In vivo genomo redagavimas naudojant nukleazę koduojančią mrną ištaiso sp-b trūkumą | gamtos biotechnologijos

In vivo genomo redagavimas naudojant nukleazę koduojančią mrną ištaiso sp-b trūkumą | gamtos biotechnologijos

Anonim

Dalykai

  • Tikslinis genų taisymas

Redaktoriui:

Genomo redagavimas naudojant daugybę skirtingų nukleazių turi didelį potencialą išmušti ar pataisyti ligas sukeliančius genus. Ideali nukleazės tiekimo priemonė yra trumpalaikė, neintegruojasi į genomą ir gali efektyviai patekti į tikslines ląsteles. Šie reikalavimai dar nebuvo pasiekti vienu metu jokiu nukleazės tiekimo vektoriu. Mes ir kiti panaudojome modifikuotą mRNR, kuri nėra integruojanti ir suteikia laikiną baltymo ekspresijos impulsą, kaip alternatyvą tradiciniams viruso vektoriams 1, 2, 3, 4, 5 . Šis metodas leido pristatyti terapinius baltymus pelių, turinčių paviršiaus baltymų B (SP-B) 3 trūkumo ir eksperimentinės astmos 4 modelius. Čia mes naudojame nukleazę koduojančią, chemiškai modifikuotą (nec) mRNR, kad pateiktume specifinėms nukleazėms pagal nusistovėjusį transgeninį pelės SP-B trūkumo modelį 6, kuriame SP-B cDNR kontroliuoja tetraciklinų sukeliamas promotorius 7 Doksiciklino vartojimas skatina SP-B ekspresiją tokiu pat lygiu, kaip ir laukinio tipo pelėse (papildomas 1 pav.), O nutraukus doksiciklino vartojimą atsiranda fenotipiniai pokyčiai, panašūs į žmogaus ligos pokyčius, įskaitant sutirštėjusias alveolių sienas, sunkią ląstelių infiltraciją, padažnėję makrofagai ir neutrofilai, intersticinė edema, padidėję citokinai plovime, sumažėjusi plaučių funkcija ir mirtinas kvėpavimo sutrikimas, dėl kurio miršta per dienas 8, 9 . Mes įterpėme konstitucinį CAG promotorių prieš pat SP-B cDNR, kad būtų galima eksploatuoti nuo doksiciklino nepriklausomą ekspresiją ir pailginti gydomų pelių gyvenimą.

Pirmiausia pritaikėme cinko pirštų nukleazių (ZFN) ir į transkripcijos aktyvatorius panašių efektorinių nukleazių (TALEN), skirtų transgeninei SP-B kasetei (1a pav. Ir papildomas 2 pav.), Grupę. Mes pasirinkome TALEN Nr. 1 (T-1) ir ZFN Nr. 3 (Z3) dėl jų didelio aktyvumo ir artumo prie norimos promotoriaus integracijos vietos (1a, b pav.) Ir palygino pristatymą plazmidės DNR ir mRNR. mRNR pristatymas lėmė dažnesnį dvigubų stygų pertraukimų (DSB) (1c pav. ir papildomas 3 pav.; P <0, 05) ir homologijai skirto remonto (HDR) (1d pav., P <0, 05) indukciją. Kadangi Z3 mRNR buvo veiksmingesnė nei T-1 mRNR abiem atvejais, Z3 buvo pasirinktas tolesniam eksperimentui (aminorūgščių sekos rastos papildomame 4 pav.). Palyginimas su Z3 koduojančiu AAV 6 serotipo vektoriu (AAV6) („Z3 AAV6“) parodo santykinai trumpalaikę Z3 mRNR išraišką (1e pav.), Ribojantį laiką, per kurį gali atsirasti tikslinis skilimas.

Image

a ) T-1 ir Z3 kandidatai, palyginti su transgenine SP-B kasete. CMV, citomegalo virusas. ( b ) T7 tyrimai, skirti nustatyti TALEN ir ZFN sukeltų indelių dažnį genominėje DNR, surinktoje praėjus 3 d po transfekcijos (5 μg / 80 000–100 000 ląstelių). Žr. Papildomą 21 brėž. ( c ) T-1- ir Z3 sukeltos indelės, pateikusios nukleazes kaip mRNR arba plazmidinę DNR (pDNR; 0, 5 arba 5 μg). Pageidaujama nukleazė pažymėta žalia dėžute. ( d ) HDR 3 d procentas po 5 μg T-1 arba Z3 mRNR (arba pDNR) transfekcijos 0–4 μg donoro plazmidėje. Rodyklės žymi NHI jautrius skilimo produktus, atsirandančius dėl HDR. B - d buvo naudojami transgeniniai SP-B pelių gauti fibroblastai; nd, neaptinkamas. e ) Laikas, rodantis 3xFLAG pažymėtos Z3 mRNR, palyginti su Z3 AAV, kinetiką ir stabilumą A549 ląstelėse ( n = 3). Klaidų juostos, vidurkis ± sd ( f ) Anti-3xFLAG srauto citometrija parodo baltymų ekspresiją visose plaučių ląstelėse ir ATII ląstelėse. Šviesiai mėlyna dėžutė pateikia duomenis iš eksperimentinės tamsiai mėlynos dėžės sąrankos, bet be NP. Dėžutės, viduriai ± tarpkvartaliniai diapazonai; ūsai, minimalus ir maksimalus; * P <0, 05 palyginti su nemodifikuotu; ** P <0, 01 ir *** P <0, 001, palyginti su be NP. φ, pseudouridinas. ( g ) 3xFLAG imuninis dažymas pelių plaučių pjūviuose, aprašytuose f punkte . Mastelio juosta, 50 μm. Rodyklės rodo 3xFLAG išraišką.

