Kintamas kenkėjų geno įspaudimas žmogaus embrionuose prieš implantavimą | europos žmogaus genetikos žurnalas

Kintamas kenkėjų geno įspaudimas žmogaus embrionuose prieš implantavimą | europos žmogaus genetikos žurnalas

Anonim

Dalykai

  • Genetinis polinkis į ligas
  • Įspaudimas
  • Nevaisingumas
  • Reprodukcijos metodai

Anotacija

Yra įrodymų, kad pagalbinio apvaisinimo technologijos (ART) ir nevaisingumas gali paveikti atspausdinto paterniškai išreikšto 1- ojo geno / mezodermos specifinio transkripto homologo ( PEG1 / MEST ) geną ir jo metilinimą. Šiame tyrime siekėme įvertinti MEST geno įspaudimo būklę didelėje in vitro gautų žmogaus implantacijų, gautų in vitro, grupėje, kad apibūdintume galimą ART ir nevaisingumo poveikį šiam lokusui ankstyvajame žmogaus vystymosi etape. Embrionų genominė DNR iš morulų arba blastocistos stadijų embrionų buvo patikrinta, ar nėra transkribuoto Afl III polimorfizmo MEST metodu, o įspaudų analizė atlikta cDNR bibliotekose, gautose iš šių embrionų. Iš 10 heterozigotinių embrionų MEST išraiška buvo monoallelinė septyniuose embrionuose, daugiausia monoalleliniuose dviejuose embrionuose ir bialleliniuose viename embrione. CDNR, gauto iš 61 papildomo žmogaus implantavimo prieš implantavimą embrionų, kurių DNR genotipui nustatyti nebuvo įmanoma, patikros metu buvo nustatyti aštuoni embrionai, kurių ekspresija atsirado iš abiejų alelių (biallelinio arba vyraujančio monoallelinio). Todėl kai kuriuose embrionuose įspausta MEST išraiška atsiranda vėlyvojo implantacijos metu. Pastebėtas MEST įspaudų kintamumas apvaisinimo in vitro ir intracitoplazminės spermos injekcijos embrionų atveju. Biallelinė arba daugiausia monoallelinė MEST išraiška nebuvo susijusi su jokia nevaisingumo priežastimi. Charakterizuojant pagrindines MEST izoformas, paaiškėjo, kad izoforma 2 buvo aptinkama ankstyvame vystymosi etape ir pati skirtingai įspausta tarp embrionų. Mūsų žiniomis, ši ataskaita yra didžiausias iki šiol atliktas genomo įspaudų embrionuose genomo įspaudimo tyrimas ir atskleidžiama, kad kai kuriems įspaustiems genams egzistuoja kontrastingos įspaudų būsenos tarp embrionų.

Įvadas

Paterniniu būdu ekspresuojamas 1 geno / mezodermos specifinio transkripto homologas ( PEG1 / MEST ) koduoja nežinomos funkcijos α / β hidrolazės raukšlės šeimos fermentą. Pelėms „ Mest“ priskiriama įspausta sritis, kuri turi įtakos 1 augimui, o „ Mest“ geno sutrikimas lemia embriono augimo sulėtėjimą ir nenormalų motinos maitinimą. 2 Nutukusiame riebaliniame audinyje padidėja klastos išraiška ir tai gali reguliuoti adipocitų augimą ir lipidų kaupimąsi. 3, 4, 5, 6 Žmonėms įspaustas MEST genas priskiriamas 7q32, 7, 8 chromosomai ir yra kandidatas į Silver-Russell sindromo (SRS) geną, nors apie MEST seką ar epigenetines mutacijas dar nepranešama. 9, 10, 11 pelėms Pelių įspaudimo (LOI) praradimas yra susijęs su pakitusiu augimu. 12 MEST LOI žmonėms buvo aprašyti gaubtinės ir tiesiosios žarnos vėžiui 13 bei plaučių vėžio ląstelių linijoms. 14 LOI taip pat buvo pranešta apie invazinį krūties vėžį 15, tačiau čia pastebėta biallelinė išraiška greičiausiai atsirado dėl promotoriaus naudojimo perjungimo tarp MEST izoformų. 16

Pagalbinio apvaisinimo technologija (ART) ir nevaisingumas gali būti susiję su epigenetiniais defektais. Yra aiškių įrodymų, kad įvairios ART formos žmonėms, pelėms ir nežmoginiams primatams gali turėti įtakos MEST geno metilinimui ir ekspresijai. Buvo pranešta apie hipermetiliaciją MEST diferencijuotai metilintame regione (DMR) mergaitei, sergančiai SRS, kuri buvo pastojama apvaisinant in vitro ( 18 ), nors neaišku, ar ši paterniškai paveldėta epimutacija sukėlė sindromą. Neįprastas MEST metilinimas DNR buvo pastebėtas ir superovuliuotuose žmogaus oocituose. 19 In vitro ir in vivo pastojusiems vaikams buvo nustatyta diferencinė metilinija MEST metu. Pastebėta, kad vaikai, pastojantys per IVF, skiriasi, palyginti su intracitoplazminiu spermos injekcija (ICSI), ir natūraliai pagimdytais vaikais. Pelėms „ Mest“ metilinimo įspaudas gali būti jautrus in vitro kultūros arba oocitų senėjimo in vitro poveikiui. Pastebėtas reikšmingas DNR metilinimo sumažėjimas atliekant „ Mest “ pelių oocituose, susidariusiuose po kiaušidžių folikulų auginimo, esant mažam metilo donorų kiekiui. 23 In vitro folikulogenezės sukeltas pelių „ Mest“ genų poveikis taip pat gali būti neigiamas, dėl to metilinimas gali būti prarastas. 24 Galiausiai buvo aprašytas per didelis MEST geno ekspresas po to, kai in vitro subrendo rezaus beždžionių oocitai. 25

