Hitachi) esant 5 kV, 10 μA ir SE (U) režimui.

RNR gryninimas iš frakcijos, turinčios daug UEx

Iš išskirtos UExo turinčios frakcijos visa RNR buvo išgryninta naudojant miRNeasy Micro Kit (Qiagen, Venlo, Nyderlandai). Bendroji RNR iš UExo taip pat buvo gauta naudojant 1 žingsnio kolonėlių rinkinį (šlapimo egzosomų RNR izoliacijos rinkinį; Norgen, Thorold, ON, Kanada) pagal gamintojo instrukcijas. Visi RNR tirpalai buvo sureguliuoti iki 100 μL su RNazės neturinčiu vandeniu. Gauta RNR koncentracija buvo išmatuota naudojant „NanoDrop 2000“ („ThermoFisher Scientific“).

NGS

NGS buvo atlikta, kaip buvo pranešta anksčiau 4 . Bendros RNR kokybė izoliuotose iš UExo išvestose RNR, gautose naudojant kolonėlės metodą (1 ml šlapimo), buvo patikrinta naudojant Bioanalyzer (Agilent; Santa Clara, CA, JAV), o mėginiai iš HC ir KD gyvūnų buvo sujungti. kaip vienas pavyzdys kiekvienai grupei. Bibliotekos buvo paruoštos naudojant „TruSeq“ mažos bibliotekos paruošimo rinkinį (Iliumina; San Diegas, CA, JAV) pagal gamintojo protokolus ir seka naudojant 50 bazių skaitymus, gautus naudojant „HiSeq 2000“ platformą. Išsami informacija apie mažų RNR, nukreipiančių į miRNR, sekos analizę, yra aprašyta Papildomuose metoduose. Kaip nuoroda buvo naudojami 2011 m. Gruodžio mėn. (GRCm38 / mm10) pelių ( Mus musculus ) genomo duomenys (//genome.ucsc.edu/).

Histopatologinis tyrimas ir LMD

Inkstai buvo fiksuojami naudojant 10% neutralaus buferinio formalino arba 4% paraformaldehido ir buvo įterpti į parafiną. Norint įvertinti Glo pažeidimo sunkumą, buvo ištirta daugiau kaip 20 glomerulų kiekviename inkste, naudojant periodiškai rūgšties-Schiff (PAS) dažytas dalis. Kiekvienas inksto mėginys buvo išsamiai įvertintas pagal šiuos kriterijus: 0 balų, nėra atpažįstamo glo pažeidimo; 3 balas, nedidelis PAS teigiamas nusėdimas, lengvi proliferaciniai ar membraniniai pažeidimai, silpna glomerulų hipertrofija; 5 balas, segmentinis arba visuotinis PAS teigiamas nusėdimas, proliferaciniai ar membraniniai pažeidimai ir (arba) glomerulų hipertrofija; 7 balas, toks pat kaip ir 5 balas, kai nusėdimas PAS teigiamas 50% Glo ir (arba) sunkios glomerulų atrofijos ar hipertrofijos regionų; 9 balas, kapiliarų arba kapsulinių žaizdų išnykimas, PAS teigiamos medžiagos nusėdimas visame pasaulyje, uždegiminių ląstelių periglomerulinė infiltracija ir (arba) sunki glomerulų sklerozė. Panašiai, siekiant įvertinti TI pažeidimo laipsnį, buvo ištirta daugiau kaip 20 inkstų žievės sričių, padidinančių 200 kartų. Kiekvienas inksto mėginys buvo išsamiai įvertintas pagal šiuos kriterijus: 0 balų, nėra atpažįstamo pažeidimo TI; 3 balas, šiek tiek PAS teigiamų medžiagų vamzdiniame skiltyje, lengvas pilvaplėvės ląstelių įsiskverbimas, silpna kanalėlių pagrindo membranos hipertrofija ir (arba) lengvas vamzdinio spindžio išsiplėtimas; score 5, several PAS-positive materials in the tubular lumen, peritubular cell infiltration, hypertrophy of tubular basement membrane, and/or dilation of tubular lumen; score 7, the same as score 5 with fibrotic feature in TI; and score 9, numerous PAS-positive materials in the tubular lumen, severe peritubular cell infiltration, hypertrophy of tubular basement membrane, atrophy of tubules, severe fibrotic feature, and/or severe dilation of tubular lumen. Furthermore, the product of the Glo damage score and TI damage score was defined as “kidney damage score.” The median of the scores for each dog was expressed as the values of each group.

For LMD, deparaffinized sections were stained with toluidine blue. LMD was performed using a MicroBeam Rel.4.2 (Carl Zeiss; Oberkochen, Germany) on 200–400 Glo and TI sections with an area equal to that of the total area from which samples were collected. Total RNA from LMD samples was isolated using a miRNeasy Micro Kit (Qiagen).

miRNA analysis

miRNA levels in UExo-rich fractions and LMD samples were determined using a TaqMan MicroRNA RT Kit (ThermoFisher Scientific). Quantitative PCR analysis was performed using each miRNA-specific TaqMan primer and TaqMan Universal PCR Master Mix (ThermoFisher Scientific) with an MX3000P system (Agilent). Mimic miRNAs (AccuTarget; Bioneer, Daejeon, Republic of Korea) were used to draw standard curves, and the net level of miRNA was calculated by numerical formula.

Statistinė analizė

Results are expressed as the median or mean ± standard errors (SE). The Mann–Whitney U test was used to compare two groups ( P < 0.05). Kruskal-Wallis test was used for comparing over three populations or time points, and multiple comparisons were performed using Scheffé's method when a significant difference was observed ( P < 0.05). Spearman's correlation test ( P < 0.05) was used to analyze the correlation between two parameters.

Papildoma informacija

How to cite this article: Ichii, O. et al . Urinary exosome-derived microRNAs reflecting the changes of renal function and histopathology in dogs. Mokslas. Rep. 7, 40340; doi: 10.1038/srep40340 (2017).

Leidėjo pastaba: „ Springer Nature“ išlieka neutralus paskelbtų žemėlapių jurisdikcijos reikalavimų ir institucinių ryšių atžvilgiu.

Papildoma informacija

PDF failai

  1. 1.

    Papildoma informacija

Komentarai

Pateikdami komentarą jūs sutinkate laikytis mūsų taisyklių ir bendruomenės gairių. Jei pastebite ką nors įžeidžiančio ar neatitinkančio mūsų taisyklių ar gairių, pažymėkite, kad tai netinkama.