Visas dydis

  • Atsisiųskite „Excel“ šaltinio duomenis

Norėdami optimizuoti ekspresiją pelės plaučiuose, mes skyrėme 3xFLAG pažymėtų Z3 mRNR plokštelę su įvairiomis modifikavimo schemomis 2, 5, 10 su arba be kompleksų į biologiškai suderinamas, biologiškai skaidžias nanodaleles (NP), pagamintas iš chitozanu dengto poli (pieno-ko -glikolio) rūgštis 11, 12 . Po intratrachealinio (it) pristatymo NP-kompleksas reikšmingai ( P <0, 001) padidino mRNR ekspresijos lygį (papildomas 5 pav.). 3xFLAG baltymo ekspresija buvo tvirčiausia toje grupėje, kurioje mRNR modifikuota su 25% 2-tiouridino (s2U (0, 25) ) ir 25% 5-metilcidtidino (m5C (0, 25) ) įsisavinimu ir kompleksuota su NP (1f, g pav. Ir papildomi pav. 6), ir po jo gimimo imuninės aktyvacijos nepastebėta (papildomas 7 pav.). Todėl vėlesniuose tyrimuose in vivo buvo naudojamas šio kandidato, vadinamo „Z3 nec-mRNA-NP“, pristatymas.

Tada mes sukūrėme papildomą donoro šabloną, kad įterptų konstitucinį CAG promotorių į Z3 nec-mRNR-NP supjaustytą vietą, prieš transgeninę SP-B cDNR (2g pav. Ir papildomos sekos). Sėkmingas konkrečios vietos HDR leistų pelėms išgyventi ir gaminti SP-B be doksiciklino. Kadangi donoro šabloną reikia pristatyti per daug, kad būtų galima įsitikinti, jog HDR metu jis yra palankesnis homologinei chromosomai, mes panaudojome AAV6 - vektorių, žinomą kaip aukšto efektyvumo keičiančias plaučių ląsteles 4 . Ex vivo AAV6 donoro pristatymas su Z3 nec-mRNR-NP lėmė pirminio fibroblastų HDR rezultatą (papildomas 8 pav.). Tuomet AAV6 donoras ir Z3 nec-mRNR-NP (arba Z3 AAV kontrolė) buvo pernešti tam tikru laiko atžvilgiu į transgeninių SP-B pelių plaučius ir pašalintas doksiciklinas (2a pav.). Pažymėtina, kad šių grupių pelės gyveno žymiai ilgiau, palyginti su suderintomis kontrolinėmis grupėmis (2a pav., P <0, 001), išlaikydamos SP-B ekspresijos lygį panašų į pelių, gavusių doksicikliną, 20 dienų po doksiciklino vartojimo nutraukimo ( 2b, c pav. Ir papildomi 9 ir 10 pav.) Derinant genų korekciją su AAV6 donoru ir Z3 nec-mRNR-NP (arba Z3 AAV), buvo išvengta plaučių funkcijos sumažėjimo (2d pav. Ir papildomas 11 pav.), Sunkių hemoraginių infiltracijų ir didelio masto edemos (papildomi 12–14 pav.) ) ir neutrofilija (papildomas 15 pav.) - visa tai stebima neigiamos kontrolės plaučiuose. Nežinomas interleukino (IL) -12 padidėjimas pastebėtas Z3 nec-mRNR-NP lyginant su pelėmis, gydomomis PBS (papildomas 16 pav.); tačiau interferono (IFN) -α padidėjimo nenustatyta (duomenys nepateikti). Biologinio pasiskirstymo analizės atskleidė, kad AAV išliko tik plaučiuose, o širdyje, kepenyse, inkstuose ar blužnyje jos nebuvo galima aptikti (duomenys nepateikti). DSB ir HDR greičiai (pastaruosius nustatant į vidinę PGR; 2g pav.) Atitiko sėkmingą genų manipuliavimą (2e, f pav.), Kuris taip pat buvo nulemtas tikslinės vietos sekos nustatymu (papildomas 17 pav.). Jei tai būtų pasiekta žmonėms, HDR greičio of 9% (2g pav.) Greičiausiai pakaktų, kad būtų išvengta sunkios ligos progresavimo (papildoma diskusija). Šie rezultatai taip pat patvirtino, kad nukleazės ekspresija buvo ilgesnė, jei ji buvo skiriama AAV, todėl Z3 nec-mRNA-NP tapo puikia ir efektyvia nešiklio priemone (2h pav. Ir papildomi 18–20 pav.).