Aberantiškas metilinimas MEST metu yra susijęs su tam tikromis vyrų nevaisingumo formomis. Hipermetiliacija MEST buvo aprašyta vyrams, kuriems nustatyta oligozoospermija, 26, 27 ir idiopatinis vyrų nevaisingumas. 28 MEST DMR metilinimo klaidos buvo dažniausiai pasitaikantys defektai, pastebėti nevaisingiems vyrams, palyginti su keliais kitais įspaustais genais. 29 Visuotinė spermos DNR metilinimo analizė taip pat atskleidė, kad padidėjęs MEST metilinimas susijęs su prastais spermos parametrais. 30

Visi šie duomenys reiškia, kad MEST lokusas gali būti paveiktas ART manipuliacijų ir neteisingo epigenetinio programavimo padarinių. Todėl šiame tyrime mes siekėme apibūdinti MEST įspaudimo būklę žmogaus embrionuose, implantuojamuose pagalbinio apvaisinimo būdu.

medžiagos ir metodai

Oocitai ir embrionai

Žmonių embrionai, implantuojami implantuojant implantaciją, kurie nebuvo atrinkti perkėlimui ir kurie dėl to buvo pertekliniai gydymo poreikiams, buvo paaukoti tyrimams, gavus informuotą sutikimą, poroms, lankantiems Leedo bendrosios ligoninės pagalbinio koncepcijos skyrių (ACU). Visi audiniai buvo paaukoti pagal protokolus, kuriuos patvirtino Lydso Vakarų tyrimų etikos komitetas ir kuriuos išdavė Žmogaus apvaisinimo ir embrionų tarnyba (HFEA). Kiaušidžių stimuliacijos, kiaušialąsčių surinkimo ir embrionų auginimo procedūros Medi-Cult IVF terpėje (MediCult UK Ltd, Reigate, UK) ir apvaisinimas in vitro buvo atliktas Leeds ACU pagal paskelbtus protokolus. 31 Paaukoti, švieži embrionai buvo pervežti antrą dieną po apvaisinimo į Jorko universitetą, kaip aprašyta anksčiau, 32, 33, ir išauginti į blastocistos stadiją. Kriokonservuoti embrionai, kurių perteklius neatitiko gydymo reikalavimų, buvo paaukoti tyrimams, gavus informuotas porų, lankančių Bourn Hall kliniką, Kembridžą, ir buvo atitirpinti bei išauginti į blastocistos stadiją HFEA licencijuotose tyrimų laboratorijose Lidse. Visi embrionai buvo atskirai kultivuojami 4 μl Earle'o subalansuoto druskos tirpalo lašeliais, papildytais 1 mM gliukozės, 5 m M laktato, 0, 47 m M natrio piruvato, 0, 5% (v / v) žmogaus serumo albumino (Zenalb 20; Bioproducts Lab)., Elstree, JK) ir aminorūgščių esant beveik fiziologinėms koncentracijoms, remiantis Tay ir kt ., 1997, 34 duomenimis, naudojant embrionų patikrintą mineralinį aliejų, esant 37 ° C, esant 5% CO 2 ore. Embrionai buvo perkelti į šviežius terpės lašus po kiekvieno 24 val. Auginimo laikotarpio. Kiekvienos morulos ar blastocistos morfologinis laipsnis buvo užfiksuotas auginimo pabaigoje, kaip aprašyta anksčiau. Buvo naudojami tik 1–3 klasių embrionai. Pasibaigus auginimui, embrionams buvo leista pražūti atvėsus iki kambario temperatūros per 10 minučių aplinkos atmosferos sąlygomis, nuplauti Ca 2+ ir Mg2 + be fosfatų buferiniu tirpalu 4 ° C temperatūroje (Life Technologies, Paisley, JK), prieš tai užšaldant lizės buferiu (Dynabeads, Life Technologies). Embrionų mėginių skaičiams 9 ir 10 (2b paveikslas) auginimo pabaigoje zona pellucidae buvo pašalinti, veikiant Acid Tyrode tirpalu (Sigma-Aldrich, Gillingham, JK).

Atvirkštinė transkripcija ir cDNR amplifikacija

Pavieniai embrionai ir oocitai buvo surinkti ir lizuoti 80 ° C temperatūroje lizės buferyje („Dynabeads mRNA DIRECT Micro Kit“, Life Technologies). Ekstrahavus RNR su oligo-dT Dynabeads, cDNR buvo sukurta ir amplifikuota, pritaikant esamus cDNR amplifikacijos protokolus 35, 36, naudojant 1 μg kiekvieno iš cDNR amplifikacijos pradmenų, pradmenis 1: 5′-AAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCCCT 24 -3 : 5′-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3 ′, naudojant aukštesniojo rakto II RNAseH atvirkštinę transkriptazę (Invitrogen) ir susijusius reagentus, inkubuojant 2 valandas 42 ° C temperatūroje. CDNR buvo amplifikuota PGR, naudojant papildomą 1 μg kiekvieno pradmens, 2 μl 50 x 2 pranašumo polimerazės (Clontech, Mountain View, CA, JAV), šiluminiame cikleriu 32 ciklams, esant 95 ° C 45 s, 65 ° C 6 minutes 45 s. Embriono cDNR bibliotekos naudojamos keliuose eksperimentuose.