Image

a ) Transgeninių SP-B pelių, traumuotų donoru (2, 5 × 10 11 viruso genomo AAV6 donoras, AAV6, arba jo nėra) ir nukleazės (20 μg Z3 nec-mRNR-NP, intrateraliai) gydytų schema ir Kaplan-Meier išgyvenamumo kreivės. mack-mRNA-NP, 5 × 10 10 vg Z3 AAV arba jo nėra), tada pašalinamas iš doksiciklino. C – F grupės, n = 6; A ir B grupės, n = 13, po doksiciklino pašalinimo sumažintos iki n = 4, 20 d. Buvo atlikti log-rank testai. ( b, c ) Reprezentatyvi SP-B išraiška (ruda) plaučių audinyje ( b ) ir anti-SP-B blotai ant ląstelių neturinčio bronchoalveolinio plovimo skysčio supernatanto (10 μg bendro baltymo / juostos) ( c ) iš aprašytų pelių a . Išsamius vakarų matavimo vienetus žiūrėkite papildomame 22 paveiksle. Mastelio juosta, 50 μm. Plovimai ir audiniai buvo surinkti praėjus 20 dienų po doksiciklino pašalinimo. n = 6 pelės kiekvienoje grupėje. d ) Plaučių būklė normalizuojama atsižvelgiant į atitinkamą kūno svorį ( n = 3, A arba B), praėjus 20 dienų po doksiciklino pašalinimo. Pradinis matavimas atliekamas 20 min .; vertės, apskaičiuotos prieš kiekvieną hiperinfliaciją. *** P <0, 001, palyginti su kontrolinėmis grupėmis C – F. Juoda linija su užpildytais trikampiais: teigiamos kontrolės pelės ant doksiciklino. Klaidų juostos, vidurkis ± sd ( e, f ) PGR ant A ir B grupių iš plaučių išskirtos DNR arba netikslinių plaučių; kiekviena juosta žymi atskirą pelę. Mėginiai buvo paimti praėjus 20 dienų po doksiciklino pašalinimo. e ) tikslinio lokuso PGR, atlikus T7 testus. Rodyklės rodo laukiamas juostas. n = 6 pelės kiekvienoje grupėje. f ) PGR naudojant P1 / P3 arba P1 / P2, po to atliekant gelio elektroforezę. #, netikslinė kontrolė; §, A ir B grupių DNR fondas. Rodyklė rodo juostą, susidariusią iš HDR. n = 4 pelės kiekvienoje grupėje. nd, neaptinkamas; ne, netaikoma. g ) Transgeninės SP-B kasetės, CAG integracijos ir pradmenų (P1, P2 ir P3) vietų, skirtų vidiniams PGR, schema. h ) tipiškas A, B grupių ir kontrolinės doksiciklino grupės (+ doksi) imunohistochemija, naudojant du skirtingus anti-3xFLAG antikūnus. Mastelio juosta, 50 μm. Audiniai buvo surinkti praėjus 20 dienų po doksiciklino pašalinimo. n = 6 pelės kiekvienoje grupėje.

Visas dydis

  • Atsisiųskite „Excel“ šaltinio duomenis

Apibendrinant, mes parodėme, kad Z3 nec-mRNR, kompleksuoto į chitozanu padengtas NP ir AAV6 donoro DNR, pristatymas sąlygoja sėkmingą specifinės vietos genomo redagavimą in vivo . Mūsų žiniomis, nė vienas ankstesnis tyrimas neįrodė visą gyvenimą pratęsiančio genų korekcijos plaučiuose. Mūsų tyrimui būdingi tam tikri apribojimai, įskaitant AAV-DNR donoro šablono kartu transfekavimo kartu su nec-mRNR poreikį, trumpą išgijimo trukmę in vivo , tikriausiai dėl natūralios perkeltų plaučių ląstelių populiacijos kaitos ir naudoti transgeninį pelės modelį, kuriame tikslinė dirbtinė kasetė, o ne humanizuotas modelis. Atsižvelgiant į laikiną nec-mRNR veikimo pobūdį, šis terapinis būdas geriausiai tinka daugeliui scenarijų, kai trumpalaikis genomo redagavimas gali turėti ilgalaikę klinikinę naudą.

Metodai

Vietos specifinės nukleazės.

TALEN ir ZFN, nukreipti į transgeninę SP-B kasetę, buvo surinkti naudojant cinko piršto baltymų archyvą, kaip aprašyta anksčiau 13 . Visos Z3 poros aminorūgščių sekos parodytos papildomame 3 paveiksle. ZFN ekspresijos vektorius buvo surinktas taip, kaip aprašyta anksčiau 14 . Atitinkamas plazmidžių konstrukcijas maloniai pateikė „Sangamo BioSciences“ (www.sangamo.com).

Taikymo vektoriai.

Taikymo vektorius, turintis CAG promotorių, buvo surinktas iš sintetinių oligonukleotidų (www.lifetechnologies.com) ir PGR produktų ir buvo patikrintas seka. Visa donoro vektoriaus DNR seka pavaizduota papildomame 5 paveiksle. NheI restrikcijos fragmento ilgio polimorfizmo (RFLP) donoro plazmidė buvo sukonstruota pašalinant CAG promotorių iš nukreipimo vektoriaus NheI skaidymo būdu, paliekant vieną NheI restrikcijos vietą, kuri buvo naudojami RFLP tyrimuose.

Ląstelių kultūra ir transfekcija.

T7 ir HDR tyrimams 1x106 fibroblastai 6 duobučių plokštelėse buvo transfekuoti, kaip nurodyta atitinkamų paveikslų legendose, naudojant Neono elektroporacijos sistemą (www.lifetechnologies.com) su 100 μl galiukais. Elektroporacijos nustatymai buvo 1 650 V, 20 ms, 1 impulsas. A549 ląstelės (žmogaus ATII ląstelės, ląstelių tipas, atsakingos už SP-B ekspresiją plaučiuose) ir MLE12 ląstelės (pelių ATII ląstelės) buvo palaikomos 37 ° C temperatūroje esant 5% CO 2 ir auginamos minimaliai būtinoje terpėje (www.lifetechnologies. com), papildytas 10% FCS, 1% penicilino-streptomicino. Vieną dieną prieš transfekciją 50 000 arba 80 000 ląstelių / šulinyje / 500 μl buvo pasodintos į 24 duobučių plokšteles. Ląstelės (70–90% konfluentų) buvo transfekuotos naudojant 5 μg (T7 analizės, fragmentų analizės ir RFLP) arba 1 μg Z3 poros nec-mRNR (laiko tėkmės eksperimentas), naudojant Neono elektroporaciją (www.lifetechnologies.com) su transfekcija. sumaišykite 100 μl tūrį pagal gamintojo nurodymus arba perduokite su daugybe infekcijų (MOI) 1 × 10 6 vg kiekvieno Z3 AAV6. 1d paveiksle pavaizduotiems transfekcijos eksperimentams mes subalansavome DNR kiekį pridėdami inertinės (tuščios vektorinės) DNR, iš viso po 9 μg. Transdukcijai ląstelės vieną kartą buvo plaunamos PBS ir kultivuojamos OptiMEM; Praėjus 6 valandoms po transdukcijos, buvo tiekiama 10% FCS. Po 24 valandų terpė buvo pašalinta, ląstelės vieną kartą plaunamos PBS ir pridedama šviežios terpės. Pirminiai fibroblastai iš transgeninių SP-B pelių buvo gauti pašalinant nugaros odą, po to epidermį atskyrus nuo dermos naudojant dispazę. Po to, kai derma buvo virškinama naudojant kolagenazę, suspensija buvo perpilama per 70 μm filtrą. Po plovimo ir centrifugavimo ląstelių nuosėdos buvo resuspenduotos fibroblastų auginimo terpėje (DMEM / Ham's F-12 terpėje su L-gliutaminu, 10% MSC laipsnio vaisiaus veršelio serumo, 1 × MEM neesminių amino rūgščių, 1 × natrio piruvato, 1). % penicilino / streptomicino, 0, 1 mM 2-merkaptoetanolio). Laiko tėkmės eksperimentams: 1, 2, 3, 4, 5 ir 14 dienų po transfekcijos A549 ląstelės buvo surinktos, permeabiliuotos naudojant BD Cytofix / Cytoperm plus (www.bd.com), dažytos APC anti-DYKDDDK klonu L5 ( www.biolegend.com) antikūnas ir ištirtas naudojant LSR-I srauto citometrą (//www.bd.com/); duomenys buvo analizuojami naudojant „BD FACSDiva“ programinę įrangą (//www.bd.com/).

Neklasifikuotos mRNR generavimas.

Norėdami sukurti šablonus transkripcijai in vitro , 3xFLAG pažymėti T-1 ir Z3 buvo išpjaustyti iš pradinių vektorių ir subklonuoti į PolyA-120, turinčią pVAX1 (www.lifetechnologies.com). Plazmidės buvo linearizuotos XbaI ir transkribuotos in vitro, naudojant MEGAscript T7 Transkripcijos rinkinį (www.lifetechnologies.com), turinčius 25% 2-tio-UTP ir 25% 5-metil-CTP arba 100% PseudoUTP ir 100% 5-metilą. -CTP (visi iš www.trilinkbiotech.com). Antivirusinės CAP analogų (ARCA) užfiksuotos susintetintos nec-mRNR buvo išgrynintos naudojant MEGAclear rinkinį (www.lifetechnologies.com) ir ištirtos pagal agarozės gelių dydį bei grynumą ir koncentraciją „NanoPhotometer“ (//www.implen.com). ).