Embrionų genotipų nustatymas

Genominė DNR buvo išgauta iš embrionų, naudojant „Qiagen DNA Micro kit“ (Crawley, JK) pagal protokolą, panaudojant ląstelių lizatą, likusį po mRNR ekstrahavimo proceso. Du PGR raštai buvo atlikti su 2, 5 μl ekstrahuotos genominės DNR, naudojant gruntą PEG1-gDNA-F GGTCCTGGCCATCAAACATA 37 ir R1 5′-CCTCTACTGTAGCTCAAGAG-3 ′ 38 pirmame ture, o PEG1-gDNA-F ir R2 5′- GGAGTCTCAGACTGTTATTTGC-3 ′ 38 antrame ture (1a paveikslas). PGR sąlygos buvo 94 ° C 5 minutes, tada 35 ciklai 94 ° C 30 s, 60 ° C 30 s, 72 ° C 1 min 30 s. Antrojo turo PGR produktai buvo suskaidyti ir pusiau apdoroti trimis vienetais „ Afl III“ ir suardyti 37 ° C temperatūroje per naktį, o po to dar 3 valandas papildyti dar dviem vienetais „ Afl III“. Produktai buvo tepami 1, 5% agarozės geliu, remiantis 100 bp kopėčių ir fermentų skaidymo kontrole. Alternatyva, embrionams buvo atliktas genotipas pagal MEST genomo PGR produktų seką (Biomolekulinės analizės priemonė, Lidso universitetas, Lidsas, JK).

Image

a ) MEST genomo ir įspaudų analizės PGR tyrimų, parodančių PGR pradmenų vietas, PGR produktus ir Afl III polimorfizmą, schema . b ) Genominės DNR ir cDNR išskyrimo iš atskirų implantacijos embrionų, genotipo nustatymo ir įspaudų analizės protokolo schema. c ) Namų apyvokos genų ir raidos žymenų kokybės tikrinimo PGR metodais pavyzdžiai embrionų cDNR bibliotekose, gauti iš šešių embrionų (i – vi), kurie buvo naudojami MEST įspaudų tyrime. Embrioninės cDNR buvo patikrintos β-aktino ( ACTB ) genu (A), GAPDH (G), HPRT (H kintamasis tarp embrionų) ir OCT4 (O).

Visas dydis

Įspaudų analizė ir izoformos 2 specifinė PGR

Heterozigotinių (genotipinių) embrionų ir nežinomų genotipų embrionų atrankos cDNR ekspresuoti MEST geno aleliai buvo analizuojami PGR iš 50 ng amplifikuoto embriono cDNR, naudojant MEST pradmenis F1 5′-GCAACAATGACGGGAACTTAGT-3 ′ ir R1 5′ CCTCTACTGTAGCTCAAGAG-3 ′ pirmajame ture, o F2 5′-TCAGAGGAAGAAGTTCAGAAGG-3 ′ ir R2 5′-GGAGTCTCAGACTGTTATTTGC-3 ′ - antrame ture. Pusė PGR produkto buvo suardyta Afl III, kaip aprašyta aukščiau. Kiekviename eksperimente buvo vykdomos tinkamos fermentų skaidymo kontrolės priemonės, kurios buvo amplifikuotos nuo riboto somatinio audinio mRNR kiekio. Kaip alternatyva, buvo seka MEST PGR produktai. Izoformos specifiniam PGR ( neaptveriančiam Afl III polimorfizmo) A egzonui (5′-CCTGTAGGCAAGGTCTTACCTG-3 ′) ir 1 egzonui (5′-GCGGCGGCCGGATATGGATA-3 ′) buvo naudojami specifiniai pradmenys 16 kartu su 5 „EXON R“. -GAAGACTTCCATGAGTGAAGGGC-3 ′ pirmame ture, o priekiniai gruntai buvo antrą kartą įstatyti su EXON 2 R2 5′-ATGTGCAGGTACGCAGCAAG-3 ′. Izoformos 2 specifiniam PGR, apimančiam Afl III polimorfizmą, pirmame ture buvo naudojami egzonas A ir R1, o antrame - pradmuo F1 ir R2. 38 RT-PGR produkto identiškumas iš atrinktų embrionų buvo patvirtintas tiesiogine seka naudojant pradmenis F1 ir R1. Alelių santykis buvo išreikštas kiekybiniu būdu, naudojant trijų juostos piko rodmenų vidurkį, naudojant J vaizdą (//rsbweb.nih.gov/ij/). Vyraujanti monoallelinė išraiška buvo apibūdinta kaip alelių santykis didesnis kaip 1: 3, kaip aprašyta anksčiau. 39, 40 PGR produktai, gauti naudojant izoformai specifinius pradmenis, buvo sekuojami klonuojant į TOPO-TA (Invitrogen), naudojant standartinius M13 pradmenis. Kiti čia aprašyti pradmenys yra: GAPDH priekinė 5′-TTGTCAAGCTCATTTCCTGGTAT-3 ′, GAPDH atvirkštinė 5′-TCTCTCTTCCTCTTGTGCTCTTG-3 ′, ZP2 priekinė 5′-GACCTGCCCTTGTGTCCTCTA-3AG ’, ZP2 atvirkštinė ′ ZAC -GATATACATCACCTGCCACC-3 ′, ZP3 atvirkštinė 5′-TCACTTCATGGTCACCACTC-3 ′.