T7 nukleazės tyrimas.

Genomo DNR buvo išgauta iš fibroblastų, naudojant „DNeasy Blood & Tissue Kit“ (www.qiagen.com). 50 μl PGR reakcija buvo atlikta naudojant 100 ng gDNR, gauto iš fibroblastų, anksčiau perkeltų į 5 μg T-1 arba Z3 porą, 0, 5 μM pradmenis (T-1: fwd, „P3“ GTAGGCGTGTACGGTGGGAG; rev, „P1“). CAGCAGAGGGTAGGAAGCAGC; skirtas Z3: fwd, TGTACGGTGGGAGGCCTAT; rev, CCTGGCAGGTGATGTGG) ir „AmpliTaq Gold 360 Mastermix“ (www.lifetechnologies.com). Kita PGR reakcija buvo atlikta naudojant tuos pačius pradmenų rinkinius, bet su gDNR iš neperkeltų ląstelių. PGR produktai buvo testuojami agarozės geliais, kad būtų galima patikrinti dydį ir pakankamą amplifikaciją, sujungti, išgryninti nusodinant etanoliu, ištirpinti 20 μl vandens ir DNR koncentracija buvo matuojama „NanoPhotometer“. 2 μl NEBuffer 2 (www.neb.com), 2 μg išgryninto PGR produkto ir vandens įpilama į bendrą 19 μl tūrį. DNR buvo hibridizuota termociklere pagal šį protokolą: 95 ° C 5 minutes, 95–85 ° C esant –2 ° C / s, 85–25 ° C esant –0, 1 ° C / s, palaikoma 4 ° C. Pridedama 1 μl (10 V) T7E1 (www.neb.com, M0302L) ir inkubuojama 37 ° C temperatūroje 15 min. Reakcija buvo sustabdyta pridedant 2 μl 0, 25 M EDTA. Reakcija vėl buvo išgryninta nusodinant etanoliu ir ištirpinta 15 μl vandens. Nukleazės specifiniai skilimo produktai buvo nustatyti agarozės geluose. Juostos intensyvumas buvo išmatuotas naudojant „ImageJ“ (//rsb.info.nih.gov/ij/).

Neišmatuojamam poveikiui išmatuoti A549 ląstelės buvo transfekuotos 5 μg mRNR arba perkeistos 1 × 10 5 vg AAV6-Z3. PGR ir T7 buvo atlikti taip, kaip aprašyta aukščiau (pradmenys: 1 tikslo neatitinkantis: fwd, GCAAGTTTGGCGTCGCTCCA; rev, AGAGGAAGGCGCGGCAGG; 2 tikslinis rodiklis: fwd, TTCTTGCTCCAGTGACTCTCTTA; rev, AGCCTAGTAGTAGGAG; išjungti-4 tikslas: Pers, CTGGAGATGCATCCTTGTCTGT; aps, GAGGGTGAAGACTTTTGGAGCT pašalinį tikslinė 5: Pers, CAGCACCAGATGTTCCCTGTTA; aps, TGGAAAGCAATAGTTCTAGGATGA pašalinį taikinio 6: Pers, GAGGCTGTGTCACTAGCAGGA; aps, CAAAGTGGTACCTTGGCAAGAG pašalinį taikinio 7: Pers, AGAAAGCCAGCTGAGTACCA; aps, TGTTGGCTTGTTTGGACTCATG pašalinį tikslinė 8: Pers, TGACTACAATCATGCTTCTTGGTT; aps, TGTAGGCCTTCAGTGATCTAGG pašalinį taikinio 9: FWD, AAGGACTTCATCTTTGCTGGAT; aps, GAATCAACAGCCTGGCAGC pašalinį taikinio 10: FWD, ACATTTTCTGGAGTGTAGTGTG; rev, GCTCTTTCGGTAACACAGTTCTT).

HDR / RFLP tyrimas.

Genomo DNR buvo išgauta iš fibroblastų ar plaučių audinio, naudojant DNeasy Blood & Tissue Kit (www.qiagen.com). T-1 arba Z3 tiksliniai lokusai buvo amplifikuoti PGR (40 ciklų, atkaitinimas 58 ° C temperatūroje ir 30 s prailginimas 72 ° C temperatūroje; 5 min. 72 ° C, kad būtų užtikrinta amplikonų baigtis), naudojant 0, 5 μM pradmenis T-1fwd (GTAGGCGTGTACGGTGGGAG ) ir T-1rev (CAGCAGAGGGTAGGAAGCAGC), taip pat P1 ir P3 (žr. aukščiau) su „AmpliTaq Gold 360 Mastermix“. Be to, vidinės PGR reakcijos buvo atliktos naudojant pradmenis P1 ir P2 (AGGCACTGGGCAGGTAAGTA) (žr. Papildomą 20 pav.).

Srauto citometrija.

Nuimti plaučiai buvo suardomi 37 ° C temperatūroje 1 val. Sukamajame purtiklyje 1 mg / ml I tipo kolagenazės (www.lifetechnologies.com), 1% (500 V) DNase (www.epibio.com) tirpale. Virškinamas plaučiai buvo perduoti per 40 μm nailono ląstelių kamštį, o eritrocitai buvo lizuojami naudojant ACK lizuojantį buferį (www.lifetechnologies.com). PE anti-CD45 klonas 30-F11, PE anti-CD31 klonas C13.3, APC anti-pelės Ly-6A (Sca-1) D7 klonas (www.biolegend.com), FITC anti-FLAG M2 ir anti-clara ląstelės. sekreciniai baltymai (www.sigmaaldrich.com) buvo naudojami dažyti plaučių ląsteles. Po tarpląstelinių žymeklių dažymo ląstelės buvo fiksuotos ir permeabilizuotos naudojant BD Cytofix / Cytoperm plus (www.bd.com), po to nudažytos tarpląsteliniais antikūnais. Srauto citometro analizė buvo atlikta naudojant LSR-I srauto citometrą (www.bd.com), o duomenys buvo analizuojami naudojant BD FACSDiva programinę įrangą (www.bd.com).

ATII ir Clara ląstelės buvo rūšiuojamos FACSAria (www.bd.com).

Nanodalelės.

Chitozano (83% deacetiluotas (Protasan UP CL 113, www.novamatrix.biz)) dengtos PLGA (poli-D, L-laktidų ko-glikolidas 75:25 (Resomer RG 752H, www.evonik.de)) nanodalelės (trumpai: NP) buvo paruošti naudojant emulsijos difuzijos-garinimo 15. su nedideliais pakeitimais. Trumpai tariant, 100 mg PLGA buvo ištirpinta etilo acetate ir lašinama į vandeninį 2, 5% PVA tirpalą (polivinilo alkoholis, Mowiol 4-88, www.kuraray). eu), kuriame yra 15 mg chitozano. Ši emulsija maišoma (1, 5 val. kambario temperatūroje) ir po to homogenizuojama esant 10 000 sūkių per minutę 10 minučių, naudojant „Polytron PT 2500E“ (www.kinematica.ch). Šios teigiamai įkrautos NP buvo steriliai filtruojamos ir apibūdinamos Malvern ZetasizerNano ZSP (hidrodinaminis skersmuo: 157, 3 ± 0, 87 nm, PDI 0, 11, zeta potencialas +30, 8 ± 0, 115 mV). Po dalelių susidarymo jie buvo įpilti mRNR maišant (masės santykis, 25: 1).

AAV vektorių gamyba.

AAV 6 serotipo vektoriai iš Z3 poros ir donoro seka buvo pagaminti ir įsigyti iš „Virovek“ (www.virovek.com).

Eksperimentai su gyvūnais.

6-8 savaičių BALB / c pelės (www.criver.com) ir transgeninės SP-B pelės 6 (SP-C rtTA / (teto) 7 SP-B / SP-B - / - ) buvo laikomos specifinėmis sąlygomis be patogenų ir buvo laikomos 12–12 h šviesos / tamsos ciklu. Visi gyvūnai buvo aprūpinti maistu ir vandeniu ad libitum ir buvo aklimatizuojami mažiausiai 7 dienas iki atitinkamo eksperimento pradžios. Transgeninės SP-B pelės buvo šeriamos maistu, kurio sudėtyje yra doksiciklino, iki nutraukimo (kontrolinės ir pagrindinės grupės 0 diena). Visas procedūras gyvūnams patvirtino ir kontroliavo vietos etikos komitetas ir jos buvo vykdomos pagal Vokietijos gyvūnų apsaugos apsaugos įstatymus.

Intratrahealinė injekcija.

BALB / c arba transgeninės SP-B pelės buvo anestezuojamos į pilvaplėvės ertmę medetomidino (0, 5 mg / kg), midazolamo (5 mg / kg) ir fentanilo (50 μg / kg) mišiniu ir suspenduotos ant pelių intubacijos platformos (www. penncentury.com, MIP modelis) 45 ° kampu viršutiniai dantys. Optimaliam trachėjos apšvietimui buvo naudojamas mažų gyvūnų laringoskopas (www.penncentury.com). „Microsprayer Aerosolizer“ - „IA-1C“ modelis, sujungtas su aukšto slėgio švirkštu „FMJ-250“ (abu iš www.penncentury.com), buvo įdėtas į endotelį ir įtaisytas PBS, 20 μg Z3 nec-mRNR, plika arba kompleksiška su NP, arba AAV6 (www .virovek.com) buvo naudojamas 100 μl tūris. „Microsprayer“ antgalis buvo pašalintas po 10 s, priešnuodis buvo sušvirkštas po oda (atipamezolas (50 μg / kg), flumazenilis (10 μg / kg) ir naloksonas (24 μg / kg)), o pelė buvo pašalinta iš atramos po 2 min. .