Rezultatai

Embrionų genominės DNR ir cDNR patikra

Embrionų genotipui nustatyti ir įspaudų analizei atlikti buvo įdėtas įterptasis PGR aplink Afl III polimorfizmą MEST geno 3′-netransliuojamoje srityje (1a pav.). Šiam tyrimui tėvų DNR pavyzdžių nebuvo galima nustatyti genotipui nustatyti, taigi mes negalėjome tokiu būdu nustatyti informatyvių heterozigotinių embrionų. Todėl mes sukūrėme metodiką, leidžiančią embriono genomo DNR išgauti iš likusio plovimo buferio, kuris liko po mRNR išskyrimo procedūros, kad būtų galima tiesiogiai nustatyti embriono DNR genotipą (1b pav.). Nors spermatozoidai gali likti prilipę prie zonos, esančios iš IVF gautų embrionų, šio tyrimo pastebėjimai rodo, kad spermos DNR buvo suskaidyta morulos arba blastocistos stadijoje ir todėl jų amplifikacija nebuvo atlikta atliekant genominės patikros PGR. Be to, į tyrimą buvo įtraukti ICSI embrionai (be lipnių spermos) ir embrionai, iš kurių pašalinta zona. Išsami informacija apie visus embrionus, naudojamus tyrime, pateikta 1 lentelėje. Mes nustatėme 10 vėlyvųjų implantacijos stadijų embrionų, kurie buvo heterozigotiniai MEST geno afl III polimorfizmui.

Pilno dydžio lentelė

MEST įspaudų analizė heterozigotiniuose embrionuose

Atliekant MEST įspaudų analizę, cDNR bibliotekos, kurios buvo sugeneruotos iš žmogaus implantacijos embrionų, buvo patikrintos tikrinant namų tvarkymo genų ir tinkamų vystymosi žymenų genų, įskaitant β- aktiną ( ACTB ), GAPDH , HPRT ir OCT4, nuorašus (1c paveikslas). Alelių ekspresija buvo įvertinta 10 heterozigotinių embrionų, naudojant įdėto PGR schemą, kuri sustiprina visas žinomas MEST izoformas. 2a paveiksle MEST transkriptų PGR amplifikacija buvo atlikta iš penkių heterozigotinių embrionų cDNR. PGR produktai buvo suskaidyti Afl III kartu su atitinkamomis fermentų skaidymo kontrolėmis, gautomis iš cDNR bibliotekų, kurios buvo amplifikuotos dėl riboto somatinio audinio mRNR (0, 5 μg ), kurie buvo arba homozigotiniai kiekvienam aleliui (A arba G), arba heterozigotiniai, kiekių. Visų embrionų alelių santykis parodytas 1 lentelėje. 1-ojo laipsnio, 2 laipsnio ir 6-osios dienos IVF morulų impregnantų analizė parodė daugiausia monoallelinę MEST išraišką (2a paveikslas, 1 pavyzdys) su 93–7% A ekspresija. ir G aleliai. Taigi iš silpnosios alelės (numanomos motinos alelio) buvo galima aptikti silpną ekspresiją. Kitais keturiais vėlyvojo implantacijos etapo embrionais ekspresija buvo griežtai monoallelinė (2a pav., 2–5 pavyzdžiai). Šie mėginiai apėmė 2 laipsnio IVF blastocistą (2 pavyzdys), 2 laipsnio, 7 dienos IVF blastocistą (3 pavyzdys), 2 laipsnio, 7 dienos IVF blastocistą (4 pavyzdys) ir 2 laipsnio dieną. -6 Atitinkamai ICSI morula (5 pavyzdys). MEST įspaudų analizė taip pat buvo atlikta antrame heterozigotinių embrionų rinkinyje, kur embriono genomo DNR buvo genotipuotas sekos Afl III polimorfizmu (2b paveikslas, mėginių skaičius nuo 6 iki 10). MEST įspaudų analizė buvo atlikta jų atitinkamose cDNR sekose ir (arba) su Afl III restrikcijos virškinimu. 6 mėginio (6 dienos išplėstinė ICSI blastocista) ekspresija buvo biallelikinė. Monoallelic MEST ekspresija pastebėta dar trijuose papildomuose blastocistose (2b paveikslas, 7–9 pavyzdžiai). Vyraujanti monoallelinė ekspresija buvo stebima per 6 dieną išplėstą IVF blastocistą (10 pavyzdys).

Image

MEST įspaudų analizė 10- ame IVF ir ICSI embrionų implantuose, kurie buvo heterozigotiniai MEST Afl III polimorfizmui. PCR schema, naudojama analizės įspaudams iš cDNR, sustiprina abi MEST izoformas. Visa informacija apie mėginius yra pateikta 1 lentelėje. A ) MEST įspaudų analizė atliekant fermentaciją afl III būdu heterozigotinėse blastocistose. Embrionams buvo atliktas genotipas, o po to įvertinta įspaudų analizė. Antrosios apvaliosios PGR produkto genomos PGR ir Afl III skaidymas buvo atliktas siekiant nustatyti heterozigotinius embrionus (genomo DNR plokštes). Iš kiekvieno embriono gautos amplifikuotos cDNR PEG1 / MEST nuorašų amplifikacija buvo atlikta trimis egzemplioriais (a – c) su nesuvirškintais (-) ir visiškai suvirškintais produktais (+) gretimose juostose (cDNR plokštės). Kiekvieno embriono fermento skaidymo kontrolė MEST PGR produktuose buvo įtraukta iš amplifikuotų cDNR bibliotekų, gautų ribojant žinomo genotipo somatinių audinių RNR kiekius. Jie buvo homozigotiniai kiekvienam priešingam aleliui (1 ir 2 kontrolinės juostos) arba bialleliniai (3 kontrolinė juosta). Į neigiamą mėginio kontrolę įeina mėginys, atliktas per abu PGR raundus (−ve 1, 2) ir tik antrąjį raundą (−ve, 2). MEST įspaudas vienoje moruloje (1 embrionas) buvo daugiausia monoallelinis, o monoallelic MEST raiška buvo stebima 2–5 embrionuose. b ) MEST įspaudų analizė papildomame heterozigotinių blastocistų rinkinyje, gautame sekuojant MEST PGR produktus iš penkių žmogaus blastocistų genominės DNR ir analizuojant MEST įspaudus jų atitinkamose cDNR sekose arba Afl III restrikcija. Viename embrione (6-as embrionas) raiška buvo biallelinė (smailės sutampa cDNR seka), o daugiausia monoallelinė išraiška buvo stebima 6 dieną išplėstoje IVF blastocistoje (10-as embrionas). Monoallelic ekspresija buvo stebima trijuose papildomuose blastocistose (7, 8, 9). c ) Atrinktų embrionų, naudojamų šio paveikslo analizei atlikti, nuotraukos (1, 2, 3, 4, 9, 10 embrionai).

Visas dydis

MEST įspaudas blastocistos ir morulos cDNR bibliotekose

Kintamo MEST įspaudimo stebėjimas heterozigotiniuose embrionuose paskatino išplėsti embrionų MEST įspaudų patikrinimą, naudojant didelę cDNR bibliotekų ( n = 61), gautų iš žmogaus blastocistų, ir mažesnį morulių skaičių (3 pav.). Šių mėginių genominės DNR nebuvo. Kadangi šių embrionų genotipas nežinomas, šie eksperimentai yra informatyvūs tik nustačius išraišką iš abiejų alelių. Tačiau įvertinus didelę embrionų grupę, galima gauti naudingos informacijos apie embrionų įspaudimo kintamumą. Buvo identifikuoti aštuoni embrionai, kurių raišką galima aptikti iš abiejų alelių (3 paveikslas). Atliktas embrionų, gautų iš IVF, embrionų (3 paveikslas, 11, 12, 29, 57 ir 58 pavyzdžiai) ir iš ICSI gautų embrionų (10, 39 ir 41 pavyzdžiai) atspaudas. Dviejų brolių ir seserų ICSI embrionai, gauti po vyrų faktoriaus nevaisingumo, pasireiškė bialleliniu ir vyraujančiu monoalleliškumu (3 paveikslas, atitinkamai 39 ir 41 pavyzdžiai). MEST įspaudas neatitiko dviejų brolių ir seserų IVF embrionų, kuriuose vyravo monoallelinė ir monoallelinė ekspresija (atitinkamai 3 paveikslas, 11 pavyzdys ir 2a paveikslas, 2 pavyzdys).

Image

MEST įspaudų analizė 61 nežinomo genotipo žmogaus implantacijos embrionuose. PGR tyrimas amplifikuoja abi MEST izoformas. Neišgesinti (-) ir visiškai „ Afl III“ suskaidyti produktai (+) rodomi gretimose juostose. Įtraukiami kontroliniai bialleliniai arba daugiausia monoalleliniai mėginiai, kurie buvo paimti iš mišrių somatinių audinių ir kepenų (atitinkamai 7 ir 49 mėginiai). Abu MEST aleliai buvo aptikti 10, 11, 12, 29, 39, 41, 57, 58 embrionų pavyzdžiuose. Embriono detalės ir MEST įspaudų būklė apibendrinta 1 lentelėje. Šiame paveikslėlyje 39 ir 41 pavyzdžiai yra brolių, gimusių iš ICSI, embrionų pavyzdžiai. . 11 pavyzdys (3 paveikslas) yra 2a paveiksle pateikto 2 mėginio brolis, abu yra gauti iš IVF.