Kvėpavimo takų atitiktis.

Atitiktis buvo nustatyta naudojant ex vivo izoliuoto perfuzinio plaučio modelį, kaip aprašyta anksčiau (IPL, Harvardo aparatūra) 4, 16 . Siekiant sumažinti kintamumą, visos pelės buvo gydomos, o vėliau per nustatytą laikotarpį buvo išskirti plaučiai. Trumpai tariant, in situ pelės plaučiai buvo dedami į krūtinės ląstos kamerą, o pelės buvo vėdinamos trachėjos kaniuliu. Ventiliacijos greitis buvo nustatytas 90 įkvėpimų per minutę, esant neigiamo slėgio ventiliacijai nuo –2, 8 cm H 2 O iki 8, 5 cm H 2 O. Norėdami išvengti atelektazės, kas 5 min. Buvo suveikiama hiperinfliacija (–25 cm H 2 O). Plaučiai perfuzuojami per plaučių arteriją naudojant 4% hidroksietilo krakmolą, kuriame yra perfuzijos buferis (srautas 1 ml / min.). Plaučių funkcijos parametrai buvo užregistruoti automatiškai, o atitiktis apskaičiuota naudojant HSE-HA Pulmodyn W Software (Harvardo aparatūra). Grafinei ir statistinei analizei buvo apskaičiuotos vidutinės atitikties vertės iš paskutinių dešimties laiko žymių (40 s) per kiekvieną 5 minučių periodą (tarp dviejų hiperinfliacijų). Dvi D grupės pelės buvo per daug sergančios išmatuoti, o prieš analizę buvo pažeisti vienos F grupės pelės plaučiai.

Kvėpavimo takų pasipriešinimas.

Kvėpavimo takų atsparumas mechaolinui (MCh, acetil-β-metilcholino chloridas; Sigma-Aldrich) vėl buvo nustatytas naudojant izoliuoto perfuzinio plaučio ex vivo modelį (IPL, www.harvardapparatus.com) 4, 16 . Trumpai tariant, atlikus 20 minučių pradinį matavimą, plaučiai buvo perfuzuojami didėjančiomis MCh koncentracijomis (0, 1 μM, 1 μM, 10 μM ir 100 μM) 10 min. Kiekvienam, atskiriant 10 minučių plovimo periodu perfuzijos buferiu. Plaučių funkcijos parametrai buvo užregistruoti automatiškai, o kvėpavimo takų pasipriešinimas užfiksuotas naudojant „HSE-HA Pulmodyn W Software“ (www.harvardapparatus.com). Grafinei ir statistinei analizei buvo apskaičiuotos vidutinės pasipriešinimo vertės iš paskutinių dešimties laiko žymių (40 s) kiekvienoje 10 min. MCh ekspozicijoje.

Histopatologija.

Pelės plaučiai buvo fiksuojami 4, 5% Histofix (www.carlroth.com) 4 ° C temperatūroje per naktį. Fiksuoti plaučiai buvo įterpti į parafiną, o pjūviai buvo nudažyti H&E arba paviršiaus aktyviuoju baltymu DAB (pelių monokloniniu anti-SP-B antikūnu (www.abcam.com, ab3282), Zytochem Plus HRP One-Step Polymer anti-mouse). / triušis / žiurkė (www.zytomed-systems.com, ZUC53-006) ir DAB substrato rinkinys peroksidazei (www.vectorlabs.com, SK-4100).) 3xFLAG FITC fluorescencinis dažymas (monokloninis anti-FLAG M2-FITC antikūnas ( www.sigma-aldrich.com, F4049)) ir DAPI įtempimas (www.applichem.com, A1001) buvo tiriamas naudojant Zeiss Axio Imager.

3xFLAG Cy3 fluorescenciniam dažymui triušio polikloniniai DDDDK žymėjimo antikūnai (www.abcam.com, ab21536) buvo naudojami kaip pirminis antikūnas, ožkų anti-triušio Cy3 antikūnai (www.jacksonimmuno.com, 111-165-144) buvo naudojami kaip antriniai. antikūnas kartu su DAPI (www.applichem.com, A1001).

Western blot analizė.