Visas dydis

MEST izoformų ekspresija žmogaus oocituose ir embrionuose prieš implantavimą

Žmonėse yra ekspresuojamos dvi pagrindinės MEST izoformos: 1 izoforma ir 2 izoforma, kurios atsiranda atitinkamai iš P2 ir P1 promotorių. Mes apibūdinome MEST izoformų raišką žmogaus oocituose ir embrionuose prieš implantavimą. Mūsų tyrime, kuriame buvo naudojamas pusiau įterptas PGR protokolas su specifiniams 1 izoformos pradmenims, besidriekiantiems nuo 1 egzono (dar vadinamo 1c) iki 2 egzono, 1 izoforma nebuvo lengvai aptinkama oocitų, zigotų ar morulų mėginiuose (4a pav. –C). 1 izoformos ekspresija buvo silpnai nustatyta tik viename iš devynių blastocistų, tačiau lengvai aptinkama kontrolinėse cDNR, gautose iš mišrių žmogaus audinių, kiaušidžių ir placentos (4c paveikslas). Priešingai, izoforma 2 buvo nustatyta kiaušialąsčių, zigotų, morulų ir blastocistos stadijų embrionuose, be kontrolinių audinių, naudojant izoformai 2 specifinius pradmenis, besitęsiančius nuo egzono A (taip pat vadinamo 1a) iki 2 egzono (4a – c pav.). Izoformai specifinių PGR produktų tapatumas buvo patvirtintas sekvenavimu. MEST izoforma 2 yra vyraujanti MEST izoforma, kurią mes nustatėme žmogaus oocituose ir prieš implantavimą embrionuose.

Image

MEST izoformų ekspresija žmogaus oocituose, zigotuose ir prieš implantavimą embrionuose. ( a ) 1 izoformos ekspresija buvo įvertinta naudojant pusiau įterptą PGR protokolą su specifiniais 1 izoformos pradmenimis, besitęsiančiais nuo 1 egzono (dar vadinamo 1c) iki 2 egzono. 2 izoformos ekspresija buvo aptikta naudojant pradmenis, besitęsiančius nuo egzono A. (dar vadinama 1a) iki 2 egzono. b ) 1 ir 2 izoformų ekspresija žmogaus oocituose (1–5 juostos) ir zigotuose (6–8 juostos). 1 izoforma buvo silpnai aptinkama tik viename oocite (1 izoforma, 2 juosta), tačiau ji buvo aptikta kontroliniuose mėginiuose, sudarytuose iš mišrių somatinių audinių (1 izoformos eksperimentas, 9 ir 10 juostos) ir placentos bei kiaušidžių (11 ir 12 juostos). tas pats tyrimas. Izoforma 2 buvo nustatyta visuose oocitų ir zigotų cDNR (2 izoformos eksperimentas, 1–8 juostos) ir kontrolinės (9–12 juostos). 2 izoforma gali būti sujungta atskirai: 2-osios izoformos trumpesnis P1a nuorašas buvo pagrindinis splaisingo variantas, išreikštas oocito, zigotos ir visose priešimplantacinėse stadijose. Didesnis P1b transkriptas buvo aptiktas tik kaip silpnesnė juosta dviejuose oocituose, kaip nurodyta („Isoform 2“ eksperimentas, 1 ir 3 juostos). c ) 1 ir 2 izoformų ekspresija žmogaus morulose ir blastocistose. 1 izoforma buvo silpnai nustatyta vienoje blastocistoje (1 izoforma, 1 juosta, kaip nurodyta). Priešingai, 2 izoforma buvo lengvai aptinkama visuose morulos arba blastocistos stadijos embrionuose (1–10 juostos) ir kontroliniuose audiniuose (11, 12 juostos). d ) 2 izoformos specifinio įspaudo analizė trijuose embrionuose, naudojant pirmojo apvaliojo PGR pradmenis, esančius A egzone, ir 3′-UTR (R1), kurie pasirenka izoformą 2, ir antrojo apvalumo pradmenis, esančius 10 egzono ir 3′-UTR (R2). ), kurie supa Afl III polimorfizmą. 1 pavyzdys: ICSI blastocistos, kurioms anksčiau buvo nustatyta, kad PGR tyrime vyrauja monoallelinė ekspresija, kuri amplifikuoja abi izoformas (žr. 3 paveikslą, 10 pavyzdys), 2 mėginys: 6 dienos IVF morula, kuri anksčiau buvo įrodyta, kad vyrauja monoallelinis MEST išraiška (žr. 2a paveikslą, 1 pavyzdys), 3 pavyzdys: 6 dienos ICSI morula, kuri anksčiau buvo patvirtinta, kad turi monoallelinę MEST išraišką (žr. 2a paveikslą, 5 pavyzdys). 4 ir 5 juostos yra atitinkamai neigiamos pirmojo ir antrojo etapo PGR kontrolinės vertės. e) Motinos (iš kiaušialąsčių pagamintų) zona pellucida genų nuorašų ( ZP2 , ZP3 ) ir GAPDH ekspresija embrionuose su bialleliniu arba vyraujančiu monoalleliniu MEST ekspresija. (1–7 juostos) Embrionai, turintys biallelio arba daugiausia monallelinio MEST išraišką. (8 juosta) Mišri žmogaus somatinių audinių kontrolė (MT), (9 juosta) Sukaupti MII oocitų kontrolės cDNR mėginiai (MII), −ve kontrolė (−ve).

Visas dydis

Alternatyvus izoformos 2 sujungimas

Anksčiau buvo pranešta apie alternatyvų 2-os izoformos susiuvimą A eksone. 42 Trumpesnis izoformos 2 P1a nuorašas buvo pagrindinis splaisingo variantas, išreikštas žmogaus oocitais, zigotomis ir visais čia išbandytais prieš implantavimą susijusiais etapais (4b paveikslas). Didesnis P1b transkriptas buvo aptiktas kaip silpnesnė juosta dviejuose oocituose. PGR produktų tapatumas buvo patvirtintas sekvenavimu.

2 izoformos tiesioginė įspaudų analizė morulos ir blastocistos stadijų embrionuose

Trims embrionams buvo atlikta izoformos 2 specifinio įspaudo analizė (4d paveikslas), siekiant išsiaiškinti, ar tarp embrionų pastebėtas kintamas MEST įspaudimas yra priskirtinas kintamajam izoformos 2 įspaudui. 4d paveiksle 1 pavyzdys buvo ICSI blastocista, kokia anksčiau buvo. parodyta, kad vyrauja monoallelinė MEST ekspresija, kai ji analizuojama PGR metodu, kuris amplifikuoja abi izoformas (žr. 3 paveikslą, 10 pavyzdys). 2 mėginys buvo heterozigotinė 6-osios dienos IVF morula, kuriai anksčiau buvo įrodyta, kad vyrauja monoallelinė ekspresija (žr. 2a paveikslą, 1 pavyzdys). 3 mėginys buvo 6 dienos ICSI morula, kuris anksčiau buvo patvirtintas kaip heterozigotinis ir įspaustas (žr. 2a paveikslą, 5 pavyzdys). Rezultatai patvirtina izoformos 2 įspaudimo kintamumą tarp embrionų. Motinos transkriptų ( ZP2 , ZP3 ) nenustatymas blastocistose, kurioms buvo nustatyta monoallelinė ar biallelinė MEST išraiška (4e pav.) Rodo, kad šiuose blastocistose greičiausiai trūksta oocitų gautų nuorašų. Todėl tikriausiai MEST nuorašai, amplifikuoti mūsų tyrimuose, yra embrioninės kilmės.

Diskusija

Įvertinus įspaustų genų įspaudimo būklę žmogaus preimplantacijos embrione, galima atskleisti, kaip įspaustų genų reguliavimą gali paveikti ART ir nevaisingumas, ir kaip galima to išvengti. Šie duomenys taip pat teikia kontrolinę informaciją, kuria remiantis galima geriau suprasti žmogaus embrioninių kamieninių ląstelių epigenetinio nestabilumo kilmę. Be to, kad būtų analizuojami epigenetiniai ženklai, tokie kaip DNR metilinimas ankstyvame vystymosi etape, taip pat svarbu tirti įspaustų genų raišką, nes jų raiškos būseną lemia kolektyvinė šių epigenetinių ženklų įtaka, neatsižvelgiant į jų pobūdį. Iki šiol buvo nustatyta tik dviejų genų įspaudimo būsena, kad būtų galima vystytis prieš implantavimą, ir tai rodo, kad IGF2 ir SNRPN yra įspausti. 43, 44

Yra žinoma, kad MEST geno nuorašai yra ekspresuojami žmogaus oocituose ir embrionuose prieš implantavimą. 38 Tačiau ankstesni bandymai apibūdinti MEST įspaudimo būklę žmogaus skilimo embrionuose buvo nenuoseklūs (aprašyti Monk and Salpekar (2001) 45 ). Dabartiniame tyrime mes parodėme, kad didelėje žmonių, implantuotų prieš implantuojant embrionus, kurie dažniausiai buvo blastocistos stadijoje, grupėje MEST geno įspaudimas buvo įvairus. Svarbu tai, kad mūsų duomenys rodo, kad įspausta MEST išraiška iš tikrųjų gali įvykti vėlyvosios implantacijos metu ir tai atitinka pastebėtą reikšmingą MEST ekspresijos sumažėjimą blastocistos etape žmogaus partenogenetiniuose preimplantacijos embrionuose. 46

Viso mūsų tyrimo metu mes stebėjome iš viso 11 embrionų, kuriuose buvo aptikti abiejų alelių nuorašai - bialleliniai (keturi embrionai) arba daugiausia monoallelic (septyni embrionai). Todėl iš tikrųjų įmanoma, kad kai kurie gydymo nuo ART ar nevaisingumo aspektai gali turėti įtakos MEST įspaudimui šiais atvejais. Daugumoje pranešimų apie MEST įspaudimo sutrikimą vyriškos lyties faktorių nevaisingume nurodoma apie tėvystės (išreikšto) MEST alelio hipermetilinimą. 18, 26, 27 dalis. Prieš implantuojant embrioną mažai tikėtina, kad tokia nenormali metilinimo būsena tiesiogiai sukeltų atsipalaidavimą, ty transkripcijos pradžią iš paprastai nutildyto motinos alelio. Todėl tikėtina, kad atsipalaidavusio MEST įspaudimo priežastis, pastebėta šiuose embrionuose, yra motinos arba embriono kilmės, pvz., Nesugebėjimas nustatyti tinkamo įspaudimo oocitoje ir (arba) įspaudo neišlaikymas vykstant implantavimui. Sutikus, porų, turinčių skirtingą nevaisingumo priežastį, tiek IVF, tiek pagal ICSI gautus embrionus buvo pastebėtas ramus MEST įspaudas, todėl jie gali atsirasti nepriklausomai nuo poveikio, susijusio tik su vyrų nevaisingumu (1 lentelė). Pastebėjome, kad embrionuose, kuriems buvo priskirta 1 ir 2 klasė, buvo pastebėtas ramus MEST įspaudimas, todėl implikuoja, kad embriono morfologinis laipsnis nėra naudingas rodiklis embriono epigenetinei būklei įvertinti, bent jau MEST . Dviejų brolių ir seserų IVF blastocistos (2 pavyzdys, 2a paveikslas ir 11 pavyzdys, 3 paveikslas) parodė MES atspaudų kontrastines būsenas, turinčias atitinkamai monoallelinę ir vyraujančią monoallelinę išraišką. Kadangi šie brolių ir seserų embrionai buvo apvaisinti ir auginami kartu, mažai tikėtina, kad kultūrinė aplinka ar poveikis, susijęs su moters nevaisingumu, yra embriono, sukeliančio atsipalaidavimą, priežastinis veiksnys; tačiau reikia atsižvelgti į embrionų vystymosi skirtumus. Kitos galimos embrionų MEST įspaudimo kintamumo priežastys gali būti skirtingi atsakai į superovuliacijos režimą. 19 Kituose tyrimuose nustatyta, kad MEST geno metilinimas vaikams, kurie gimsta per ART, yra mažesnis nei vidutinis. Šie stebėjimai sutampa su mūsų išvadomis, apie kurias pranešta čia, ir gali būti, kad bus prarastas MEST įspaudimas ankstyvajame embrione. Mūsų tyrimo grupėje buvo embrionai, kurie buvo apvaisinti dviejose skirtingose ​​vaisingumo klinikose. Tai rodo, kad kintamas MEST įspaudas gali būti būdingas embrionams, gautiems in vitro , bet taip pat gali atsirasti in vivo . Dėl nepakankamos medžiagos (genominės DNR) negalėjome nustatyti, ar LOI buvo kituose lokusuose, o tai reikštų visuotinį įspaudimo defektą. Embrionai gali būti akivaizdžiai išsivystę iki blastocistos stadijos su atsipalaidavusiu MEST įspaudu.