Baltymai nuo bronchoalveolinio plovimo skysčio buvo atskirti „NuPAGE 10% Bis-Tris Plus“ geluose ir „NuPAGE Mini Gel Tank“ (visi iš www.lifetechnologies.com), o imunoblotai buvo atlikti standartinėmis procedūromis pagal gamintojo instrukcijas, naudojant „XCell II Mini“. -Cell ir blot moduliai (www.lifetechnologies.com). Po blokavimo 2 valandas kambario temperatūroje, pirminis antikūnas prieš SP-B (maloniai parūpintą MG) arba ANTI-FLAG M2 (www.sigmaaldrich.com) buvo inkubuojami per naktį, su krienų peroksidaze konjuguotais antriniais antikūnais (anti-triušiu iš www. dianova.com) buvo inkubuojami 1 val. Blotai buvo apdoroti naudojant „ECL Prime Western Blot Detection Reagents“ (www.gelifesciences.com). Pusiau kiekybinė analizė buvo atlikta naudojant „Quantity One“ programinę įrangą (www.bio-rad.de).

Tikslo vietos sekos nustatymas.

Pagal gamintojo protokolą, naudojant „NucleoSpin Tissue Kit“ (www.mn-net.com) buvo išskirtos genominės DNR iš pirminių fibroblastų ( in vitro perkeltos / perduotos) arba išrūšiuotų ATII ląstelių (po in vivo transfekcijos / transdukcijos). Amplikonai buvo gauti iš PGR su pradmenimis P1 ir P2 (žr. Sekas aukščiau), naudojant šias sąlygas: AmpliTaq Gold 360 pagrindinis mišinys (www.lifetechnologies.com) esant 95 ° C 10 min., 95 ° C 30 s, 60 ° C. 30 s, 72 ° C 60 s, iš viso 35 ciklai ir paskutinis pratęsimo žingsnis 72 ° C temperatūroje 7 minutes. Amplikonai buvo klonuoti į pCR-TOPO vektorių (www.lifetechnologies.com) ir sekuojami naudojant pradmenis M13forward (GTAAAACGACGGCCAGTG) ir M13 atvirkštinius (CAGGAAACAGCTATGACCATG). Derinimai buvo atlikti su „Geneious R6“ (www.biomatters.com), naudojant „daugialypio suderinimo“ funkciją, pasirinkus 65% panašumo sąnaudų matricą (5, 0 / −4, 0), atotrūkio atotrūkį 12 ir atotrūkio padidinimo baudą 3.

Realaus laiko RT-PGR.

Plaučių ląstelių atskyrimai tris kartus buvo stipriai plaunami PBS, kad būtų išvengta plaučių ląstelių nepaimtos RNR pernešimo (trečiasis supernatantas vėliau buvo patikrintas dėl RNR užterštumo, naudojant toliau aprašytą qPCR procedūrą). Tada RNR buvo išskirta naudojant „RNeasy“ gryninimo rinkinį (www.qiagen.com). 50 ng RNR atvirkštinė transkripcija buvo atlikta naudojant „iScript“ cDNR sintezės rinkinį (www.bio-rad.com). Z3 cDNR aptikimas buvo atliktas naudojant SYBR-Green pagrįstą kiekybinį realaus laiko PGR naudojant 20 μl reakcijas ViiA7 (www.lifetechnologies.com). Reakcijos buvo inkubuojamos 10 min. 95 ° C temperatūroje, po to sekė 40 ciklų po 15 s, esant 95 ° C, ir 2 min., Esant 50 ° C (atkaitinimas ir prailginimas), po to atlikta standartinė lydymosi kreivės analizė. Buvo naudojamos šios grunto poros: Z3 kairysis fwd TGTACGGCTACAGGGGAA, Z3 kairysis rev GCCGATAGGCAGATTGTA; optimaliai nustatytas namų ūkio genas beta-aktinas: fwd TAGGCACCAGGGTGATG, rev GCCATGTTCAATGGGGTACT.

Statistika.

MRNR raiškos skirtumai tarp grupių buvo analizuojami poriniais fiksuotos perskirstymo atsitiktinės atrankos tyrimais naudojant REST 2009 programinę įrangą 17 . Visos kitos analizės buvo atliktos naudojant Wilcoxon-Mann-Whitney testą su SPSS 21 (www.ibm.com). Duomenys pateikiami kaip vidurkis ± sem arba kaip mediana ± IQR (tarpkvartiliniai diapazonai), o P <0, 05 (dvipusė) buvo laikoma statistiškai reikšminga. Išgyvenamumo tyrimams atlikti log-rank testai. Statistiniai duomenys apie atitikimą plaučiams buvo atlikti naudojant dvipusius ANOVA ir Bonferroni post testus su „GraphPad Prism 5.0“ programine įranga. Duomenys apie plaučių funkciją pateikiami kaip vidurkis ± sd, o P <0, 05 (dvipusis) buvo laikomas statistiškai reikšmingu. Eksperimentams su gyvūnais randomizacija nebuvo naudojama. Visais atvejais, išskyrus tuos atvejus, kai AAV6 / mRNR buvo skiriama intarpą, tyrėjai buvo aklai vertindami rezultatus.

Papildoma informacija

PDF failai

  1. 1.

    Papildomas tekstas ir figūros

    Papildomi 1–22 paveikslai, papildomos sekos ir papildoma diskusija