Tačiau šiuos rūpesčius reikia suderinti su dabartinėmis žiniomis apie izoformų įspaudimo būklę, kylančią iš MEST lokuso. Atrodo, kad izoforma 1 yra išreikšta monoalleliais daugelyje audinių. Pradinėse ataskaitose 2 izoforma apibūdinta kaip biallelinė kraujo limfocituose. Vėlesniuose pranešimuose nurodoma, kad tam tikruose audiniuose, įskaitant krūtį, placentą ir storąją žarną, 2 izoforma iš tikrųjų gali būti įspausta ir, be to, kad atspaudo būsena (nesvarbu, ar monoallelic, ar biallelic) gali skirtis tarp asmenų. 13, 16, 37, 47, kituose tyrimuose pastebėta, kad izoforma 2 yra eksternu ekspresuojama vaisiaus placentoje, taip pat inkstuose ir fibroblastų linijose, stebint polimorfinį atspaudą tarp skirtingų fibroblastų linijų. 48 Taip pat buvo pranešta apie kintamą MEST, įskaitant izoformą 2, įspaudimą tarp žmogaus embriono kamieninių ląstelių (hESC) linijų, keliant susirūpinimą dėl šių ląstelių epigenetinio stabilumo. 40, 49, 50

Atsižvelgdami į abejotiną MEST metilinimą ir įspaudus ligas, 13, 14, 16, mes manėme, kad svarbu toliau apibūdinti ekspresiją MEST lokuso embrionuose su ekspresija, kylančia iš abiejų alelių. Mūsų duomenys rodo, kad 2 izoforma buvo vyraujanti MEST izoforma, aptinkama prieš implantavimą embrionuose, ir tiesiogiai parodo, kad pačios izoformos 2 įspauda gali skirtis tarp embrionų (4d paveikslas). Tačiau negalėjome ištirti biallelinių embrionų izoformos 2 įspaudimo tyrime. Mes pripažįstame, kad techniniai apribojimai arba diferencinis poli-A uodegos ilgio panaudojimas tarp izoformų gali apriboti mūsų galimybes aptikti izoformos 1 ekspresiją oocituose ir embrionuose (atitinkamai 4b ir c paveikslai). Svarbu tai, kad neradome MEST įspaudų būsenų, kurios stebimos sergant šia liga, ty 1 izoformos atspaudo atsipalaidavimo arba promotoriaus, pereinančio nuo atspausdintos izoformos 1 prie kintamai atspausdintos izoformos 2. MEST įspaudimo kintamumas tarp HESC linijų and also the placenta may therefore reflect an epigenetic programme that was intrinsic to the founder blastocyst, within the inner cell mass and trophectoderm, respectively. We detected expression of the P1b MEST splice variant in a small number of oocytes (Figure 4b) and this is in agreement with the observation of expression of P1b in the ovary. 42

In conclusion, while infertility or ART-induced effects both remain as possible causes for the variable imprinting of MEST observed among the large cohort of blastocysts tested, our considered opinion is that effects due to inter-individual variation in imprinting of isoform 2 must also be considered. These MEST imprinting differences may also exist in naturally conceived human preimplantation embryos. Regardless of the cause, the developmental consequences of the variable imprinting of MEST in early human embryos in vitro and in vivo remain unclear. In mice, elevated expression of Mest has been associated with fat mass expansion 4, 51, 52 and obese phenotypes with LOI of Mest have been obtained from epigenetically immature oocytes. 53 Finally, it remains possible that uncharacterized MEST transcripts, such as human equivalents of the longer MestXL variants that were recently described in the mouse, 54 may have been amplified in our non-isoform-specific PCR assays. These observations suggest that further characterisation of the causes and effects of contrasting embryonic imprinting states during in vitro conception are required.